Starting /dee2/code/volunteer_pipeline.sh ERR3317464 current disk space = 1524953178112 free memory = 1602344652 ERR3317464 SRAfilesize 2537210bca58b6c16e2cd3e27226313c ERR3317464.sra ERR3317464.sra file validated ERR3317464 is paired end ERR3317464 is conventional basespace ERR3317464 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62275 34.0 31.0 34.0 31.0 34.0 2 32.374 34.0 31.0 34.0 31.0 34.0 3 32.86325 34.0 31.0 34.0 31.0 34.0 4 36.36825 37.0 37.0 37.0 35.0 37.0 5 36.37675 37.0 37.0 37.0 35.0 37.0 6 36.22225 37.0 37.0 37.0 35.0 37.0 7 36.33525 37.0 37.0 37.0 35.0 37.0 8 36.38025 37.0 37.0 37.0 35.0 37.0 9 38.20375 39.0 39.0 39.0 37.0 39.0 10-11 38.14975 39.0 39.0 39.0 36.0 39.0 12-13 38.135625000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.726749999999996 41.0 40.0 41.0 37.0 41.0 16-17 39.693 41.0 40.0 41.0 37.0 41.0 18-19 39.641 41.0 40.0 41.0 37.0 41.0 20-21 39.65325 41.0 40.0 41.0 37.0 41.0 22-23 39.5305 41.0 40.0 41.0 37.0 41.0 24-25 39.383875 41.0 39.0 41.0 36.0 41.0 26-27 39.2175 41.0 39.0 41.0 36.0 41.0 28-29 39.15975 41.0 39.0 41.0 36.0 41.0 30-31 39.0235 40.5 39.0 41.0 35.5 41.0 32-33 38.763374999999996 40.0 38.0 41.0 35.0 41.0 34-35 38.432125 40.0 38.0 41.0 33.5 41.0 36-37 38.282624999999996 40.0 38.0 41.0 34.0 41.0 38-39 38.123374999999996 40.0 38.0 41.0 33.5 41.0 40-41 37.91975 40.0 38.0 41.0 33.0 41.0 42-43 37.981625 40.0 38.0 41.0 33.0 41.0 44-45 37.73625 40.0 37.0 41.0 32.5 41.0 46-47 37.40475 40.0 36.5 41.0 32.5 41.0 48-49 37.111374999999995 40.0 36.0 41.0 31.0 41.0 50-51 37.37 40.0 36.0 41.0 32.5 41.0 52-53 37.205625 40.0 36.0 41.0 32.0 41.0 54-55 36.886375 39.5 35.0 41.0 31.5 41.0 56-57 36.59425 39.0 35.0 41.0 31.0 41.0 58-59 36.362750000000005 39.0 35.0 41.0 31.0 41.0 60-61 36.001999999999995 38.0 35.0 41.0 30.5 41.0 62-63 35.721125 37.0 35.0 40.0 30.5 41.0 64-65 35.38375 37.0 35.0 40.0 30.0 41.0 66-67 34.926125 36.0 34.5 39.0 29.5 41.0 68-69 34.523250000000004 35.5 34.0 39.0 29.0 41.0 70-71 34.107 35.0 34.0 38.5 29.0 40.5 72-73 33.714625 35.0 34.0 37.0 28.0 39.5 74-75 33.3755 35.0 34.0 37.0 28.0 39.0 76-77 32.075875 34.5 32.0 35.5 25.5 37.5 78-79 32.516875 35.0 33.0 36.0 26.5 37.0 80-81 32.300125 35.0 33.0 35.5 26.0 37.0 82-83 32.058875 35.0 33.0 35.0 26.0 37.0 84-85 31.698999999999998 35.0 33.0 35.0 24.0 36.0 86-87 31.4685 35.0 33.0 35.0 24.0 36.0 88-89 31.227625 35.0 33.0 35.0 23.0 36.0 90-91 30.966875 35.0 32.0 35.0 21.5 35.0 92-93 30.74525 35.0 32.0 35.0 20.0 35.0 94-95 30.449125 35.0 32.0 35.0 16.5 35.0 96-97 30.08325 35.0 31.5 35.0 4.5 35.0 98-99 29.647125 35.0 31.5 35.0 2.0 35.0 100-101 27.19675 33.0 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 4.0 10 2.0 11 5.0 12 9.0 13 10.0 14 13.0 15 11.0 16 7.0 17 10.0 18 15.0 19 18.0 20 14.0 21 21.0 22 13.0 23 18.0 24 30.0 25 20.0 26 29.0 27 35.0 28 43.0 29 47.0 30 59.0 31 80.0 32 112.0 33 119.0 34 207.0 35 301.0 36 516.0 37 991.0 38 1090.0 39 148.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.550209205020924 25.83682008368201 18.305439330543933 26.30753138075314 2 27.425 25.650000000000002 17.575 29.349999999999998 3 27.125 25.15 18.175 29.549999999999997 4 28.95 23.849999999999998 16.400000000000002 30.8 5 27.875 24.925 16.1 31.1 6 27.375 29.125 18.775 24.725 7 28.95 24.075 23.325000000000003 23.65 8 31.35 26.450000000000003 24.224999999999998 17.974999999999998 9 32.1 26.950000000000003 24.2 16.75 10-11 32.2125 27.0625 22.125 18.6 12-13 29.975 26.25 24.2875 19.4875 14-15 26.737499999999997 26.85 25.025 21.3875 16-17 26.325 26.0375 26.0625 21.575 18-19 25.5125 26.3125 26.1 22.075 20-21 24.725 27.250000000000004 25.7375 22.287499999999998 22-23 25.474999999999998 26.787499999999998 25.2625 22.475 24-25 25.337500000000002 26.200000000000003 25.624999999999996 22.8375 26-27 25.1875 26.200000000000003 26.075 22.537499999999998 28-29 25.624999999999996 26.700000000000003 25.3125 22.3625 30-31 26.8125 26.387500000000003 24.0625 22.7375 32-33 25.7375 26.775 25.3125 22.175 34-35 25.137500000000003 26.05 24.9875 23.825 36-37 25.474999999999998 27.05 25.112499999999997 22.3625 38-39 24.9375 26.200000000000003 25.9875 22.875 40-41 24.2875 25.275 26.8 23.6375 42-43 25.837500000000002 25.162499999999998 26.2875 22.7125 44-45 25.900000000000002 26.85 24.85 22.400000000000002 46-47 26.85 25.637500000000003 24.337500000000002 23.175 48-49 25.474999999999998 25.937500000000004 26.437500000000004 22.15 50-51 26.224999999999998 26.0375 24.962500000000002 22.775000000000002 52-53 25.75 26.087500000000002 24.2875 23.875 54-55 26.05 26.5 24.8625 22.5875 56-57 25.7 25.9875 26.075 22.237499999999997 58-59 25.9625 26.450000000000003 24.3875 23.200000000000003 60-61 24.637500000000003 25.874999999999996 25.337500000000002 24.15 62-63 26.087500000000002 26.0375 24.875 23.0 64-65 25.6125 26.6625 24.5125 23.2125 66-67 24.2375 25.775 26.0125 23.974999999999998 68-69 26.0625 27.037499999999998 24.087500000000002 22.8125 70-71 25.650000000000002 26.85 24.087500000000002 23.4125 72-73 25.0125 26.125 26.05 22.8125 74-75 25.374999999999996 26.2625 24.85 23.5125 76-77 26.0625 26.6625 23.6625 23.6125 78-79 25.85 26.85 24.525 22.775000000000002 80-81 25.5375 26.7625 24.5 23.200000000000003 82-83 25.4625 26.4625 25.074999999999996 23.0 84-85 25.9875 26.3625 24.65 23.0 86-87 25.2375 27.6875 23.724999999999998 23.35 88-89 25.650000000000002 27.3875 24.05 22.912499999999998 90-91 25.575 27.037499999999998 24.125 23.2625 92-93 24.5375 27.125 24.525 23.8125 94-95 25.0375 26.724999999999998 24.2 24.0375 96-97 26.625 26.775 23.9875 22.6125 98-99 25.412499999999998 26.8625 24.0125 23.7125 100-101 24.2875 26.974999999999998 24.4125 24.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 2.0 24 2.5 25 1.5 26 2.5 27 4.0 28 4.5 29 7.5 30 15.0 31 16.5 32 14.5 33 21.5 34 28.0 35 37.0 36 52.0 37 71.5 38 73.5 39 94.5 40 135.5 41 146.5 42 159.0 43 172.0 44 193.5 45 214.0 46 211.0 47 206.5 48 193.5 49 181.5 50 175.5 51 159.5 52 137.5 53 116.0 54 107.5 55 103.0 56 88.5 57 75.0 58 70.5 59 70.0 60 59.0 61 51.0 62 49.5 63 47.5 64 46.5 65 39.5 66 35.0 67 32.5 68 29.5 69 30.5 70 30.0 71 27.0 72 23.0 73 22.0 74 19.5 75 15.0 76 14.0 77 10.5 78 6.5 79 7.0 80 6.0 81 2.0 82 2.0 83 2.5 84 2.0 85 2.0 86 3.0 87 2.0 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.43989769820972 96.22500000000001 2 1.1764705882352942 2.3 3 0.20460358056265981 0.6 4 0.07672634271099744 0.3 5 0.051150895140664954 0.25 6 0.025575447570332477 0.15 7 0.025575447570332477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTG 7 0.17500000000000002 No Hit ACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAAC 6 0.15 No Hit TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGAT 5 0.125 No Hit ATGCCAGGTGTTATACCAGTAGCTTCAGGTGGTATTCATGTTTGGCATAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1125 0.0 0.0 0.0 0.0 28-29 0.16249999999999998 0.0 0.0 0.0 0.0 30-31 0.1875 0.0 0.0 0.0 0.0 32-33 0.21250000000000002 0.0 0.0 0.0 0.0 34-35 0.2375 0.0 0.0 0.0 0.0 36-37 0.3125 0.0 0.0 0.0 0.0 38-39 0.4125 0.0 0.0 0.0 0.0 40-41 0.525 0.0 0.0 0.0 0.0 42-43 0.6125 0.0 0.0 0.0 0.0 44-45 0.7 0.0 0.0 0.0 0.0 46-47 0.7875000000000001 0.0 0.0 0.0 0.0 48-49 0.85 0.0 0.0 0.0 0.0 50-51 0.9625 0.0 0.0 0.0 0.0 52-53 1.1124999999999998 0.0 0.0 0.0 0.0 54-55 1.275 0.0 0.0 0.0 0.0 56-57 1.4625 0.0 0.0 0.0 0.0 58-59 1.7875 0.0 0.0 0.0 0.0 60-61 2.0999999999999996 0.0 0.0 0.0 0.0 62-63 2.4 0.0 0.0 0.0 0.0 64-65 2.7875 0.0 0.0 0.0 0.0 66-67 3.1625 0.0 0.0 0.0 0.0 68-69 3.55 0.0 0.0 0.0 0.0 70-71 3.8625 0.0 0.0 0.0 0.0 72-73 4.175000000000001 0.0 0.0 0.0 0.0 74-75 4.6375 0.0 0.0 0.0 0.0 76-77 5.275 0.0 0.0 0.0 0.0 78-79 6.025 0.0 0.0 0.0 0.0 80-81 6.6125 0.0 0.0 0.0 0.0 82-83 7.1 0.0 0.0 0.0 0.0 84-85 7.7 0.0 0.0 0.0 0.0 86-87 8.45 0.0 0.0 0.0 0.0 88-89 9.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317464 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.99125 33.0 31.0 34.0 30.0 34.0 2 32.09275 34.0 31.0 34.0 30.0 34.0 3 32.01125 34.0 31.0 34.0 30.0 34.0 4 35.21 37.0 35.0 37.0 33.0 37.0 5 35.42575 37.0 35.0 37.0 33.0 37.0 6 35.605 37.0 36.0 37.0 35.0 37.0 7 35.685 37.0 37.0 37.0 35.0 37.0 8 35.6755 37.0 37.0 37.0 35.0 37.0 9 37.33725 39.0 39.0 39.0 35.0 39.0 10-11 37.43875 39.0 39.0 39.0 35.0 39.0 12-13 37.460125 39.0 39.0 39.0 35.0 39.0 14-15 38.964124999999996 41.0 40.0 41.0 36.0 41.0 16-17 38.94325 41.0 40.0 41.0 36.0 41.0 18-19 38.799125000000004 41.0 39.5 41.0 35.5 41.0 20-21 38.797375 41.0 39.0 41.0 36.0 41.0 22-23 38.742875 41.0 39.0 41.0 35.0 41.0 24-25 38.690124999999995 41.0 39.0 41.0 35.0 41.0 26-27 38.54425 41.0 39.0 41.0 35.0 41.0 28-29 38.466875 41.0 39.0 41.0 35.0 41.0 30-31 38.366125 41.0 39.0 41.0 35.0 41.0 32-33 38.211625 40.0 38.0 41.0 34.0 41.0 34-35 38.011625 40.0 38.0 41.0 34.0 41.0 36-37 37.909625 40.0 38.0 41.0 33.0 41.0 38-39 37.769999999999996 40.0 38.0 41.0 33.0 41.0 40-41 37.889250000000004 40.0 38.0 41.0 33.0 41.0 42-43 37.855125 40.0 38.0 41.0 33.0 41.0 44-45 37.794624999999996 40.0 38.0 41.0 33.0 41.0 46-47 37.552 40.0 38.0 41.0 33.0 41.0 48-49 37.392875000000004 40.0 37.0 41.0 33.0 41.0 50-51 36.36825 39.0 35.5 40.5 30.5 40.5 52-53 36.41074999999999 39.0 35.5 40.5 30.5 41.0 54-55 36.679125 40.0 36.0 41.0 31.0 41.0 56-57 36.482375000000005 39.0 35.0 41.0 31.0 41.0 58-59 36.179249999999996 39.0 35.0 41.0 30.5 41.0 60-61 35.868624999999994 39.0 35.0 41.0 29.5 41.0 62-63 35.580625 38.0 35.0 41.0 29.5 41.0 64-65 35.3235 37.0 35.0 40.0 30.0 41.0 66-67 35.380875 37.0 35.0 40.0 30.5 41.0 68-69 34.954625 36.5 35.0 40.0 29.0 41.0 70-71 34.691500000000005 36.0 35.0 39.0 29.5 41.0 72-73 34.311375 35.5 35.0 39.0 29.0 41.0 74-75 33.968 35.0 34.5 37.5 29.5 39.5 76-77 33.53975 35.0 34.0 37.0 29.0 39.0 78-79 33.199375 35.0 34.0 36.5 29.0 39.0 80-81 32.779125 35.0 34.0 36.0 27.0 37.5 82-83 32.512375 35.0 34.0 36.0 27.0 37.0 84-85 32.354375000000005 35.0 34.0 35.0 27.0 37.0 86-87 32.131875 35.0 33.5 35.0 26.5 36.0 88-89 31.901375 35.0 33.0 35.0 26.0 36.0 90-91 31.680750000000003 35.0 33.0 35.0 24.5 36.0 92-93 31.44725 35.0 33.0 35.0 24.0 35.5 94-95 31.160874999999997 35.0 33.0 35.0 23.5 35.0 96-97 30.94575 35.0 33.0 35.0 20.0 35.0 98-99 30.70275 35.0 33.0 35.0 16.5 35.0 100-101 28.825375 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 5.0 4 4.0 5 5.0 6 6.0 7 2.0 8 4.0 9 3.0 10 3.0 11 6.0 12 13.0 13 9.0 14 11.0 15 6.0 16 6.0 17 12.0 18 8.0 19 9.0 20 9.0 21 12.0 22 17.0 23 12.0 24 13.0 25 22.0 26 19.0 27 26.0 28 35.0 29 35.0 30 44.0 31 61.0 32 67.0 33 89.0 34 171.0 35 243.0 36 455.0 37 927.0 38 1278.0 39 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.549999999999997 12.049999999999999 28.475 29.925 2 25.25 11.75 25.874999999999996 37.125 3 23.025000000000002 12.725 29.025000000000002 35.225 4 25.0 11.325000000000001 27.3 36.375 5 25.324999999999996 13.725000000000001 25.45 35.5 6 27.35 18.875 28.575 25.2 7 20.075000000000003 24.125 39.0 16.8 8 16.5 26.525 36.3 20.674999999999997 9 17.474999999999998 28.225 35.85 18.45 10-11 18.587500000000002 27.0875 32.725 21.6 12-13 19.2125 26.937499999999996 33.2375 20.6125 14-15 19.554888722180543 25.64391097774444 31.682920730182545 23.118279569892472 16-17 19.94248562140535 26.906726681670417 29.844961240310074 23.305826456614152 18-19 21.030257564391096 27.394348587146787 28.557139284821204 23.018254563640912 20-21 20.64266066516629 25.393848462115532 30.070017504376096 23.893473368342086 22-23 21.305326331582897 24.518629657414355 29.43235808952238 24.74368592148037 24-25 20.5625 26.5875 29.037499999999998 23.8125 26-27 20.9875 26.3 28.3875 24.325 28-29 21.65 26.137500000000003 27.025 25.1875 30-31 20.575 25.7875 29.812499999999996 23.825 32-33 22.1375 25.874999999999996 27.6125 24.375 34-35 21.2 24.7 27.675 26.424999999999997 36-37 20.7875 26.4625 28.249999999999996 24.5 38-39 22.6375 24.7875 27.500000000000004 25.074999999999996 40-41 21.7875 24.712500000000002 27.250000000000004 26.25 42-43 21.637500000000003 25.900000000000002 26.8 25.662499999999998 44-45 21.640205025628205 26.22827853481685 26.740842605325664 25.390673834229275 46-47 21.840230028753595 24.94061757719715 26.52831603950494 26.690836354544317 48-49 20.674999999999997 27.500000000000004 27.650000000000002 24.175 50-51 23.025000000000002 25.6 26.8625 24.5125 52-53 21.3625 26.0 26.525 26.1125 54-55 20.125 27.175 29.099999999999998 23.599999999999998 56-57 22.725 24.1875 27.800000000000004 25.2875 58-59 21.8875 24.175 27.3875 26.55 60-61 21.9625 26.875 27.6375 23.525 62-63 22.3 26.2125 26.9125 24.575 64-65 22.400000000000002 25.5125 26.437500000000004 25.650000000000002 66-67 21.212500000000002 26.424999999999997 28.4125 23.95 68-69 23.0 25.937500000000004 26.2125 24.85 70-71 22.0875 25.2625 26.55 26.1 72-73 22.287499999999998 25.2125 27.35 25.15 74-75 23.75 25.45 26.150000000000002 24.65 76-77 23.6375 26.0125 24.224999999999998 26.125 78-79 23.25 26.6125 25.424999999999997 24.712500000000002 80-81 23.6625 25.974999999999998 26.450000000000003 23.9125 82-83 23.400000000000002 24.9125 25.887500000000003 25.8 84-85 24.474999999999998 26.387500000000003 25.75 23.3875 86-87 24.9125 26.1 25.0125 23.974999999999998 88-89 23.275000000000002 26.237500000000004 25.424999999999997 25.0625 90-91 24.1375 27.237499999999997 25.025 23.599999999999998 92-93 24.425 25.662499999999998 25.4875 24.425 94-95 24.8625 25.4625 25.874999999999996 23.799999999999997 96-97 25.4875 26.387500000000003 25.587500000000002 22.537499999999998 98-99 23.4875 26.1625 25.8625 24.4875 100-101 26.0375 25.025 25.2375 23.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 20.0 1 15.5 2 6.5 3 2.0 4 2.0 5 3.0 6 2.5 7 1.0 8 1.0 9 3.5 10 4.0 11 1.0 12 1.5 13 1.5 14 0.5 15 0.5 16 0.5 17 1.5 18 1.5 19 0.5 20 1.0 21 3.0 22 2.5 23 1.5 24 4.0 25 6.0 26 6.0 27 7.0 28 6.0 29 9.5 30 13.5 31 15.0 32 22.0 33 31.0 34 36.0 35 52.0 36 66.5 37 76.5 38 103.0 39 124.0 40 147.0 41 177.0 42 187.0 43 192.0 44 205.0 45 218.0 46 201.0 47 175.5 48 170.0 49 158.5 50 163.0 51 150.0 52 119.0 53 117.0 54 105.5 55 85.0 56 76.0 57 82.0 58 75.0 59 62.5 60 64.5 61 54.5 62 47.0 63 42.0 64 36.5 65 33.5 66 26.0 67 23.5 68 20.5 69 21.5 70 21.5 71 18.0 72 18.0 73 10.0 74 6.5 75 7.0 76 7.0 77 6.5 78 5.0 79 5.0 80 5.0 81 2.5 82 1.0 83 0.5 84 0.5 85 2.0 86 1.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0125 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.89545337785769 96.25 2 0.7706139224248651 1.5 3 0.15412278448497305 0.44999999999999996 4 0.025687130747495505 0.1 5 0.025687130747495505 0.125 6 0.0 0.0 7 0.05137426149499101 0.35000000000000003 8 0.025687130747495505 0.2 9 0.0 0.0 >10 0.05137426149499101 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 29 0.7250000000000001 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 12 0.3 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 8 0.2 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 7 0.17500000000000002 No Hit TCTTCGTATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 7 0.17500000000000002 No Hit TCTTTATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1375 0.0 0.0 0.0 0.0 30-31 0.16249999999999998 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.1875 0.0 0.0 0.0 0.0 36-37 0.2625 0.0 0.0 0.0 0.0 38-39 0.3625 0.0 0.0 0.0 0.0 40-41 0.44999999999999996 0.0 0.0 0.0 0.0 42-43 0.5375000000000001 0.0 0.0 0.0 0.0 44-45 0.625 0.0 0.0 0.0 0.0 46-47 0.7124999999999999 0.0 0.0 0.0 0.0 48-49 0.775 0.0 0.0 0.0 0.0 50-51 0.8875 0.0 0.0 0.0 0.0 52-53 1.0375 0.0 0.0 0.0 0.0 54-55 1.15 0.0 0.0 0.0 0.0 56-57 1.3375 0.0 0.0 0.0 0.0 58-59 1.6625 0.0 0.0 0.0 0.0 60-61 1.95 0.0 0.0 0.0 0.0 62-63 2.25 0.0 0.0 0.0 0.0 64-65 2.6125 0.0 0.0 0.0 0.0 66-67 2.975 0.0 0.0 0.0 0.0 68-69 3.3875 0.0 0.0 0.0 0.0 70-71 3.7375 0.0 0.0 0.0 0.0 72-73 4.075 0.0 0.0 0.0 0.0 74-75 4.5375 0.0 0.0 0.0 0.0 76-77 5.1875 0.0 0.0 0.0 0.0 78-79 5.925 0.0 0.0 0.0 0.0 80-81 6.525 0.0 0.0 0.0 0.0 82-83 7.05 0.0 0.0 0.0 0.0 84-85 7.6625 0.0 0.0 0.0 0.0 86-87 8.412500000000001 0.0 0.0 0.0 0.0 88-89 9.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891656 spots for ERR3317464.sra Written 1891656 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra Read 1891643 spots for ERR3317464.sra Written 1891643 spots for ERR3317464.sra SRR ids: ['ERR3317464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9u1v2ayz ERR3317464.sra spots: 37832873 blocks: [[1, 1891643], [1891644, 3783286], [3783287, 5674929], [5674930, 7566572], [7566573, 9458215], [9458216, 11349858], [11349859, 13241501], [13241502, 15133144], [15133145, 17024787], [17024788, 18916430], [18916431, 20808073], [20808074, 22699716], [22699717, 24591359], [24591360, 26483002], [26483003, 28374645], [28374646, 30266288], [30266289, 32157931], [32157932, 34049574], [34049575, 35941217], [35941218, 37832873]] ERR3317464 file size 9104002 ERR3317464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317464 ERR3317464_1.fastq ERR3317464_2.fastq Input file: ERR3317464_1.fastq Paired file: ERR3317464_2.fastq trimmed: ERR3317464-trimmed-pair1.fastq, ERR3317464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:03:28 2024 >> started Tue Dec 10 10:04:12 2024 >> done (43.539s) 37832873 read pairs processed; of these: 256243 ( 0.68%) short read pairs filtered out after trimming by size control 663965 ( 1.75%) empty read pairs filtered out after trimming by size control 36912665 (97.57%) read pairs available; of these: 12326360 (33.39%) trimmed read pairs available after processing 24586305 (66.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 527 0.00% 19 574 0.00% 20 852 0.00% 21 1027 0.00% 22 1385 0.00% 23 1923 0.01% 24 2387 0.01% 25 2906 0.01% 26 3603 0.01% 27 4141 0.01% 28 4718 0.01% 29 5447 0.01% 30 6380 0.02% 31 8617 0.02% 32 7979 0.02% 33 8644 0.02% 34 10766 0.03% 35 11185 0.03% 36 12646 0.03% 37 13616 0.04% 38 16374 0.04% 39 17277 0.05% 40 18638 0.05% 41 20278 0.05% 42 22032 0.06% 43 23846 0.06% 44 26601 0.07% 45 27436 0.07% 46 29431 0.08% 47 34405 0.09% 48 35701 0.10% 49 37484 0.10% 50 43477 0.12% 51 43494 0.12% 52 44759 0.12% 53 49867 0.14% 54 55122 0.15% 55 58027 0.16% 56 61116 0.17% 57 65767 0.18% 58 69448 0.19% 59 86106 0.23% 60 99300 0.27% 61 105459 0.29% 62 111380 0.30% 63 118589 0.32% 64 127236 0.34% 65 140046 0.38% 66 147653 0.40% 67 145193 0.39% 68 148124 0.40% 69 150576 0.41% 70 157358 0.43% 71 165589 0.45% 72 172908 0.47% 73 179244 0.49% 74 179990 0.49% 75 181315 0.49% 76 182009 0.49% 77 189469 0.51% 78 204349 0.55% 79 202492 0.55% 80 206343 0.56% 81 213753 0.58% 82 211809 0.57% 83 219288 0.59% 84 226401 0.61% 85 240691 0.65% 86 245664 0.67% 87 252489 0.68% 88 258232 0.70% 89 296370 0.80% 90 268171 0.73% 91 280570 0.76% 92 292863 0.79% 93 310130 0.84% 94 341628 0.93% 95 373249 1.01% 96 394194 1.07% 97 450121 1.22% 98 549550 1.49% 99 740054 2.00% 100 1850502 5.01% 101 24586305 66.61% 36912665 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=15 prefix-density=0.57 prefix-fanout=2.6 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=20.72 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=8.8 sequence=GGAGGAGAAGAA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=57.69 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.2 sequence=AGCTTCCTCTGTAATGTACATACCAATCACATCCACTCCTCGATCCACCATGCATCCATACACATAGCATGCATAACACTAGCACGGAGTAGTACTTTACAACACAAATTAAGTGCATTGTCGACCATTTCAACTAGAGAGACATATCGTCCCATCAATCAATTTTACATGCATGCA ERR3317464 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:04:49 Started mapping on | Dec 10 10:04:49 Finished on | Dec 10 10:06:40 Mapping speed, Million of reads per hour | 1197.17 Number of input reads | 36912665 Average input read length | 190 UNIQUE READS: Uniquely mapped reads number | 32185185 Uniquely mapped reads % | 87.19% Average mapped length | 189.43 Number of splices: Total | 19497268 Number of splices: Annotated (sjdb) | 18510119 Number of splices: GT/AG | 19198906 Number of splices: GC/AG | 264379 Number of splices: AT/AC | 14964 Number of splices: Non-canonical | 19019 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.00% Deletion average length | 1.21 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2981126 % of reads mapped to multiple loci | 8.08% Number of reads mapped to too many loci | 167761 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 2.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1927152 1927152 1927152 N_multimapping 2981126 2981126 2981126 N_noFeature 1379734 3447965 29418757 N_ambiguous 969223 294680 19503 UnstrandedReadsAssigned:29836228 PositiveStrandReadsAssigned:28442540 NegativeStrandReadsAssigned:2746925 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=96 echo kmer=91 ERR3317464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317464-trimmed-pair1.fastq ERR3317464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,912,665 reads, 30,542,014 reads pseudoaligned [quant] estimated average fragment length: 182.142 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52973 ERR3317464.ke.tsv 35125 ERR3317464.se.tsv 88098 total ==> ERR3317464.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 755.094 0 0 PNS24247 1044 862.859 53.2443 3.03595 PNS24249 1928 1746.86 80.2315 2.25969 PNS24246 1044 862.859 53.2443 3.03595 PNS24248 1044 862.859 53.2443 3.03595 PNS24244 1471 1289.86 192.036 7.32489 PNS24243 293 139.561 2 0.70506 KQK14069 1603 1421.86 8779.68 303.797 KQK14071 474 301.765 50.6401 8.25632 ==> ERR3317464.se.tsv <== BRADI_1g14170v3 10153 BRADI_1g53295v3 184 BRADI_1g59795v3 846 BRADI_1g07683v3 0 BRADI_1g00485v3 110 BRADI_1g20270v3 1464 BRADI_1g74790v3 422 BRADI_1g09890v3 12 BRADI_1g77505v3 399 BRADI_1g48960v3 0 ERR3317464 completed mapping pipeline successfully