Starting /dee2/code/volunteer_pipeline.sh ERR3450052 current disk space = 1543232921600 free memory = 1602389440 ERR3450052 SRAfilesize 055eb05509be886c659c4aa9289ee2ef ERR3450052.sra ERR3450052.sra file validated ERR3450052 is paired end ERR3450052 is conventional basespace ERR3450052 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450052_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0655 37.0 37.0 37.0 37.0 37.0 2 36.1885 37.0 37.0 37.0 37.0 37.0 3 36.3345 37.0 37.0 37.0 37.0 37.0 4 36.4625 37.0 37.0 37.0 37.0 37.0 5 36.4405 37.0 37.0 37.0 37.0 37.0 6 36.5115 37.0 37.0 37.0 37.0 37.0 7 36.3715 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.4735 37.0 37.0 37.0 37.0 37.0 10-11 36.48175 37.0 37.0 37.0 37.0 37.0 12-13 36.456 37.0 37.0 37.0 37.0 37.0 14-15 36.4945 37.0 37.0 37.0 37.0 37.0 16-17 36.48625 37.0 37.0 37.0 37.0 37.0 18-19 36.443 37.0 37.0 37.0 37.0 37.0 20-21 36.48025 37.0 37.0 37.0 37.0 37.0 22-23 36.44525 37.0 37.0 37.0 37.0 37.0 24-25 36.458749999999995 37.0 37.0 37.0 37.0 37.0 26-27 36.357 37.0 37.0 37.0 37.0 37.0 28-29 36.429249999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.4005 37.0 37.0 37.0 37.0 37.0 32-33 36.389250000000004 37.0 37.0 37.0 37.0 37.0 34-35 36.323 37.0 37.0 37.0 37.0 37.0 36-37 36.31725 37.0 37.0 37.0 37.0 37.0 38-39 36.310500000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.2245 37.0 37.0 37.0 37.0 37.0 42-43 36.1685 37.0 37.0 37.0 37.0 37.0 44-45 36.232 37.0 37.0 37.0 37.0 37.0 46-47 36.20875 37.0 37.0 37.0 37.0 37.0 48-49 36.26 37.0 37.0 37.0 37.0 37.0 50-51 36.1375 37.0 37.0 37.0 37.0 37.0 52-53 36.24125 37.0 37.0 37.0 37.0 37.0 54-55 36.119 37.0 37.0 37.0 37.0 37.0 56-57 36.1815 37.0 37.0 37.0 37.0 37.0 58-59 36.149 37.0 37.0 37.0 37.0 37.0 60-61 36.119 37.0 37.0 37.0 37.0 37.0 62-63 36.04375 37.0 37.0 37.0 37.0 37.0 64-65 35.96575 37.0 37.0 37.0 37.0 37.0 66-67 36.088499999999996 37.0 37.0 37.0 37.0 37.0 68-69 36.01575 37.0 37.0 37.0 37.0 37.0 70-71 36.08825 37.0 37.0 37.0 37.0 37.0 72-73 36.06 37.0 37.0 37.0 37.0 37.0 74-75 36.02875 37.0 37.0 37.0 37.0 37.0 76-77 36.1025 37.0 37.0 37.0 37.0 37.0 78-79 36.03875 37.0 37.0 37.0 37.0 37.0 80-81 35.998 37.0 37.0 37.0 37.0 37.0 82-83 36.0205 37.0 37.0 37.0 37.0 37.0 84-85 36.008250000000004 37.0 37.0 37.0 37.0 37.0 86-87 36.037 37.0 37.0 37.0 37.0 37.0 88-89 36.065 37.0 37.0 37.0 37.0 37.0 90-91 35.932 37.0 37.0 37.0 37.0 37.0 92-93 35.97525 37.0 37.0 37.0 37.0 37.0 94-95 35.962 37.0 37.0 37.0 37.0 37.0 96-97 35.96825 37.0 37.0 37.0 37.0 37.0 98-99 35.95525 37.0 37.0 37.0 37.0 37.0 100-101 35.968 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 7.0 23 2.0 24 8.0 25 4.0 26 13.0 27 22.0 28 23.0 29 37.0 30 36.0 31 44.0 32 50.0 33 77.0 34 114.0 35 216.0 36 1730.0 37 1616.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.21031547320981 9.864797195793692 10.741111667501253 39.18377566349524 2 22.5 13.475000000000001 28.525 35.5 3 21.975 16.900000000000002 23.974999999999998 37.15 4 28.525 23.825 17.575 30.075000000000003 5 28.299999999999997 27.500000000000004 20.724999999999998 23.474999999999998 6 22.7 31.4 23.325000000000003 22.575 7 20.7 22.425 36.325 20.549999999999997 8 21.825 22.650000000000002 28.799999999999997 26.724999999999998 9 22.325 20.674999999999997 31.025000000000002 25.974999999999998 10-11 24.762500000000003 27.6125 22.787499999999998 24.837500000000002 12-13 24.575 22.8625 25.324999999999996 27.237499999999997 14-15 23.5 23.962500000000002 25.825 26.7125 16-17 24.1125 24.349999999999998 24.349999999999998 27.187499999999996 18-19 23.9 23.5875 25.937500000000004 26.575 20-21 24.95 25.35 24.05 25.650000000000002 22-23 24.5375 24.025 24.575 26.8625 24-25 23.6375 24.375 24.0125 27.975 26-27 23.875 23.6375 24.975 27.5125 28-29 24.8 24.212500000000002 24.337500000000002 26.650000000000002 30-31 24.9 24.474999999999998 23.9125 26.7125 32-33 24.075 24.2875 24.825 26.8125 34-35 24.6 23.35 24.6125 27.437499999999996 36-37 24.4875 23.7 24.7 27.1125 38-39 24.2875 24.462500000000002 23.8875 27.3625 40-41 25.2875 23.925 24.337500000000002 26.450000000000003 42-43 25.0 23.825 23.799999999999997 27.375 44-45 25.112499999999997 23.1625 24.75 26.974999999999998 46-47 25.837500000000002 23.7 23.775 26.687499999999996 48-49 25.474999999999998 24.5 23.7375 26.2875 50-51 25.650000000000002 24.474999999999998 23.5375 26.337500000000002 52-53 25.45 23.825 23.4625 27.2625 54-55 24.1875 24.2375 23.95 27.625 56-57 23.8875 24.3625 24.462500000000002 27.287499999999998 58-59 25.650000000000002 23.962500000000002 23.275000000000002 27.1125 60-61 25.75 22.912499999999998 24.337500000000002 27.0 62-63 24.85 23.849999999999998 24.625 26.674999999999997 64-65 25.05 24.025 23.75 27.175 66-67 25.837500000000002 23.6375 23.7875 26.737499999999997 68-69 25.624999999999996 24.0 23.2875 27.0875 70-71 25.0125 23.825 24.175 26.987499999999997 72-73 25.4875 24.224999999999998 22.95 27.3375 74-75 25.637500000000003 24.212500000000002 23.4875 26.6625 76-77 25.75 24.5 22.875 26.875 78-79 26.387500000000003 24.725 23.974999999999998 24.9125 80-81 26.474999999999998 23.3875 23.1375 27.0 82-83 26.437500000000004 24.637500000000003 22.5875 26.337500000000002 84-85 26.450000000000003 23.5375 23.4375 26.575 86-87 25.087500000000002 23.6625 23.7875 27.462500000000002 88-89 26.575 23.9125 22.25 27.2625 90-91 25.837500000000002 24.825 22.975 26.3625 92-93 26.3 24.4125 22.8125 26.474999999999998 94-95 26.237500000000004 23.925 22.325 27.5125 96-97 25.424999999999997 25.2 21.9 27.474999999999998 98-99 25.35 25.2 23.3125 26.137500000000003 100-101 26.35 24.3625 22.85 26.437500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 6.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.5 11 1.0 12 1.5 13 2.0 14 1.0 15 0.5 16 1.0 17 1.5 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 1.0 24 2.0 25 2.0 26 2.0 27 1.5 28 1.0 29 1.5 30 2.5 31 4.0 32 6.0 33 8.5 34 7.0 35 10.5 36 24.0 37 36.0 38 49.5 39 67.0 40 82.5 41 107.0 42 128.5 43 142.0 44 147.5 45 159.0 46 180.5 47 185.5 48 184.5 49 167.5 50 156.5 51 153.0 52 142.5 53 132.5 54 123.0 55 130.5 56 120.5 57 101.0 58 87.5 59 83.0 60 88.0 61 80.5 62 79.0 63 80.5 64 73.0 65 63.5 66 59.0 67 60.0 68 58.0 69 60.0 70 60.0 71 49.0 72 34.0 73 26.5 74 31.0 75 28.5 76 23.0 77 19.0 78 15.5 79 11.5 80 7.5 81 4.5 82 3.0 83 4.0 84 2.0 85 1.5 86 2.0 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.9 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35582154515778 84.875 2 6.936887921653971 12.75 3 0.544069640914037 1.5 4 0.13601741022850924 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02720348204570185 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 15 0.375 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.07500000000000001 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.1875 0.0 0.0 0.0 0.0 40-41 0.2625 0.0 0.0 0.0 0.0 42-43 0.2875 0.0 0.0 0.0 0.0 44-45 0.3375 0.0 0.0 0.0 0.0 46-47 0.4125 0.0 0.0 0.0 0.0 48-49 0.5 0.0 0.0 0.0 0.0 50-51 0.5625 0.0 0.0 0.0 0.0 52-53 0.6625 0.0 0.0 0.0 0.0 54-55 0.8125 0.0 0.0 0.0 0.0 56-57 0.925 0.0 0.0 0.0 0.0 58-59 1.0125 0.0 0.0 0.0 0.0 60-61 1.2375 0.0 0.0 0.0 0.0 62-63 1.4 0.0 0.0 0.0 0.0 64-65 1.5125 0.0 0.0 0.0 0.0 66-67 1.725 0.0 0.0 0.0 0.0 68-69 2.0 0.0 0.0 0.0 0.0 70-71 2.2625 0.0 0.0 0.0 0.0 72-73 2.65 0.0 0.0 0.0 0.0 74-75 3.0 0.0 0.0 0.0 0.0 76-77 3.625 0.0 0.0 0.0 0.0 78-79 4.2 0.0 0.0 0.0 0.0 80-81 4.6 0.0 0.0 0.0 0.0 82-83 4.975 0.0 0.0 0.0 0.0 84-85 5.5625 0.0 0.0 0.0 0.0 86-87 5.9625 0.0 0.0 0.0 0.0 88-89 6.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450052 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450052_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.169 37.0 37.0 37.0 37.0 37.0 2 36.10825 37.0 37.0 37.0 37.0 37.0 3 36.087 37.0 37.0 37.0 37.0 37.0 4 36.2425 37.0 37.0 37.0 37.0 37.0 5 36.198 37.0 37.0 37.0 37.0 37.0 6 36.22975 37.0 37.0 37.0 37.0 37.0 7 36.23 37.0 37.0 37.0 37.0 37.0 8 36.2605 37.0 37.0 37.0 37.0 37.0 9 36.162 37.0 37.0 37.0 37.0 37.0 10-11 36.14275 37.0 37.0 37.0 37.0 37.0 12-13 36.158500000000004 37.0 37.0 37.0 37.0 37.0 14-15 36.105999999999995 37.0 37.0 37.0 37.0 37.0 16-17 36.108000000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.102125 37.0 37.0 37.0 37.0 37.0 20-21 36.19125 37.0 37.0 37.0 37.0 37.0 22-23 36.136875 37.0 37.0 37.0 37.0 37.0 24-25 36.1135 37.0 37.0 37.0 37.0 37.0 26-27 36.056749999999994 37.0 37.0 37.0 37.0 37.0 28-29 36.081500000000005 37.0 37.0 37.0 37.0 37.0 30-31 36.111000000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.05575 37.0 37.0 37.0 37.0 37.0 34-35 35.9165 37.0 37.0 37.0 37.0 37.0 36-37 35.952749999999995 37.0 37.0 37.0 37.0 37.0 38-39 35.9465 37.0 37.0 37.0 37.0 37.0 40-41 36.06425 37.0 37.0 37.0 37.0 37.0 42-43 35.990875 37.0 37.0 37.0 37.0 37.0 44-45 35.931 37.0 37.0 37.0 37.0 37.0 46-47 35.93 37.0 37.0 37.0 37.0 37.0 48-49 35.90425 37.0 37.0 37.0 37.0 37.0 50-51 35.9475 37.0 37.0 37.0 37.0 37.0 52-53 35.985 37.0 37.0 37.0 37.0 37.0 54-55 35.83375 37.0 37.0 37.0 37.0 37.0 56-57 35.917249999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.77825 37.0 37.0 37.0 37.0 37.0 60-61 35.94175 37.0 37.0 37.0 37.0 37.0 62-63 35.96225 37.0 37.0 37.0 37.0 37.0 64-65 35.791 37.0 37.0 37.0 37.0 37.0 66-67 35.828 37.0 37.0 37.0 37.0 37.0 68-69 35.702875 37.0 37.0 37.0 37.0 37.0 70-71 35.788 37.0 37.0 37.0 37.0 37.0 72-73 35.71925 37.0 37.0 37.0 37.0 37.0 74-75 35.710750000000004 37.0 37.0 37.0 37.0 37.0 76-77 35.826499999999996 37.0 37.0 37.0 37.0 37.0 78-79 35.7875 37.0 37.0 37.0 37.0 37.0 80-81 35.595875 37.0 37.0 37.0 37.0 37.0 82-83 35.679125 37.0 37.0 37.0 37.0 37.0 84-85 35.7975 37.0 37.0 37.0 37.0 37.0 86-87 35.81625 37.0 37.0 37.0 37.0 37.0 88-89 35.806749999999994 37.0 37.0 37.0 37.0 37.0 90-91 35.75512500000001 37.0 37.0 37.0 37.0 37.0 92-93 35.766999999999996 37.0 37.0 37.0 37.0 37.0 94-95 35.722750000000005 37.0 37.0 37.0 37.0 37.0 96-97 35.722125000000005 37.0 37.0 37.0 37.0 37.0 98-99 35.778875 37.0 37.0 37.0 37.0 37.0 100-101 35.624875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 5.0 16 3.0 17 4.0 18 7.0 19 5.0 20 6.0 21 12.0 22 13.0 23 12.0 24 17.0 25 14.0 26 9.0 27 23.0 28 19.0 29 20.0 30 30.0 31 41.0 32 58.0 33 58.0 34 105.0 35 231.0 36 2087.0 37 1219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6 17.150000000000002 12.35 30.9 2 25.98149537384346 23.1807951987997 25.531382845711427 25.30632658164541 3 24.55 23.825 27.725 23.9 4 31.175000000000004 26.224999999999998 17.925 24.675 5 30.025000000000002 28.849999999999998 18.95 22.175 6 23.55588897224306 32.733183295823956 20.05501375343836 23.655913978494624 7 26.724999999999998 19.2 29.799999999999997 24.275 8 26.25 19.6 22.775000000000002 31.374999999999996 9 26.325 21.575 24.575 27.525 10-11 28.3625 27.187499999999996 18.325 26.125 12-13 28.462500000000002 20.8 23.2375 27.500000000000004 14-15 27.474999999999998 24.3125 23.5625 24.65 16-17 28.275 24.45 22.037499999999998 25.2375 18-19 27.678459807475935 24.803100387548444 22.527815976997125 24.990623827978496 20-21 27.425 25.362499999999997 21.6125 25.6 22-23 28.141017627203404 24.815601950243778 22.365295661957745 24.678084760595073 24-25 26.8125 24.9375 22.75 25.5 26-27 26.724999999999998 25.25 22.8375 25.1875 28-29 28.549999999999997 24.125 22.1 25.224999999999998 30-31 27.537499999999998 23.9875 22.475 26.0 32-33 27.1125 23.7875 22.9375 26.1625 34-35 27.6125 24.0125 22.45 25.924999999999997 36-37 26.474999999999998 24.2875 22.825 26.4125 38-39 26.400000000000002 24.3875 23.775 25.4375 40-41 27.0625 25.2375 21.5625 26.137500000000003 42-43 26.428303537942245 24.56557069633704 22.927865983247905 26.078259782472806 44-45 26.86921730432608 25.04376094023506 22.393098274568644 25.693923480870218 46-47 26.85 25.2125 22.075 25.8625 48-49 26.924999999999997 23.9875 23.65 25.4375 50-51 25.687500000000004 24.825 23.075000000000003 26.4125 52-53 27.3875 23.6875 23.1 25.825 54-55 26.525 24.0625 23.2125 26.200000000000003 56-57 27.0125 24.7875 23.2625 24.9375 58-59 27.0625 24.099999999999998 23.625 25.2125 60-61 27.975 24.3625 22.525000000000002 25.137500000000003 62-63 27.55 24.3625 23.2125 24.875 64-65 27.224999999999998 24.3625 22.575 25.837500000000002 66-67 26.937499999999996 24.712500000000002 22.8125 25.5375 68-69 27.128391048881113 24.278034754344294 23.49043630453807 25.103137892236532 70-71 27.619404851212803 24.843710927731934 22.330582645661416 25.206301575393848 72-73 27.644411102775695 24.343585896474117 23.168292073018254 24.843710927731934 74-75 26.44411102775694 25.04376094023506 24.031007751937985 24.48112028007002 76-77 27.8375 23.849999999999998 23.0625 25.25 78-79 26.3 24.075 24.2875 25.337500000000002 80-81 26.215776972121514 24.46555819477435 23.72796599574947 25.59069883735467 82-83 28.316039504938118 23.827978497312163 23.215401925240656 24.640580072509064 84-85 28.787499999999998 24.099999999999998 22.6 24.5125 86-87 27.950000000000003 24.75 22.6875 24.6125 88-89 27.650000000000002 24.5625 21.9 25.887500000000003 90-91 29.11613951743968 23.940492561570196 21.690211276409553 25.25315664458057 92-93 28.49462365591398 24.48112028007002 22.9057264316079 24.118529632408105 94-95 29.457364341085274 23.393348337084273 22.655663915978995 24.493623405851466 96-97 29.028628578572324 25.353169146143266 22.30278784848106 23.31541442680335 98-99 28.42855356919615 25.240655081885237 22.740342542817853 23.590448806100763 100-101 30.103762970371296 24.66558319789974 22.277784723090384 22.95286910863858 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 1.0 11 1.5 12 3.0 13 2.5 14 1.5 15 3.5 16 5.0 17 3.0 18 1.0 19 1.0 20 3.0 21 3.0 22 1.0 23 1.5 24 1.0 25 1.0 26 3.0 27 3.0 28 3.5 29 3.5 30 3.0 31 4.5 32 8.0 33 12.0 34 12.5 35 16.0 36 21.0 37 28.0 38 35.0 39 50.5 40 76.0 41 95.5 42 119.0 43 134.5 44 149.0 45 165.5 46 160.5 47 155.5 48 167.0 49 174.0 50 155.0 51 136.5 52 131.0 53 134.5 54 136.5 55 130.0 56 115.0 57 102.5 58 98.0 59 89.0 60 86.5 61 89.0 62 77.0 63 67.5 64 77.0 65 83.0 66 82.0 67 70.5 68 72.0 69 66.0 70 51.5 71 50.0 72 52.5 73 52.0 74 38.5 75 27.0 76 21.0 77 18.0 78 14.5 79 12.5 80 9.0 81 4.5 82 3.0 83 2.0 84 1.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.025 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.025 72-73 0.025 74-75 0.025 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.025 94-95 0.025 96-97 0.0125 98-99 0.0125 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48648648648648 85.55 2 7.054054054054054 13.05 3 0.35135135135135137 0.975 4 0.08108108108108107 0.3 5 0.02702702702702703 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACCATAAACG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.07500000000000001 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.1875 0.0 0.0 0.0 0.0 40-41 0.2625 0.0 0.0 0.0 0.0 42-43 0.2875 0.0 0.0 0.0 0.0 44-45 0.3375 0.0 0.0 0.0 0.0 46-47 0.4125 0.0 0.0 0.0 0.0 48-49 0.5 0.0 0.0 0.0 0.0 50-51 0.5625 0.0 0.0 0.0 0.0 52-53 0.6625 0.0 0.0 0.0 0.0 54-55 0.8125 0.0 0.0 0.0 0.0 56-57 0.925 0.0 0.0 0.0 0.0 58-59 1.0125 0.0 0.0 0.0 0.0 60-61 1.2375 0.0 0.0 0.0 0.0 62-63 1.4 0.0 0.0 0.0 0.0 64-65 1.5125 0.0 0.0 0.0 0.0 66-67 1.725 0.0 0.0 0.0 0.0 68-69 2.0125 0.0 0.0 0.0 0.0 70-71 2.2874999999999996 0.0 0.0 0.0 0.0 72-73 2.6875 0.0 0.0 0.0 0.0 74-75 3.05 0.0 0.0 0.0 0.0 76-77 3.7 0.0 0.0 0.0 0.0 78-79 4.2875 0.0 0.0 0.0 0.0 80-81 4.699999999999999 0.0 0.0 0.0 0.0 82-83 5.075 0.0 0.0 0.0 0.0 84-85 5.6875 0.0 0.0 0.0 0.0 86-87 6.075 0.0 0.0 0.0 0.0 88-89 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494411 spots for ERR3450052.sra Written 1494411 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra Read 1494392 spots for ERR3450052.sra Written 1494392 spots for ERR3450052.sra SRR ids: ['ERR3450052.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_khq2esyi ERR3450052.sra spots: 29887859 blocks: [[1, 1494392], [1494393, 2988784], [2988785, 4483176], [4483177, 5977568], [5977569, 7471960], [7471961, 8966352], [8966353, 10460744], [10460745, 11955136], [11955137, 13449528], [13449529, 14943920], [14943921, 16438312], [16438313, 17932704], [17932705, 19427096], [19427097, 20921488], [20921489, 22415880], [22415881, 23910272], [23910273, 25404664], [25404665, 26899056], [26899057, 28393448], [28393449, 29887859]] ERR3450052 file size 7187578 ERR3450052 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450052 ERR3450052_1.fastq ERR3450052_2.fastq Input file: ERR3450052_1.fastq Paired file: ERR3450052_2.fastq trimmed: ERR3450052-trimmed-pair1.fastq, ERR3450052-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:06:14 2024 >> started Sat Dec 7 14:06:42 2024 >> done (28.207s) 29887859 read pairs processed; of these: 279 ( 0.00%) short read pairs filtered out after trimming by size control 53622 ( 0.18%) empty read pairs filtered out after trimming by size control 29833958 (99.82%) read pairs available; of these: 3546158 (11.89%) trimmed read pairs available after processing 26287800 (88.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 49 0.00% 19 96 0.00% 20 283 0.00% 21 706 0.00% 22 872 0.00% 23 420 0.00% 24 410 0.00% 25 560 0.00% 26 914 0.00% 27 1180 0.00% 28 1661 0.01% 29 2157 0.01% 30 2629 0.01% 31 3336 0.01% 32 3409 0.01% 33 3171 0.01% 34 3309 0.01% 35 3396 0.01% 36 3692 0.01% 37 4219 0.01% 38 4966 0.02% 39 5617 0.02% 40 6681 0.02% 41 7865 0.03% 42 8931 0.03% 43 9164 0.03% 44 8203 0.03% 45 8302 0.03% 46 8832 0.03% 47 9874 0.03% 48 11028 0.04% 49 12231 0.04% 50 13647 0.05% 51 15054 0.05% 52 16540 0.06% 53 17375 0.06% 54 18386 0.06% 55 19238 0.06% 56 20060 0.07% 57 21494 0.07% 58 23202 0.08% 59 25291 0.08% 60 27006 0.09% 61 29640 0.10% 62 31992 0.11% 63 34188 0.11% 64 36147 0.12% 65 37535 0.13% 66 39167 0.13% 67 41379 0.14% 68 42882 0.14% 69 44717 0.15% 70 47963 0.16% 71 51039 0.17% 72 54371 0.18% 73 57603 0.19% 74 59481 0.20% 75 62598 0.21% 76 64568 0.22% 77 66434 0.22% 78 69062 0.23% 79 72686 0.24% 80 75055 0.25% 81 77882 0.26% 82 81952 0.27% 83 85405 0.29% 84 88506 0.30% 85 91761 0.31% 86 93395 0.31% 87 97155 0.33% 88 100249 0.34% 89 102152 0.34% 90 106236 0.36% 91 110067 0.37% 92 113209 0.38% 93 116049 0.39% 94 120112 0.40% 95 123278 0.41% 96 124827 0.42% 97 128773 0.43% 98 130139 0.44% 99 132499 0.44% 100 148549 0.50% 101 26287800 88.11% 29833958 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=21 prefix-density=0.27 prefix-fanout=2.5 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=173.16 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=21.3 sequence=CGCCGCCGCCGCGCCGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTCGTGCTTCTCGTAGAGGGCGAAGGCGCCAGCGGCGGCGGC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=26 prefix-density=0.22 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=218.05 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=23.7 sequence=CGGCGGCGGCGC ERR3450052 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:07:15 Started mapping on | Dec 07 14:07:15 Finished on | Dec 07 14:09:13 Mapping speed, Million of reads per hour | 910.19 Number of input reads | 29833958 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 25470413 Uniquely mapped reads % | 85.37% Average mapped length | 196.92 Number of splices: Total | 15688740 Number of splices: Annotated (sjdb) | 14858228 Number of splices: GT/AG | 15481089 Number of splices: GC/AG | 181286 Number of splices: AT/AC | 8528 Number of splices: Non-canonical | 17837 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1486481 % of reads mapped to multiple loci | 4.98% Number of reads mapped to too many loci | 417898 % of reads mapped to too many loci | 1.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 5.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2877064 2877064 2877064 N_multimapping 1486481 1486481 1486481 N_noFeature 661560 24464621 1281942 N_ambiguous 473055 3599 92707 UnstrandedReadsAssigned:24335798 PositiveStrandReadsAssigned:1002193 NegativeStrandReadsAssigned:24095764 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450052 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450052-trimmed-pair1.fastq ERR3450052-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,833,958 reads, 25,534,674 reads pseudoaligned [quant] estimated average fragment length: 179.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,283 rounds 52973 ERR3450052.ke.tsv 35125 ERR3450052.se.tsv 88098 total ==> ERR3450052.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.795 0 0 PNS24247 1044 865.629 64.1426 4.38906 PNS24249 1928 1749.63 238.966 8.08998 PNS24246 1044 865.629 64.1426 4.38906 PNS24248 1044 865.629 64.1426 4.38906 PNS24244 1471 1292.63 69.6059 3.18955 PNS24243 293 134.427 0 0 KQK14069 1603 1424.63 10502.8 436.675 KQK14071 474 298.978 536.609 106.31 ==> ERR3450052.se.tsv <== BRADI_1g14170v3 11300 BRADI_1g53295v3 62 BRADI_1g59795v3 241 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 2509 BRADI_1g74790v3 261 BRADI_1g09890v3 20 BRADI_1g77505v3 346 BRADI_1g48960v3 2 ERR3450052 completed mapping pipeline successfully