Starting /dee2/code/volunteer_pipeline.sh ERR3317468 current disk space = 1524804251648 free memory = 1544918996 ERR3317468 SRAfilesize 30535bf28bb2663a39aeeea7d2dbb041 ERR3317468.sra ERR3317468.sra file validated ERR3317468 is paired end ERR3317468 is conventional basespace ERR3317468 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65175 34.0 31.0 34.0 31.0 34.0 2 32.34225 34.0 31.0 34.0 31.0 34.0 3 32.83475 34.0 31.0 34.0 31.0 34.0 4 36.39075 37.0 37.0 37.0 35.0 37.0 5 36.39 37.0 37.0 37.0 35.0 37.0 6 36.16275 37.0 37.0 37.0 35.0 37.0 7 36.3455 37.0 37.0 37.0 35.0 37.0 8 36.376 37.0 37.0 37.0 35.0 37.0 9 38.217 39.0 39.0 39.0 37.0 39.0 10-11 38.123000000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.133125 39.0 39.0 39.0 37.0 39.0 14-15 39.745875 41.0 40.0 41.0 37.5 41.0 16-17 39.667874999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.616 41.0 40.0 41.0 37.0 41.0 20-21 39.5955 41.0 40.0 41.0 37.0 41.0 22-23 39.4925 41.0 40.0 41.0 37.0 41.0 24-25 39.315875 41.0 39.0 41.0 36.0 41.0 26-27 39.17175 41.0 39.0 41.0 36.0 41.0 28-29 39.10925 41.0 39.0 41.0 35.5 41.0 30-31 38.926625 40.0 39.0 41.0 35.0 41.0 32-33 38.723875 40.0 38.0 41.0 35.0 41.0 34-35 38.4685 40.0 38.0 41.0 34.0 41.0 36-37 38.27375 40.0 38.0 41.0 33.5 41.0 38-39 38.147125 40.0 38.0 41.0 33.0 41.0 40-41 37.871125 40.0 37.0 41.0 33.0 41.0 42-43 37.8525 40.0 37.5 41.0 33.0 41.0 44-45 37.666375 40.0 37.0 41.0 33.0 41.0 46-47 37.428125 40.0 36.5 41.0 32.5 41.0 48-49 37.154625 40.0 36.0 41.0 31.5 41.0 50-51 37.404375 40.0 36.0 41.0 32.5 41.0 52-53 37.169875000000005 40.0 35.5 41.0 32.0 41.0 54-55 36.893625 39.0 35.0 41.0 31.5 41.0 56-57 36.637874999999994 39.0 35.0 41.0 31.5 41.0 58-59 36.299125000000004 38.5 35.0 41.0 31.0 41.0 60-61 35.900375 37.5 35.0 40.5 30.5 41.0 62-63 35.58425 37.0 35.0 40.0 30.0 41.0 64-65 35.235875 36.5 35.0 40.0 29.5 41.0 66-67 34.752375 36.0 34.0 39.0 29.0 41.0 68-69 34.377375 35.0 34.0 39.0 29.0 41.0 70-71 34.0265 35.0 34.0 37.5 29.0 40.0 72-73 33.600624999999994 35.0 34.0 37.0 28.0 39.0 74-75 33.13575 35.0 33.5 36.5 27.0 39.0 76-77 31.911 34.5 32.0 35.5 25.5 37.0 78-79 32.375875 35.0 33.0 36.0 26.0 37.0 80-81 32.224000000000004 35.0 33.0 35.0 26.0 37.0 82-83 32.012375000000006 35.0 33.0 35.0 25.5 36.0 84-85 31.637999999999998 35.0 33.0 35.0 24.0 36.0 86-87 31.400875 35.0 33.0 35.0 24.0 36.0 88-89 31.2795 35.0 33.0 35.0 24.0 35.5 90-91 31.018250000000002 35.0 32.0 35.0 21.5 35.0 92-93 30.708125000000003 35.0 32.0 35.0 19.5 35.0 94-95 30.485875 35.0 32.0 35.0 17.5 35.0 96-97 30.166249999999998 35.0 32.0 35.0 6.0 35.0 98-99 29.783125 34.5 31.0 35.0 2.0 35.0 100-101 27.243375 32.5 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 6.0 10 4.0 11 6.0 12 6.0 13 8.0 14 9.0 15 9.0 16 13.0 17 14.0 18 14.0 19 10.0 20 13.0 21 15.0 22 17.0 23 16.0 24 33.0 25 18.0 26 27.0 27 43.0 28 54.0 29 42.0 30 64.0 31 69.0 32 121.0 33 134.0 34 180.0 35 315.0 36 569.0 37 998.0 38 1059.0 39 111.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.348643006263046 25.10438413361169 20.041753653444676 27.505219206680586 2 25.95 25.124999999999996 18.2 30.725 3 24.775 26.5 19.175 29.549999999999997 4 27.35 26.55 16.2 29.9 5 27.55 24.65 17.1 30.7 6 29.025000000000002 28.275 18.15 24.55 7 29.425 23.724999999999998 21.425 25.424999999999997 8 30.7 25.924999999999997 24.25 19.125 9 31.225 27.575 23.35 17.849999999999998 10-11 32.3625 26.087500000000002 22.825 18.725 12-13 29.362500000000004 26.825 23.7875 20.025000000000002 14-15 26.724999999999998 26.8625 24.4875 21.925 16-17 26.6125 26.05 25.3 22.037499999999998 18-19 26.1 25.7125 25.424999999999997 22.7625 20-21 25.424999999999997 26.0 25.837500000000002 22.7375 22-23 25.5 26.025 24.775 23.7 24-25 25.387500000000003 26.487500000000004 25.474999999999998 22.650000000000002 26-27 26.4125 25.2 24.9875 23.400000000000002 28-29 25.937500000000004 25.374999999999996 25.2125 23.474999999999998 30-31 25.324999999999996 26.3 25.087500000000002 23.2875 32-33 24.8 25.9875 25.374999999999996 23.8375 34-35 24.9 25.9875 25.5125 23.599999999999998 36-37 25.124999999999996 26.6 25.337500000000002 22.9375 38-39 25.45 25.6125 25.837500000000002 23.1 40-41 25.55 25.95 24.2875 24.212500000000002 42-43 25.9625 25.3 25.1875 23.549999999999997 44-45 26.087500000000002 25.45 25.424999999999997 23.0375 46-47 25.5 26.137500000000003 24.525 23.8375 48-49 24.9125 26.3625 25.275 23.45 50-51 26.3 24.575 25.874999999999996 23.25 52-53 25.1 25.837500000000002 25.2125 23.849999999999998 54-55 25.412499999999998 25.5625 25.275 23.75 56-57 25.575 26.375 24.125 23.925 58-59 25.624999999999996 26.2625 24.525 23.5875 60-61 24.925 25.650000000000002 25.637500000000003 23.7875 62-63 24.525 26.5625 25.025 23.8875 64-65 24.962500000000002 26.674999999999997 24.587500000000002 23.775 66-67 25.7625 26.325 24.55 23.3625 68-69 25.1875 26.25 24.1875 24.375 70-71 24.6625 26.825 24.625 23.8875 72-73 25.412499999999998 25.937500000000004 24.762500000000003 23.8875 74-75 26.2625 25.412499999999998 25.1875 23.1375 76-77 25.912499999999998 25.587500000000002 24.275 24.224999999999998 78-79 25.525 25.95 25.45 23.075000000000003 80-81 25.162499999999998 26.7125 24.525 23.599999999999998 82-83 25.9875 25.6125 24.5375 23.8625 84-85 26.4625 26.375 24.887500000000003 22.275 86-87 25.4625 26.450000000000003 24.175 23.9125 88-89 25.0 26.4625 23.849999999999998 24.6875 90-91 25.95 26.200000000000003 24.1125 23.7375 92-93 25.2875 26.137500000000003 24.425 24.15 94-95 25.887500000000003 26.887499999999996 23.474999999999998 23.75 96-97 26.125 25.85 24.3875 23.6375 98-99 25.45 25.8 24.8 23.95 100-101 25.662499999999998 26.237500000000004 22.825 25.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.5 12 0.5 13 0.5 14 2.5 15 2.5 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 2.0 24 3.0 25 2.0 26 2.0 27 4.0 28 5.5 29 7.5 30 9.0 31 12.0 32 14.0 33 19.0 34 28.0 35 34.0 36 38.5 37 56.5 38 75.5 39 93.5 40 117.0 41 146.5 42 173.5 43 184.0 44 191.5 45 194.5 46 188.0 47 188.5 48 193.5 49 183.0 50 175.0 51 158.0 52 138.5 53 123.0 54 110.5 55 107.5 56 98.0 57 81.5 58 74.0 59 67.0 60 65.0 61 63.5 62 57.5 63 60.0 64 53.5 65 46.0 66 40.5 67 38.0 68 33.0 69 29.0 70 29.5 71 24.0 72 24.5 73 26.0 74 15.5 75 12.0 76 14.5 77 10.5 78 6.5 79 3.0 80 3.5 81 5.5 82 5.0 83 5.0 84 3.5 85 2.5 86 2.0 87 1.0 88 1.0 89 1.5 90 1.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23167606355715 95.825 2 1.3070220399794976 2.55 3 0.3075345976422348 0.8999999999999999 4 0.12813941568426446 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025627883136852894 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGC 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.16249999999999998 0.0 0.0 0.0 0.0 32-33 0.2375 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.3125 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.4875 0.0 0.0 0.0 0.0 44-45 0.525 0.0 0.0 0.0 0.0 46-47 0.6625 0.0 0.0 0.0 0.0 48-49 0.825 0.0 0.0 0.0 0.0 50-51 0.9625 0.0 0.0 0.0 0.0 52-53 1.0875 0.0 0.0 0.0 0.0 54-55 1.2625000000000002 0.0 0.0 0.0 0.0 56-57 1.4625 0.0 0.0 0.0 0.0 58-59 1.65 0.0 0.0 0.0 0.0 60-61 1.9249999999999998 0.0 0.0 0.0 0.0 62-63 2.1375 0.0 0.0 0.0 0.0 64-65 2.4375 0.0 0.0 0.0 0.0 66-67 2.8 0.0 0.0 0.0 0.0 68-69 3.1375 0.0 0.0 0.0 0.0 70-71 3.3375 0.0 0.0 0.0 0.0 72-73 3.675 0.0 0.0 0.0 0.0 74-75 4.0375 0.0 0.0 0.0 0.0 76-77 4.4375 0.0 0.0 0.0 0.0 78-79 4.975 0.0 0.0 0.0 0.0 80-81 5.25 0.0 0.0 0.0 0.0 82-83 5.637499999999999 0.0 0.0 0.0 0.0 84-85 6.112500000000001 0.0 0.0 0.0 0.0 86-87 6.7875 0.0 0.0 0.0 0.0 88-89 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAAGC 15 0.00997274 47.481247 22-23 >>END_MODULE ERR3317468 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3317468_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9055 33.0 31.0 34.0 30.0 34.0 2 32.06425 34.0 31.0 34.0 30.0 34.0 3 32.00525 34.0 31.0 34.0 30.0 34.0 4 35.29225 37.0 35.0 37.0 33.0 37.0 5 35.352 37.0 35.0 37.0 33.0 37.0 6 35.50575 37.0 36.0 37.0 35.0 37.0 7 35.5295 37.0 37.0 37.0 35.0 37.0 8 35.53975 37.0 37.0 37.0 35.0 37.0 9 37.218 39.0 38.0 39.0 35.0 39.0 10-11 37.324375 39.0 39.0 39.0 35.0 39.0 12-13 37.338125000000005 39.0 38.5 39.0 35.0 39.0 14-15 38.828625 41.0 40.0 41.0 36.0 41.0 16-17 38.807249999999996 41.0 40.0 41.0 36.0 41.0 18-19 38.713625 41.0 39.5 41.0 35.5 41.0 20-21 38.620125 41.0 39.0 41.0 35.0 41.0 22-23 38.5085 41.0 39.0 41.0 35.0 41.0 24-25 38.389125 41.0 39.0 41.0 35.0 41.0 26-27 38.346625 41.0 39.0 41.0 35.0 41.0 28-29 38.261625 41.0 39.0 41.0 34.5 41.0 30-31 38.113749999999996 41.0 38.5 41.0 34.0 41.0 32-33 37.977999999999994 40.0 38.0 41.0 34.0 41.0 34-35 37.79325 40.0 38.0 41.0 33.5 41.0 36-37 37.681124999999994 40.0 38.0 41.0 33.0 41.0 38-39 37.516875 40.0 38.0 41.0 33.0 41.0 40-41 37.673 40.0 38.0 41.0 33.0 41.0 42-43 37.569125 40.0 38.0 41.0 33.0 41.0 44-45 37.440749999999994 40.0 38.0 41.0 33.0 41.0 46-47 37.156875 40.0 37.0 41.0 32.0 41.0 48-49 36.999 40.0 37.0 41.0 31.5 41.0 50-51 36.1105 39.0 35.5 40.5 31.0 40.5 52-53 36.031125 39.0 35.0 40.5 30.0 41.0 54-55 36.280875 39.5 35.0 41.0 30.5 41.0 56-57 36.14725 39.0 35.0 41.0 30.5 41.0 58-59 35.867625000000004 39.0 35.0 41.0 30.0 41.0 60-61 35.554249999999996 38.0 35.0 41.0 29.5 41.0 62-63 35.366625 38.0 35.0 40.5 29.5 41.0 64-65 34.985125 37.0 35.0 40.0 28.5 41.0 66-67 34.922625 37.0 35.0 40.0 29.0 41.0 68-69 34.614125 36.0 35.0 39.0 29.0 41.0 70-71 34.419 36.0 35.0 39.0 29.0 41.0 72-73 33.994375000000005 35.0 35.0 39.0 29.0 41.0 74-75 33.635125 35.0 34.0 37.0 28.5 39.5 76-77 33.317875 35.0 34.0 37.0 28.5 39.0 78-79 32.917500000000004 35.0 34.0 36.5 27.0 39.0 80-81 32.57975 35.0 34.0 36.0 26.5 37.0 82-83 32.3595 35.0 34.0 36.0 27.0 37.0 84-85 32.127624999999995 35.0 34.0 35.0 26.0 36.5 86-87 31.904375 35.0 33.5 35.0 25.5 36.0 88-89 31.649124999999998 35.0 33.0 35.0 24.0 36.0 90-91 31.464875 35.0 33.0 35.0 24.0 36.0 92-93 31.314375 35.0 33.0 35.0 24.0 35.5 94-95 31.122 35.0 33.0 35.0 21.5 35.0 96-97 30.851 35.0 33.0 35.0 18.5 35.0 98-99 30.661125 35.0 33.0 35.0 12.5 35.0 100-101 28.663125 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 8.0 4 7.0 5 5.0 6 7.0 7 3.0 8 3.0 9 9.0 10 5.0 11 10.0 12 8.0 13 13.0 14 9.0 15 7.0 16 7.0 17 12.0 18 11.0 19 5.0 20 10.0 21 12.0 22 11.0 23 17.0 24 12.0 25 17.0 26 19.0 27 23.0 28 29.0 29 49.0 30 47.0 31 67.0 32 70.0 33 106.0 34 158.0 35 239.0 36 456.0 37 931.0 38 1277.0 39 261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.95 13.075000000000001 28.599999999999998 28.375 2 28.599999999999998 10.85 25.15 35.4 3 23.75 12.2 29.075 34.975 4 25.674999999999997 10.549999999999999 26.724999999999998 37.05 5 25.374999999999996 14.774999999999999 24.675 35.175 6 26.724999999999998 18.375 30.049999999999997 24.85 7 20.9 22.95 39.15 17.0 8 18.5 25.4 36.25 19.85 9 19.275000000000002 27.05 33.900000000000006 19.775000000000002 10-11 19.875 25.874999999999996 33.3125 20.9375 12-13 20.175 26.7125 31.7 21.4125 14-15 20.275000000000002 25.7875 31.324999999999996 22.6125 16-17 20.45 26.337500000000002 29.4 23.8125 18-19 20.349999999999998 27.5625 28.599999999999998 23.4875 20-21 20.8875 26.35 29.3375 23.425 22-23 21.875 24.675 28.7 24.75 24-25 22.0875 25.874999999999996 28.95 23.0875 26-27 20.575 26.0125 27.3625 26.05 28-29 21.7 25.724999999999998 27.037499999999998 25.5375 30-31 21.8 26.35 27.375 24.474999999999998 32-33 21.6875 26.5375 27.200000000000003 24.575 34-35 21.625 25.05 27.3375 25.9875 36-37 21.3125 25.825 27.55 25.3125 38-39 22.8375 24.65 27.175 25.337500000000002 40-41 22.0625 25.2875 27.375 25.275 42-43 21.9625 25.162499999999998 27.775 25.1 44-45 22.537499999999998 25.35 27.1 25.0125 46-47 22.175 24.55 26.525 26.75 48-49 21.55 27.4125 26.787499999999998 24.25 50-51 22.400000000000002 26.525 26.6625 24.4125 52-53 22.9375 25.362499999999997 25.687500000000004 26.0125 54-55 21.55 25.724999999999998 28.325 24.4 56-57 22.537499999999998 25.4875 26.737499999999997 25.2375 58-59 22.2625 25.5 26.8125 25.424999999999997 60-61 22.1 26.2625 27.85 23.7875 62-63 22.787499999999998 25.2875 27.075 24.85 64-65 22.625 25.112499999999997 27.0875 25.174999999999997 66-67 22.1375 27.3875 26.987499999999997 23.4875 68-69 22.625 26.174999999999997 26.224999999999998 24.975 70-71 23.9 25.275 25.75 25.074999999999996 72-73 23.3125 25.8625 26.25 24.575 74-75 23.0 26.1125 26.35 24.5375 76-77 23.8375 25.9875 24.65 25.525 78-79 22.725 25.95 25.2375 26.087500000000002 80-81 22.85 26.325 26.325 24.5 82-83 23.7 24.9 25.112499999999997 26.2875 84-85 24.4875 25.324999999999996 25.8625 24.325 86-87 24.875 25.912499999999998 25.3 23.9125 88-89 23.8625 25.662499999999998 24.6125 25.8625 90-91 24.962500000000002 26.3625 25.5125 23.1625 92-93 24.837500000000002 25.35 25.55 24.2625 94-95 24.712500000000002 25.662499999999998 26.237500000000004 23.3875 96-97 25.1875 25.924999999999997 25.474999999999998 23.4125 98-99 24.0375 26.224999999999998 25.825 23.9125 100-101 25.8 24.975 25.05 24.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 17.0 1 14.5 2 8.0 3 6.0 4 5.5 5 3.5 6 4.0 7 2.5 8 0.5 9 1.5 10 2.0 11 1.0 12 1.0 13 1.0 14 1.5 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.0 21 2.5 22 2.0 23 1.0 24 2.5 25 5.5 26 6.0 27 6.0 28 6.5 29 7.0 30 12.0 31 19.5 32 27.0 33 36.0 34 41.5 35 44.0 36 55.0 37 71.5 38 93.0 39 117.0 40 146.0 41 177.5 42 194.0 43 201.0 44 200.5 45 200.0 46 185.0 47 175.0 48 183.0 49 173.0 50 154.5 51 131.5 52 105.0 53 96.5 54 98.0 55 82.0 56 71.0 57 74.0 58 72.0 59 70.0 60 63.5 61 61.0 62 55.0 63 45.0 64 43.5 65 38.0 66 33.0 67 26.0 68 25.0 69 32.5 70 30.5 71 27.5 72 24.0 73 16.5 74 12.0 75 10.5 76 9.0 77 6.5 78 8.5 79 6.0 80 3.5 81 4.0 82 1.0 83 0.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.79425346331452 96.275 2 0.8209338122113904 1.6 3 0.17957927142124167 0.525 4 0.07696254489481785 0.3 5 0.0513083632632119 0.25 6 0.02565418163160595 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02565418163160595 0.22499999999999998 >10 0.02565418163160595 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 27 0.675 No Hit TGGGGGTGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 9 0.22499999999999998 No Hit CCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGG 6 0.15 No Hit TCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAAC 5 0.125 No Hit TGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.16249999999999998 0.0 0.0 0.0 0.0 32-33 0.2375 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.3125 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.4 0.0 0.0 0.0 0.0 42-43 0.4875 0.0 0.0 0.0 0.0 44-45 0.525 0.0 0.0 0.0 0.0 46-47 0.6625 0.0 0.0 0.0 0.0 48-49 0.825 0.0 0.0 0.0 0.0 50-51 0.95 0.0 0.0 0.0 0.0 52-53 1.0625 0.0 0.0 0.0 0.0 54-55 1.2125 0.0 0.0 0.0 0.0 56-57 1.4125 0.0 0.0 0.0 0.0 58-59 1.6 0.0 0.0 0.0 0.0 60-61 1.875 0.0 0.0 0.0 0.0 62-63 2.075 0.0 0.0 0.0 0.0 64-65 2.3625 0.0 0.0 0.0 0.0 66-67 2.7125 0.0 0.0 0.0 0.0 68-69 3.05 0.0 0.0 0.0 0.0 70-71 3.2625 0.0 0.0 0.0 0.0 72-73 3.5999999999999996 0.0 0.0 0.0 0.0 74-75 3.9875 0.0 0.0 0.0 0.0 76-77 4.3375 0.0 0.0 0.0 0.0 78-79 4.9125 0.0 0.0 0.0 0.0 80-81 5.2375 0.0 0.0 0.0 0.0 82-83 5.637499999999999 0.0 0.0 0.0 0.0 84-85 6.0875 0.0 0.0 0.0 0.0 86-87 6.7875 0.0 0.0 0.0 0.0 88-89 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra Read 1939050 spots for ERR3317468.sra Written 1939050 spots for ERR3317468.sra Read 1939041 spots for ERR3317468.sra Written 1939041 spots for ERR3317468.sra SRR ids: ['ERR3317468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v6c_gc08 ERR3317468.sra spots: 38780829 blocks: [[1, 1939041], [1939042, 3878082], [3878083, 5817123], [5817124, 7756164], [7756165, 9695205], [9695206, 11634246], [11634247, 13573287], [13573288, 15512328], [15512329, 17451369], [17451370, 19390410], [19390411, 21329451], [21329452, 23268492], [23268493, 25207533], [25207534, 27146574], [27146575, 29085615], [29085616, 31024656], [31024657, 32963697], [32963698, 34902738], [34902739, 36841779], [36841780, 38780829]] ERR3317468 file size 9332659 ERR3317468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3317468 ERR3317468_1.fastq ERR3317468_2.fastq Input file: ERR3317468_1.fastq Paired file: ERR3317468_2.fastq trimmed: ERR3317468-trimmed-pair1.fastq, ERR3317468-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:12:15 2024 >> started Tue Dec 10 10:13:24 2024 >> done (68.922s) 38780829 read pairs processed; of these: 291122 ( 0.75%) short read pairs filtered out after trimming by size control 684798 ( 1.77%) empty read pairs filtered out after trimming by size control 37804909 (97.48%) read pairs available; of these: 11679895 (30.90%) trimmed read pairs available after processing 26125014 (69.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 883 0.00% 19 1015 0.00% 20 1511 0.00% 21 1783 0.00% 22 2203 0.01% 23 3028 0.01% 24 3595 0.01% 25 4481 0.01% 26 5046 0.01% 27 6077 0.02% 28 6533 0.02% 29 7710 0.02% 30 8511 0.02% 31 12659 0.03% 32 10558 0.03% 33 11593 0.03% 34 14193 0.04% 35 14458 0.04% 36 15953 0.04% 37 16734 0.04% 38 19787 0.05% 39 20726 0.05% 40 20438 0.05% 41 22653 0.06% 42 23850 0.06% 43 25108 0.07% 44 27112 0.07% 45 27787 0.07% 46 29687 0.08% 47 33088 0.09% 48 34315 0.09% 49 36731 0.10% 50 40878 0.11% 51 40432 0.11% 52 41634 0.11% 53 45829 0.12% 54 50378 0.13% 55 52421 0.14% 56 54215 0.14% 57 57291 0.15% 58 62172 0.16% 59 78670 0.21% 60 89070 0.24% 61 95143 0.25% 62 101721 0.27% 63 107403 0.28% 64 115554 0.31% 65 124956 0.33% 66 132784 0.35% 67 133045 0.35% 68 133694 0.35% 69 134005 0.35% 70 137484 0.36% 71 143307 0.38% 72 148457 0.39% 73 160013 0.42% 74 156899 0.42% 75 157184 0.42% 76 156240 0.41% 77 164153 0.43% 78 180328 0.48% 79 179357 0.47% 80 183131 0.48% 81 186785 0.49% 82 186863 0.49% 83 193926 0.51% 84 200148 0.53% 85 217608 0.58% 86 224329 0.59% 87 233244 0.62% 88 234470 0.62% 89 254528 0.67% 90 245997 0.65% 91 254804 0.67% 92 267638 0.71% 93 284948 0.75% 94 309437 0.82% 95 354769 0.94% 96 383783 1.02% 97 443379 1.17% 98 550203 1.46% 99 759531 2.01% 100 1965851 5.20% 101 26125014 69.10% 37804909 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.48 prefix-fanout=2.0 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=196.11 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=18.7 sequence=CGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGATGGACATCAGAAAGTATACTGTGTTTTACCACCCTAATTAAGTAAACAACTTTTGG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=50.31 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.7 sequence=CCTTCTTCTCCTCCTTGGTGGCCTTGGAGGAGATGACGGTCTTGAGGTCGTAGCGCAGGTAGGAGGCCCTGAGGCGGAGG ERR3317468 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:14:01 Started mapping on | Dec 10 10:14:01 Finished on | Dec 10 10:16:06 Mapping speed, Million of reads per hour | 1088.78 Number of input reads | 37804909 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 33800899 Uniquely mapped reads % | 89.41% Average mapped length | 190.46 Number of splices: Total | 20373819 Number of splices: Annotated (sjdb) | 19340333 Number of splices: GT/AG | 20073508 Number of splices: GC/AG | 267569 Number of splices: AT/AC | 13447 Number of splices: Non-canonical | 19295 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2878291 % of reads mapped to multiple loci | 7.61% Number of reads mapped to too many loci | 48706 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1346826 1346826 1346826 N_multimapping 2878291 2878291 2878291 N_noFeature 1243541 2928194 31349773 N_ambiguous 1031010 287094 16101 UnstrandedReadsAssigned:31526348 PositiveStrandReadsAssigned:30585611 NegativeStrandReadsAssigned:2435025 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR3317468 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3317468-trimmed-pair1.fastq ERR3317468-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,804,909 reads, 32,810,141 reads pseudoaligned [quant] estimated average fragment length: 187.947 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 ERR3317468.ke.tsv 35125 ERR3317468.se.tsv 88098 total ==> ERR3317468.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.169 0 0 PNS24247 1044 857.053 62.6261 3.33125 PNS24249 1928 1741.05 132.345 3.46542 PNS24246 1044 857.053 62.6261 3.33125 PNS24248 1044 857.053 62.6261 3.33125 PNS24244 1471 1284.05 218.777 7.76743 PNS24243 293 133.828 0 0 KQK14069 1603 1416.05 3033.54 97.6629 KQK14071 474 294.981 16.9351 2.6173 ==> ERR3317468.se.tsv <== BRADI_1g14170v3 3489 BRADI_1g53295v3 217 BRADI_1g59795v3 690 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 608 BRADI_1g74790v3 692 BRADI_1g09890v3 15 BRADI_1g77505v3 348 BRADI_1g48960v3 0 ERR3317468 completed mapping pipeline successfully