Starting /dee2/code/volunteer_pipeline.sh ERR3317465 current disk space = 1524968636416 free memory = 1534819608 ERR3317465 SRAfilesize 0b3bbc2a19c891d9b586b48f78b08e12 ERR3317465.sra ERR3317465.sra file validated ERR3317465 is paired end ERR3317465 is conventional basespace ERR3317465 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.902 34.0 31.0 34.0 31.0 34.0 2 32.4925 34.0 31.0 34.0 31.0 34.0 3 32.9075 34.0 31.0 34.0 31.0 34.0 4 36.37975 37.0 37.0 37.0 35.0 37.0 5 36.421 37.0 37.0 37.0 35.0 37.0 6 36.2295 37.0 37.0 37.0 35.0 37.0 7 36.3815 37.0 37.0 37.0 35.0 37.0 8 36.42175 37.0 37.0 37.0 35.0 37.0 9 38.211 39.0 39.0 39.0 37.0 39.0 10-11 38.105999999999995 39.0 39.0 39.0 36.0 39.0 12-13 38.134125 39.0 39.0 39.0 37.0 39.0 14-15 39.696125 41.0 40.0 41.0 37.0 41.0 16-17 39.6965 41.0 40.0 41.0 37.0 41.0 18-19 39.71662499999999 41.0 40.0 41.0 37.0 41.0 20-21 39.661 41.0 40.0 41.0 37.0 41.0 22-23 39.55625 41.0 40.0 41.0 37.0 41.0 24-25 39.429500000000004 41.0 39.5 41.0 36.5 41.0 26-27 39.242625000000004 41.0 39.0 41.0 36.0 41.0 28-29 39.138625000000005 41.0 39.0 41.0 35.5 41.0 30-31 39.0055 40.0 39.0 41.0 35.5 41.0 32-33 38.725750000000005 40.0 38.0 41.0 35.0 41.0 34-35 38.526250000000005 40.0 38.0 41.0 34.5 41.0 36-37 38.40075 40.0 38.0 41.0 34.0 41.0 38-39 38.180375 40.0 38.0 41.0 33.5 41.0 40-41 38.016375 40.0 38.0 41.0 33.0 41.0 42-43 37.919875000000005 40.0 38.0 41.0 33.0 41.0 44-45 37.790000000000006 40.0 37.0 41.0 33.0 41.0 46-47 37.5405 40.0 37.0 41.0 32.5 41.0 48-49 37.286125 40.0 36.0 41.0 32.5 41.0 50-51 37.5175 40.0 36.0 41.0 33.0 41.0 52-53 37.453625 40.0 36.0 41.0 33.0 41.0 54-55 37.123374999999996 39.5 35.0 41.0 32.5 41.0 56-57 36.908 39.0 35.0 41.0 32.0 41.0 58-59 36.679249999999996 39.0 35.0 41.0 31.5 41.0 60-61 36.27225 38.0 35.0 41.0 31.0 41.0 62-63 35.954125 37.0 35.0 40.0 31.0 41.0 64-65 35.61425 37.0 35.0 40.0 30.5 41.0 66-67 35.213499999999996 36.0 35.0 39.0 30.0 41.0 68-69 34.878249999999994 36.0 34.5 39.0 30.0 41.0 70-71 34.424875 35.0 34.0 38.5 29.5 40.5 72-73 33.890625 35.0 34.0 37.0 29.0 39.5 74-75 33.534375 35.0 34.0 37.0 29.0 39.0 76-77 32.303125 34.5 32.0 35.5 26.5 38.0 78-79 32.88275 35.0 33.0 36.0 28.5 37.0 80-81 32.66074999999999 35.0 33.0 35.5 27.0 37.0 82-83 32.399125 35.0 33.0 35.0 27.0 36.5 84-85 32.043875 35.0 33.0 35.0 26.0 36.0 86-87 31.775750000000002 35.0 33.0 35.0 25.0 36.0 88-89 31.63 35.0 33.0 35.0 24.5 36.0 90-91 31.43775 35.0 33.0 35.0 24.0 35.0 92-93 31.225 35.0 33.0 35.0 23.5 35.0 94-95 30.970625 35.0 32.0 35.0 22.0 35.0 96-97 30.595374999999997 35.0 32.0 35.0 18.5 35.0 98-99 30.273375 35.0 32.0 35.0 8.5 35.0 100-101 27.780749999999998 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 9.0 11 5.0 12 11.0 13 3.0 14 5.0 15 6.0 16 10.0 17 8.0 18 13.0 19 18.0 20 13.0 21 16.0 22 20.0 23 12.0 24 13.0 25 28.0 26 32.0 27 29.0 28 36.0 29 48.0 30 54.0 31 58.0 32 100.0 33 126.0 34 183.0 35 323.0 36 564.0 37 1009.0 38 1087.0 39 156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.927461139896376 26.580310880829018 19.40414507772021 26.088082901554404 2 27.6 24.099999999999998 19.075 29.225 3 27.750000000000004 25.3 18.2 28.749999999999996 4 27.950000000000003 25.45 17.599999999999998 28.999999999999996 5 29.125 25.674999999999997 15.875 29.325000000000003 6 29.225 28.299999999999997 18.4 24.075 7 32.324999999999996 24.925 20.775 21.975 8 34.325 25.374999999999996 22.475 17.825 9 32.775 26.35 24.025 16.85 10-11 32.125 27.437499999999996 22.825 17.6125 12-13 30.612499999999997 26.1625 24.5125 18.712500000000002 14-15 26.974999999999998 26.724999999999998 25.974999999999998 20.325 16-17 26.637499999999996 26.1625 25.937500000000004 21.2625 18-19 24.9875 27.0875 26.724999999999998 21.2 20-21 25.224999999999998 27.462500000000002 25.474999999999998 21.837500000000002 22-23 26.687499999999996 26.224999999999998 24.925 22.162499999999998 24-25 24.575 26.5125 26.237500000000004 22.675 26-27 25.575 27.0625 24.95 22.412499999999998 28-29 26.3625 27.1625 23.95 22.525000000000002 30-31 25.4625 26.700000000000003 25.2625 22.575 32-33 25.8625 25.9875 26.5875 21.5625 34-35 26.1 27.1 24.325 22.475 36-37 26.1 25.775 26.0 22.125 38-39 25.650000000000002 26.887499999999996 25.4 22.0625 40-41 25.474999999999998 27.85 24.525 22.15 42-43 26.25 26.1625 25.5625 22.025 44-45 26.187500000000004 25.5625 25.95 22.3 46-47 26.025 25.025 24.9125 24.0375 48-49 26.075 26.575 24.875 22.475 50-51 26.900000000000002 26.1625 25.387500000000003 21.55 52-53 26.1125 25.8625 25.174999999999997 22.85 54-55 26.575 26.375 26.150000000000002 20.9 56-57 25.5 27.1125 25.2125 22.175 58-59 25.900000000000002 26.787499999999998 24.3 23.0125 60-61 25.6125 25.724999999999998 26.0625 22.6 62-63 24.925 27.5625 25.162499999999998 22.35 64-65 25.874999999999996 26.125 25.2375 22.7625 66-67 26.0625 25.85 25.5125 22.575 68-69 25.074999999999996 27.400000000000002 24.8125 22.7125 70-71 25.412499999999998 27.437499999999996 24.15 23.0 72-73 25.45 26.5375 24.9375 23.075000000000003 74-75 25.2125 27.0625 25.575 22.15 76-77 25.7125 27.3375 23.6375 23.3125 78-79 24.9875 26.787499999999998 26.200000000000003 22.025 80-81 26.025 27.4125 24.3125 22.25 82-83 26.125 26.325 24.5 23.05 84-85 24.9125 27.1375 24.837500000000002 23.1125 86-87 25.775 26.987499999999997 24.65 22.5875 88-89 26.150000000000002 26.7125 23.2125 23.925 90-91 25.7375 27.125 24.425 22.7125 92-93 25.087500000000002 27.1 24.2375 23.575 94-95 26.25 26.7625 23.5625 23.425 96-97 25.474999999999998 27.1 24.975 22.45 98-99 25.9625 27.0875 24.4 22.55 100-101 25.75 28.0625 23.1625 23.025000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 2.0 21 2.0 22 0.5 23 0.0 24 1.5 25 3.0 26 3.5 27 4.5 28 5.0 29 6.0 30 12.5 31 16.0 32 16.0 33 20.5 34 27.0 35 36.5 36 48.0 37 63.5 38 75.0 39 95.0 40 127.5 41 148.0 42 172.5 43 197.0 44 208.0 45 227.5 46 225.5 47 214.5 48 210.5 49 192.0 50 167.0 51 145.0 52 128.0 53 117.5 54 109.5 55 93.0 56 91.0 57 85.0 58 69.0 59 60.5 60 55.5 61 46.5 62 40.5 63 43.0 64 43.0 65 39.5 66 29.5 67 32.5 68 32.5 69 26.5 70 27.0 71 24.0 72 25.5 73 19.0 74 14.5 75 11.5 76 7.5 77 8.5 78 7.0 79 4.0 80 5.5 81 7.0 82 3.0 83 2.5 84 3.0 85 1.5 86 1.0 87 1.5 88 1.0 89 0.5 90 0.0 91 1.0 92 1.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59943977591037 96.8 2 1.0949834479246243 2.15 3 0.2291825821237586 0.675 4 0.05092946269416857 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025464731347084286 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.11249999999999999 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2375 0.0 0.0 0.0 0.0 42-43 0.2875 0.0 0.0 0.0 0.0 44-45 0.3875 0.0 0.0 0.0 0.0 46-47 0.4625 0.0 0.0 0.0 0.0 48-49 0.5625 0.0 0.0 0.0 0.0 50-51 0.7 0.0 0.0 0.0 0.0 52-53 0.8625 0.0 0.0 0.0 0.0 54-55 1.0125 0.0 0.0 0.0 0.0 56-57 1.1 0.0 0.0 0.0 0.0 58-59 1.375 0.0 0.0 0.0 0.0 60-61 1.5625 0.0 0.0 0.0 0.0 62-63 1.85 0.0 0.0 0.0 0.0 64-65 1.9874999999999998 0.0 0.0 0.0 0.0 66-67 2.2 0.0 0.0 0.0 0.0 68-69 2.575 0.0 0.0 0.0 0.0 70-71 2.7875 0.0 0.0 0.0 0.0 72-73 2.9625 0.0 0.0 0.0 0.0 74-75 3.2 0.0 0.0 0.0 0.0 76-77 3.6375 0.0 0.0 0.0 0.0 78-79 4.175000000000001 0.0 0.0 0.0 0.0 80-81 4.6875 0.0 0.0 0.0 0.0 82-83 5.0375 0.0 0.0 0.0 0.0 84-85 5.362500000000001 0.0 0.0 0.0 0.0 86-87 5.699999999999999 0.0 0.0 0.0 0.0 88-89 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3317465 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94725 33.0 31.0 34.0 30.0 34.0 2 32.10475 34.0 31.0 34.0 30.0 34.0 3 32.0485 34.0 31.0 34.0 30.0 34.0 4 35.396 37.0 35.0 37.0 35.0 37.0 5 35.50875 37.0 35.0 37.0 33.0 37.0 6 35.686 37.0 37.0 37.0 35.0 37.0 7 35.70825 37.0 37.0 37.0 35.0 37.0 8 35.6865 37.0 37.0 37.0 35.0 37.0 9 37.384 39.0 38.0 39.0 35.0 39.0 10-11 37.434875000000005 39.0 39.0 39.0 35.0 39.0 12-13 37.452375 39.0 38.5 39.0 35.0 39.0 14-15 39.009 41.0 40.0 41.0 36.0 41.0 16-17 38.915125 41.0 40.0 41.0 36.0 41.0 18-19 38.8755 41.0 40.0 41.0 36.0 41.0 20-21 38.803125 41.0 40.0 41.0 35.5 41.0 22-23 38.735875 41.0 39.5 41.0 35.5 41.0 24-25 38.63475 41.0 39.0 41.0 35.0 41.0 26-27 38.6175 41.0 39.0 41.0 35.0 41.0 28-29 38.541375 41.0 39.0 41.0 35.0 41.0 30-31 38.411874999999995 41.0 39.0 41.0 35.0 41.0 32-33 38.279375 40.5 38.5 41.0 35.0 41.0 34-35 38.121875 40.0 38.0 41.0 34.5 41.0 36-37 37.920375 40.0 38.0 41.0 33.5 41.0 38-39 37.81675 40.0 38.0 41.0 33.0 41.0 40-41 38.019875 40.0 38.0 41.0 34.0 41.0 42-43 37.996 40.0 38.0 41.0 34.0 41.0 44-45 37.814 40.0 38.0 41.0 33.0 41.0 46-47 37.659499999999994 40.0 38.0 41.0 33.0 41.0 48-49 37.5005 40.0 37.5 41.0 33.0 41.0 50-51 36.48775 39.0 36.0 40.5 31.0 40.5 52-53 36.493375 39.0 36.0 40.5 30.5 41.0 54-55 36.82025 40.0 36.0 41.0 31.5 41.0 56-57 36.69375 40.0 35.0 41.0 31.0 41.0 58-59 36.45075 39.0 35.0 41.0 31.0 41.0 60-61 36.089375000000004 39.0 35.0 41.0 30.0 41.0 62-63 35.865750000000006 38.5 35.0 41.0 30.5 41.0 64-65 35.561625 37.5 35.0 40.0 30.0 41.0 66-67 35.602000000000004 37.0 35.0 40.0 31.0 41.0 68-69 35.210125 37.0 35.0 39.5 30.0 41.0 70-71 34.924 36.0 35.0 39.0 31.0 41.0 72-73 34.532875000000004 36.0 35.0 39.0 30.0 40.5 74-75 34.192375 35.0 35.0 37.5 30.0 39.5 76-77 33.766875 35.0 34.0 37.0 29.0 39.0 78-79 33.4875 35.0 34.0 37.0 29.0 39.0 80-81 33.167500000000004 35.0 34.0 36.0 29.0 38.0 82-83 32.807625 35.0 34.0 36.0 29.0 37.0 84-85 32.65075 35.0 34.0 35.0 29.0 37.0 86-87 32.399625 35.0 34.0 35.0 27.0 36.0 88-89 32.147875 35.0 34.0 35.0 26.5 36.0 90-91 31.987125 35.0 33.5 35.0 26.0 36.0 92-93 31.86675 35.0 33.0 35.0 26.0 36.0 94-95 31.7975 35.0 33.0 35.0 25.5 35.0 96-97 31.476625 35.0 33.0 35.0 24.5 35.0 98-99 31.28 35.0 33.0 35.0 24.0 35.0 100-101 29.283375 33.5 29.0 34.5 11.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 6.0 4 4.0 5 9.0 6 6.0 7 3.0 8 5.0 9 8.0 10 5.0 11 6.0 12 6.0 13 6.0 14 5.0 15 6.0 16 6.0 17 8.0 18 10.0 19 6.0 20 6.0 21 8.0 22 14.0 23 7.0 24 9.0 25 14.0 26 21.0 27 17.0 28 36.0 29 31.0 30 35.0 31 65.0 32 78.0 33 90.0 34 143.0 35 241.0 36 444.0 37 938.0 38 1359.0 39 287.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.4 12.85 28.4 30.349999999999998 2 25.825 11.15 26.474999999999998 36.55 3 23.05 13.525 28.875 34.55 4 24.25 11.575000000000001 26.5 37.675 5 25.124999999999996 14.875 23.724999999999998 36.275 6 25.474999999999998 18.6 29.4 26.525 7 16.900000000000002 26.0 39.6 17.5 8 16.85 26.25 34.949999999999996 21.95 9 18.275 28.749999999999996 33.800000000000004 19.175 10-11 18.50231278909864 28.041005125640705 32.69158644830604 20.76509563695462 12-13 19.652456557069634 28.416052006500813 31.278909863732967 20.652581572696587 14-15 19.107165186945103 26.409903713892707 31.411779417281483 23.071151681880707 16-17 20.24256064016004 26.76919229807452 29.319829957489375 23.668417104276067 18-19 19.884942471235618 27.501250625312657 29.48974487243622 23.12406203101551 20-21 20.07002625984744 25.834688008003 29.048393147430286 25.04689258471927 22-23 21.820682756033513 25.23446292359635 28.810804051519316 24.134050268850817 24-25 20.040005000625076 26.790848856107015 29.041130141267658 24.128016002000248 26-27 21.3125 26.474999999999998 26.7625 25.45 28-29 20.4125 25.85 27.3625 26.375 30-31 20.375 25.937500000000004 29.562500000000004 24.125 32-33 21.675 25.8 26.775 25.75 34-35 20.962500000000002 25.412499999999998 27.3875 26.237500000000004 36-37 21.175 25.7375 28.775000000000002 24.3125 38-39 21.837500000000002 25.924999999999997 26.637499999999996 25.6 40-41 21.7 25.624999999999996 27.5125 25.162499999999998 42-43 21.6 26.387500000000003 26.6125 25.4 44-45 21.780445111277817 26.78169542385596 26.18154538634659 25.256314078519633 46-47 21.315164395549445 25.528191023877984 27.378422302787847 25.778222277784725 48-49 20.9875 27.787499999999998 27.462500000000002 23.7625 50-51 22.0 26.0 26.437500000000004 25.5625 52-53 22.45 25.074999999999996 27.05 25.424999999999997 54-55 20.5875 26.637499999999996 28.575 24.2 56-57 21.1125 26.25 27.325 25.3125 58-59 21.7375 25.7625 27.3375 25.162499999999998 60-61 21.2625 26.0625 28.9 23.775 62-63 22.1375 26.950000000000003 26.2125 24.7 64-65 22.252781597699713 25.365670708838607 26.978372296537067 25.403175396924617 66-67 20.825 27.6 26.775 24.8 68-69 21.712500000000002 26.1625 26.424999999999997 25.7 70-71 22.352794099262407 26.828353544193025 26.153269158644832 24.66558319789974 72-73 21.6875 26.424999999999997 26.724999999999998 25.162499999999998 74-75 22.177772221527693 26.22827853481685 26.67833479184898 24.915614451806476 76-77 22.975 26.0125 25.4625 25.55 78-79 22.0625 27.200000000000003 25.900000000000002 24.837500000000002 80-81 22.275 25.95 27.187499999999996 24.587500000000002 82-83 22.400000000000002 25.5375 26.487500000000004 25.575 84-85 23.7 25.8125 26.0375 24.45 86-87 23.275000000000002 25.900000000000002 26.125 24.7 88-89 23.325000000000003 25.650000000000002 26.0125 25.0125 90-91 23.8375 26.650000000000002 26.1 23.4125 92-93 22.85 25.674999999999997 26.0 25.474999999999998 94-95 22.975 25.874999999999996 26.5 24.65 96-97 23.5875 26.6625 25.974999999999998 23.775 98-99 23.325000000000003 26.775 25.5375 24.3625 100-101 24.2375 26.437500000000004 24.4 24.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 8.0 2 3.5 3 2.5 4 2.0 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 2.0 12 2.0 13 1.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.5 19 2.0 20 3.5 21 2.5 22 2.5 23 3.0 24 4.5 25 4.5 26 2.5 27 6.0 28 8.5 29 12.0 30 12.5 31 15.0 32 26.0 33 36.5 34 46.5 35 55.0 36 71.0 37 94.5 38 111.5 39 122.5 40 148.5 41 180.5 42 198.5 43 210.0 44 216.0 45 203.5 46 213.5 47 204.5 48 173.0 49 161.5 50 151.5 51 151.5 52 132.5 53 108.0 54 98.5 55 90.0 56 73.0 57 56.5 58 55.0 59 51.5 60 48.0 61 51.5 62 47.5 63 41.0 64 35.5 65 31.5 66 28.5 67 29.5 68 22.5 69 14.0 70 14.0 71 11.0 72 10.5 73 12.0 74 12.0 75 9.0 76 4.5 77 4.5 78 4.5 79 5.0 80 4.0 81 1.0 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0125 14-15 0.0375 16-17 0.025 18-19 0.05 20-21 0.0375 22-23 0.0375 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.025 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95434838051517 97.0 2 0.7651109410864576 1.5 3 0.12751849018107625 0.375 4 0.0510073960724305 0.2 5 0.0510073960724305 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02550369803621525 0.22499999999999998 >10 0.02550369803621525 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 18 0.44999999999999996 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 9 0.22499999999999998 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit CCACCGAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.16249999999999998 0.0 0.0 0.0 0.0 42-43 0.21250000000000002 0.0 0.0 0.0 0.0 44-45 0.3125 0.0 0.0 0.0 0.0 46-47 0.3875 0.0 0.0 0.0 0.0 48-49 0.5 0.0 0.0 0.0 0.0 50-51 0.6 0.0 0.0 0.0 0.0 52-53 0.75 0.0 0.0 0.0 0.0 54-55 0.8875 0.0 0.0 0.0 0.0 56-57 1.0 0.0 0.0 0.0 0.0 58-59 1.2625 0.0 0.0 0.0 0.0 60-61 1.4375 0.0 0.0 0.0 0.0 62-63 1.7374999999999998 0.0 0.0 0.0 0.0 64-65 1.8624999999999998 0.0 0.0 0.0 0.0 66-67 2.0999999999999996 0.0 0.0 0.0 0.0 68-69 2.45 0.0 0.0 0.0 0.0 70-71 2.6125 0.0 0.0 0.0 0.0 72-73 2.7875 0.0 0.0 0.0 0.0 74-75 3.0375 0.0 0.0 0.0 0.0 76-77 3.4875 0.0 0.0 0.0 0.0 78-79 4.05 0.0 0.0 0.0 0.0 80-81 4.5625 0.0 0.0 0.0 0.0 82-83 4.887499999999999 0.0 0.0 0.0 0.0 84-85 5.2125 0.0 0.0 0.0 0.0 86-87 5.574999999999999 0.0 0.0 0.0 0.0 88-89 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824317 spots for ERR3317465.sra Written 1824317 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra Read 1824303 spots for ERR3317465.sra Written 1824303 spots for ERR3317465.sra SRR ids: ['ERR3317465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tovy87hk ERR3317465.sra spots: 36486074 blocks: [[1, 1824303], [1824304, 3648606], [3648607, 5472909], [5472910, 7297212], [7297213, 9121515], [9121516, 10945818], [10945819, 12770121], [12770122, 14594424], [14594425, 16418727], [16418728, 18243030], [18243031, 20067333], [20067334, 21891636], [21891637, 23715939], [23715940, 25540242], [25540243, 27364545], [27364546, 29188848], [29188849, 31013151], [31013152, 32837454], [32837455, 34661757], [34661758, 36486074]] ERR3317465 file size 8779139 ERR3317465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317465 ERR3317465_1.fastq ERR3317465_2.fastq Input file: ERR3317465_1.fastq Paired file: ERR3317465_2.fastq trimmed: ERR3317465-trimmed-pair1.fastq, ERR3317465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:03:23 2024 >> started Tue Dec 10 10:04:11 2024 >> done (48.270s) 36486074 read pairs processed; of these: 240110 ( 0.66%) short read pairs filtered out after trimming by size control 648330 ( 1.78%) empty read pairs filtered out after trimming by size control 35597634 (97.56%) read pairs available; of these: 10727266 (30.13%) trimmed read pairs available after processing 24870368 (69.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 422 0.00% 19 475 0.00% 20 663 0.00% 21 794 0.00% 22 1117 0.00% 23 1516 0.00% 24 2052 0.01% 25 2495 0.01% 26 2791 0.01% 27 3485 0.01% 28 3841 0.01% 29 4369 0.01% 30 5015 0.01% 31 6544 0.02% 32 6916 0.02% 33 7404 0.02% 34 8886 0.02% 35 9446 0.03% 36 10445 0.03% 37 11206 0.03% 38 12940 0.04% 39 13859 0.04% 40 14551 0.04% 41 16083 0.05% 42 17660 0.05% 43 18581 0.05% 44 20974 0.06% 45 21530 0.06% 46 23185 0.07% 47 26250 0.07% 48 27143 0.08% 49 28297 0.08% 50 31867 0.09% 51 33020 0.09% 52 34077 0.10% 53 37105 0.10% 54 42537 0.12% 55 44505 0.13% 56 46517 0.13% 57 49577 0.14% 58 52693 0.15% 59 67873 0.19% 60 79519 0.22% 61 84674 0.24% 62 90641 0.25% 63 96724 0.27% 64 103497 0.29% 65 115892 0.33% 66 119253 0.34% 67 118028 0.33% 68 121628 0.34% 69 123071 0.35% 70 128541 0.36% 71 135591 0.38% 72 143291 0.40% 73 149074 0.42% 74 148537 0.42% 75 149800 0.42% 76 149728 0.42% 77 157099 0.44% 78 169698 0.48% 79 167551 0.47% 80 172729 0.49% 81 177257 0.50% 82 176841 0.50% 83 183099 0.51% 84 189661 0.53% 85 203100 0.57% 86 209505 0.59% 87 217879 0.61% 88 221801 0.62% 89 252046 0.71% 90 234843 0.66% 91 245323 0.69% 92 255797 0.72% 93 271089 0.76% 94 296510 0.83% 95 336512 0.95% 96 355811 1.00% 97 412400 1.16% 98 509545 1.43% 99 698368 1.96% 100 1784607 5.01% 101 24870368 69.87% 35597634 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=2.9 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=58.57 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.0 sequence=GAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.67 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=1.0 sequence=ATGCACTGCACTTGCCTGGTGTTGTCGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=51.44 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.0 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTT ERR3317465 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:04:47 Started mapping on | Dec 10 10:04:48 Finished on | Dec 10 10:06:34 Mapping speed, Million of reads per hour | 1208.98 Number of input reads | 35597634 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 31764315 Uniquely mapped reads % | 89.23% Average mapped length | 191.22 Number of splices: Total | 20056623 Number of splices: Annotated (sjdb) | 19070161 Number of splices: GT/AG | 19759048 Number of splices: GC/AG | 264077 Number of splices: AT/AC | 16245 Number of splices: Non-canonical | 17253 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.00% Deletion average length | 1.20 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2409844 % of reads mapped to multiple loci | 6.77% Number of reads mapped to too many loci | 130369 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 1.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1584766 1584766 1584766 N_multimapping 2409844 2409844 2409844 N_noFeature 1323020 2959898 29437574 N_ambiguous 959162 294829 16387 UnstrandedReadsAssigned:29482133 PositiveStrandReadsAssigned:28509588 NegativeStrandReadsAssigned:2310354 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=99 echo kmer=95 ERR3317465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317465-trimmed-pair1.fastq ERR3317465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,597,634 reads, 30,336,178 reads pseudoaligned [quant] estimated average fragment length: 193.627 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 ERR3317465.ke.tsv 35125 ERR3317465.se.tsv 88098 total ==> ERR3317465.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.75 0 0 PNS24247 1044 851.373 46.6495 2.75742 PNS24249 1928 1735.37 73.2599 2.12446 PNS24246 1044 851.373 46.6495 2.75742 PNS24248 1044 851.373 46.6495 2.75742 PNS24244 1471 1278.37 203.791 8.02239 PNS24243 293 133.658 4 1.50605 KQK14069 1603 1410.37 3729.79 133.084 KQK14071 474 292.004 12.8556 2.21554 ==> ERR3317465.se.tsv <== BRADI_1g14170v3 4357 BRADI_1g53295v3 213 BRADI_1g59795v3 812 BRADI_1g07683v3 0 BRADI_1g00485v3 148 BRADI_1g20270v3 2486 BRADI_1g74790v3 481 BRADI_1g09890v3 7 BRADI_1g77505v3 412 BRADI_1g48960v3 1 ERR3317465 completed mapping pipeline successfully