Starting /dee2/code/volunteer_pipeline.sh ERR3450053 current disk space = 1543169179648 free memory = 1606409928 ERR3450053 SRAfilesize 37ea8d62afde9cba723a7461064b430d ERR3450053.sra ERR3450053.sra file validated ERR3450053 is paired end ERR3450053 is conventional basespace ERR3450053 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450053_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.06025 37.0 37.0 37.0 37.0 37.0 2 36.3485 37.0 37.0 37.0 37.0 37.0 3 36.3255 37.0 37.0 37.0 37.0 37.0 4 36.44 37.0 37.0 37.0 37.0 37.0 5 36.5075 37.0 37.0 37.0 37.0 37.0 6 36.4975 37.0 37.0 37.0 37.0 37.0 7 36.4255 37.0 37.0 37.0 37.0 37.0 8 36.4695 37.0 37.0 37.0 37.0 37.0 9 36.552 37.0 37.0 37.0 37.0 37.0 10-11 36.5235 37.0 37.0 37.0 37.0 37.0 12-13 36.47775 37.0 37.0 37.0 37.0 37.0 14-15 36.521 37.0 37.0 37.0 37.0 37.0 16-17 36.481750000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.486999999999995 37.0 37.0 37.0 37.0 37.0 20-21 36.509249999999994 37.0 37.0 37.0 37.0 37.0 22-23 36.48675 37.0 37.0 37.0 37.0 37.0 24-25 36.48425 37.0 37.0 37.0 37.0 37.0 26-27 36.431 37.0 37.0 37.0 37.0 37.0 28-29 36.37875 37.0 37.0 37.0 37.0 37.0 30-31 36.28275 37.0 37.0 37.0 37.0 37.0 32-33 36.308 37.0 37.0 37.0 37.0 37.0 34-35 36.38225 37.0 37.0 37.0 37.0 37.0 36-37 36.33525 37.0 37.0 37.0 37.0 37.0 38-39 36.32625 37.0 37.0 37.0 37.0 37.0 40-41 36.2585 37.0 37.0 37.0 37.0 37.0 42-43 36.315749999999994 37.0 37.0 37.0 37.0 37.0 44-45 36.2475 37.0 37.0 37.0 37.0 37.0 46-47 36.17975 37.0 37.0 37.0 37.0 37.0 48-49 36.268249999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.20575 37.0 37.0 37.0 37.0 37.0 52-53 36.18875 37.0 37.0 37.0 37.0 37.0 54-55 36.12625 37.0 37.0 37.0 37.0 37.0 56-57 36.05475 37.0 37.0 37.0 37.0 37.0 58-59 36.06375 37.0 37.0 37.0 37.0 37.0 60-61 36.14175 37.0 37.0 37.0 37.0 37.0 62-63 36.092 37.0 37.0 37.0 37.0 37.0 64-65 36.108000000000004 37.0 37.0 37.0 37.0 37.0 66-67 36.0665 37.0 37.0 37.0 37.0 37.0 68-69 36.1285 37.0 37.0 37.0 37.0 37.0 70-71 36.039 37.0 37.0 37.0 37.0 37.0 72-73 36.0355 37.0 37.0 37.0 37.0 37.0 74-75 36.138999999999996 37.0 37.0 37.0 37.0 37.0 76-77 36.1335 37.0 37.0 37.0 37.0 37.0 78-79 36.14875 37.0 37.0 37.0 37.0 37.0 80-81 36.12475 37.0 37.0 37.0 37.0 37.0 82-83 36.046499999999995 37.0 37.0 37.0 37.0 37.0 84-85 36.0515 37.0 37.0 37.0 37.0 37.0 86-87 36.071 37.0 37.0 37.0 37.0 37.0 88-89 36.057500000000005 37.0 37.0 37.0 37.0 37.0 90-91 36.05675 37.0 37.0 37.0 37.0 37.0 92-93 35.99225 37.0 37.0 37.0 37.0 37.0 94-95 36.08725 37.0 37.0 37.0 37.0 37.0 96-97 36.02675 37.0 37.0 37.0 37.0 37.0 98-99 35.907 37.0 37.0 37.0 37.0 37.0 100-101 35.88175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 6.0 25 9.0 26 15.0 27 15.0 28 25.0 29 28.0 30 36.0 31 54.0 32 72.0 33 74.0 34 93.0 35 185.0 36 1728.0 37 1654.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.83738411425708 9.270859433725883 11.601102480581307 40.29065397143573 2 21.825 13.0 30.675 34.5 3 21.45 17.75 25.724999999999998 35.075 4 28.175 22.425 18.725 30.675 5 27.85 27.825 20.625 23.7 6 23.175 32.875 22.3 21.65 7 21.4 23.025000000000002 35.675000000000004 19.900000000000002 8 21.3 21.25 28.825 28.625 9 23.825 20.75 31.3 24.125 10-11 24.474999999999998 28.512500000000003 21.912499999999998 25.1 12-13 24.3 22.675 25.85 27.175 14-15 23.8875 24.8 25.074999999999996 26.237500000000004 16-17 24.762500000000003 24.025 25.374999999999996 25.837500000000002 18-19 23.3625 25.7 24.4875 26.450000000000003 20-21 23.825 25.174999999999997 25.937500000000004 25.0625 22-23 24.837500000000002 23.25 26.0625 25.85 24-25 24.9375 24.212500000000002 24.575 26.275 26-27 25.374999999999996 23.4625 24.85 26.3125 28-29 24.8625 24.2625 23.674999999999997 27.200000000000003 30-31 25.15 23.6375 23.849999999999998 27.3625 32-33 24.15 24.099999999999998 25.0 26.75 34-35 23.9125 23.9 25.3125 26.875 36-37 24.3 23.724999999999998 25.2625 26.7125 38-39 24.1125 24.337500000000002 25.1 26.450000000000003 40-41 24.962500000000002 24.425 23.7375 26.875 42-43 25.4375 23.925 24.224999999999998 26.4125 44-45 25.162499999999998 23.775 24.212500000000002 26.85 46-47 25.4 23.4625 25.0625 26.075 48-49 24.637500000000003 24.175 24.625 26.5625 50-51 24.825 24.8125 23.625 26.737499999999997 52-53 24.875 23.150000000000002 24.837500000000002 27.1375 54-55 24.1625 24.825 24.0125 27.0 56-57 24.2 23.549999999999997 25.074999999999996 27.175 58-59 24.9875 24.0 24.3625 26.650000000000002 60-61 25.275 23.799999999999997 24.3875 26.5375 62-63 24.5625 23.8125 24.675 26.950000000000003 64-65 24.7875 24.587500000000002 23.65 26.974999999999998 66-67 24.9 24.625 23.625 26.85 68-69 25.650000000000002 24.5125 23.3625 26.474999999999998 70-71 25.624999999999996 23.4375 23.4875 27.450000000000003 72-73 25.2375 24.7875 23.5875 26.387500000000003 74-75 25.662499999999998 24.15 24.05 26.137500000000003 76-77 25.7125 24.212500000000002 23.025000000000002 27.05 78-79 24.825 24.7 24.3625 26.1125 80-81 25.900000000000002 24.0125 22.8625 27.224999999999998 82-83 25.912499999999998 24.7375 22.35 27.0 84-85 25.637500000000003 24.2375 23.65 26.474999999999998 86-87 25.087500000000002 25.15 22.5125 27.250000000000004 88-89 25.112499999999997 23.599999999999998 23.4375 27.85 90-91 24.2875 24.4 23.3375 27.975 92-93 26.1125 24.575 23.5875 25.724999999999998 94-95 25.7625 25.074999999999996 22.650000000000002 26.5125 96-97 24.55 24.825 23.200000000000003 27.425 98-99 25.775 24.4125 22.8375 26.974999999999998 100-101 24.825 23.674999999999997 23.3625 28.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.5 2 1.0 3 1.5 4 1.5 5 0.5 6 1.0 7 1.5 8 2.5 9 2.5 10 1.0 11 0.5 12 1.0 13 2.0 14 1.5 15 1.5 16 3.0 17 2.0 18 1.0 19 2.0 20 1.5 21 1.0 22 0.5 23 0.5 24 2.0 25 2.0 26 0.5 27 1.0 28 2.0 29 1.0 30 1.0 31 3.5 32 7.5 33 9.5 34 6.5 35 9.5 36 27.5 37 39.5 38 43.5 39 54.5 40 83.5 41 106.0 42 125.5 43 155.0 44 167.0 45 170.0 46 174.5 47 178.0 48 181.5 49 183.5 50 171.5 51 158.5 52 159.5 53 148.5 54 130.0 55 130.5 56 132.0 57 107.5 58 85.0 59 80.0 60 78.0 61 73.5 62 75.5 63 70.0 64 55.0 65 58.5 66 55.0 67 55.0 68 54.0 69 47.5 70 49.0 71 47.0 72 40.0 73 31.0 74 28.5 75 23.0 76 17.5 77 16.0 78 14.0 79 10.5 80 9.0 81 8.0 82 4.0 83 2.5 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.94999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.05059021922428 80.10000000000001 2 8.347386172006747 14.85 3 1.1523327712197864 3.075 4 0.30916245081506466 1.0999999999999999 5 0.056211354693648116 0.25 6 0.028105677346824058 0.15 7 0.0 0.0 8 0.0 0.0 9 0.028105677346824058 0.22499999999999998 >10 0.028105677346824058 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 6 0.15 TruSeq Adapter, Index 13 (97% over 38bp) CCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTG 5 0.125 No Hit GTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.075 0.0 0.025 0.0 0.0 38-39 0.1625 0.0 0.025 0.0 0.0 40-41 0.2875 0.0 0.025 0.0 0.0 42-43 0.4 0.0 0.025 0.0 0.0 44-45 0.4375 0.0 0.025 0.0 0.0 46-47 0.4625 0.0 0.025 0.0 0.0 48-49 0.5625 0.0 0.025 0.0 0.0 50-51 0.6375 0.0 0.025 0.0 0.0 52-53 0.7 0.0 0.025 0.0 0.0 54-55 0.8125 0.0 0.025 0.0 0.0 56-57 1.0 0.0 0.025 0.0 0.0 58-59 1.2125 0.0 0.025 0.0 0.0 60-61 1.3875 0.0 0.025 0.0 0.0 62-63 1.4249999999999998 0.0 0.025 0.0 0.0 64-65 1.675 0.0 0.025 0.0 0.0 66-67 1.9625 0.0 0.025 0.0 0.0 68-69 2.1500000000000004 0.0 0.025 0.0 0.0 70-71 2.3625 0.0 0.025 0.0 0.0 72-73 2.5999999999999996 0.0 0.025 0.0 0.0 74-75 3.175 0.0 0.025 0.0 0.0 76-77 3.525 0.0 0.025 0.0 0.0 78-79 4.025 0.0 0.025 0.0 0.0 80-81 4.4625 0.0 0.025 0.0 0.0 82-83 4.8625 0.0 0.025 0.0 0.0 84-85 5.6375 0.0 0.025 0.0 0.0 86-87 6.2875 0.0 0.025 0.0 0.0 88-89 6.8375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450053 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450053_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7055 37.0 37.0 37.0 37.0 37.0 2 35.84375 37.0 37.0 37.0 37.0 37.0 3 35.9325 37.0 37.0 37.0 37.0 37.0 4 36.0085 37.0 37.0 37.0 37.0 37.0 5 36.2065 37.0 37.0 37.0 37.0 37.0 6 36.0865 37.0 37.0 37.0 37.0 37.0 7 36.0555 37.0 37.0 37.0 37.0 37.0 8 36.13 37.0 37.0 37.0 37.0 37.0 9 36.186 37.0 37.0 37.0 37.0 37.0 10-11 36.0805 37.0 37.0 37.0 37.0 37.0 12-13 36.09425 37.0 37.0 37.0 37.0 37.0 14-15 36.054 37.0 37.0 37.0 37.0 37.0 16-17 36.0945 37.0 37.0 37.0 37.0 37.0 18-19 36.033 37.0 37.0 37.0 37.0 37.0 20-21 36.097 37.0 37.0 37.0 37.0 37.0 22-23 36.059 37.0 37.0 37.0 37.0 37.0 24-25 36.04725 37.0 37.0 37.0 37.0 37.0 26-27 35.95675 37.0 37.0 37.0 37.0 37.0 28-29 35.96875 37.0 37.0 37.0 37.0 37.0 30-31 35.946 37.0 37.0 37.0 37.0 37.0 32-33 35.87975 37.0 37.0 37.0 37.0 37.0 34-35 35.8965 37.0 37.0 37.0 37.0 37.0 36-37 35.866 37.0 37.0 37.0 37.0 37.0 38-39 35.85925 37.0 37.0 37.0 37.0 37.0 40-41 35.771 37.0 37.0 37.0 37.0 37.0 42-43 35.745374999999996 37.0 37.0 37.0 37.0 37.0 44-45 35.77912499999999 37.0 37.0 37.0 37.0 37.0 46-47 35.896249999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.87575 37.0 37.0 37.0 37.0 37.0 50-51 35.788250000000005 37.0 37.0 37.0 37.0 37.0 52-53 35.911 37.0 37.0 37.0 37.0 37.0 54-55 35.774249999999995 37.0 37.0 37.0 37.0 37.0 56-57 35.785 37.0 37.0 37.0 37.0 37.0 58-59 35.622249999999994 37.0 37.0 37.0 37.0 37.0 60-61 35.664 37.0 37.0 37.0 37.0 37.0 62-63 35.7545 37.0 37.0 37.0 37.0 37.0 64-65 35.66675 37.0 37.0 37.0 37.0 37.0 66-67 35.67075 37.0 37.0 37.0 37.0 37.0 68-69 35.645250000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.593 37.0 37.0 37.0 37.0 37.0 72-73 35.642125 37.0 37.0 37.0 37.0 37.0 74-75 35.486875 37.0 37.0 37.0 37.0 37.0 76-77 35.62875 37.0 37.0 37.0 37.0 37.0 78-79 35.571 37.0 37.0 37.0 37.0 37.0 80-81 35.550250000000005 37.0 37.0 37.0 37.0 37.0 82-83 35.533249999999995 37.0 37.0 37.0 37.0 37.0 84-85 35.673 37.0 37.0 37.0 37.0 37.0 86-87 35.641000000000005 37.0 37.0 37.0 37.0 37.0 88-89 35.77525 37.0 37.0 37.0 37.0 37.0 90-91 35.73025 37.0 37.0 37.0 37.0 37.0 92-93 35.572874999999996 37.0 37.0 37.0 37.0 37.0 94-95 35.658500000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.537499999999994 37.0 37.0 37.0 37.0 37.0 98-99 35.58225 37.0 37.0 37.0 37.0 37.0 100-101 35.495000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 4.0 17 7.0 18 4.0 19 8.0 20 4.0 21 6.0 22 9.0 23 8.0 24 14.0 25 17.0 26 18.0 27 20.0 28 32.0 29 32.0 30 39.0 31 39.0 32 55.0 33 88.0 34 136.0 35 315.0 36 2247.0 37 895.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.150000000000006 16.55 12.8 30.5 2 26.156539134783696 22.630657664416105 26.531632908227053 24.681170292573142 3 25.85 22.675 26.825 24.65 4 30.2 27.450000000000003 17.65 24.7 5 28.7 29.025000000000002 18.425 23.849999999999998 6 24.55 31.5 19.650000000000002 24.3 7 26.05 18.975 29.7 25.275 8 24.175 21.875 23.35 30.599999999999998 9 26.674999999999997 21.224999999999998 24.375 27.725 10-11 27.725 28.012500000000003 18.95 25.3125 12-13 28.8625 21.675 23.0625 26.400000000000002 14-15 26.2125 25.4625 23.200000000000003 25.124999999999996 16-17 26.474999999999998 25.224999999999998 22.825 25.474999999999998 18-19 27.150000000000002 25.374999999999996 23.025000000000002 24.45 20-21 26.9625 25.5125 22.4375 25.087500000000002 22-23 27.725 24.0125 22.675 25.587500000000002 24-25 27.125 24.1125 23.4875 25.275 26-27 26.7125 25.5375 22.825 24.925 28-29 27.175 24.3625 22.85 25.6125 30-31 27.6625 24.0125 23.075000000000003 25.25 32-33 28.0625 24.1375 22.3125 25.4875 34-35 26.987499999999997 25.474999999999998 22.5 25.0375 36-37 27.9125 24.1375 22.6875 25.2625 38-39 27.3875 24.05 22.787499999999998 25.775 40-41 27.237499999999997 23.974999999999998 23.35 25.4375 42-43 25.853231653956744 23.990498812351543 24.265533191648956 25.890736342042754 44-45 27.040880110013752 23.81547693461683 23.55294411801475 25.59069883735467 46-47 26.5375 24.762500000000003 23.325000000000003 25.374999999999996 48-49 25.587500000000002 24.712500000000002 23.0375 26.6625 50-51 27.1625 23.6625 22.7375 26.437500000000004 52-53 26.8625 25.112499999999997 23.05 24.975 54-55 26.2875 24.587500000000002 23.325000000000003 25.8 56-57 26.437500000000004 25.112499999999997 24.0 24.45 58-59 27.237499999999997 24.474999999999998 23.5875 24.7 60-61 26.775 24.175 23.7375 25.3125 62-63 27.400000000000002 23.400000000000002 24.0375 25.162499999999998 64-65 26.55 25.162499999999998 22.8 25.4875 66-67 27.3125 25.087500000000002 23.3125 24.2875 68-69 26.6625 23.8375 23.3875 26.1125 70-71 27.200000000000003 24.45 23.8375 24.5125 72-73 26.703337917239654 24.94061757719715 24.01550193774222 24.34054256782098 74-75 26.815851981497683 24.553069133641706 23.265408176022003 25.365670708838607 76-77 27.187499999999996 24.474999999999998 23.5125 24.825 78-79 26.724999999999998 24.2 23.674999999999997 25.4 80-81 26.75 24.825 23.6625 24.762500000000003 82-83 27.3625 24.6 24.0625 23.974999999999998 84-85 27.3 24.712500000000002 22.7125 25.275 86-87 28.012500000000003 24.7 22.875 24.4125 88-89 28.037499999999998 24.375 23.05 24.5375 90-91 28.775000000000002 24.0 23.0875 24.1375 92-93 27.953494186773348 24.553069133641706 22.690336292036505 24.803100387548444 94-95 28.799999999999997 24.175 22.925 24.099999999999998 96-97 28.9 23.8625 23.1375 24.099999999999998 98-99 29.462500000000002 24.4 22.1 24.0375 100-101 29.3375 24.6125 22.787499999999998 23.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.0 9 3.0 10 3.5 11 0.5 12 2.0 13 3.5 14 1.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 2.5 26 3.5 27 2.0 28 3.0 29 4.0 30 4.5 31 5.0 32 5.0 33 4.0 34 4.0 35 15.0 36 26.0 37 26.5 38 48.0 39 71.0 40 81.5 41 105.5 42 120.0 43 122.5 44 134.5 45 156.0 46 170.5 47 170.5 48 177.0 49 177.5 50 150.5 51 145.0 52 164.0 53 157.5 54 127.5 55 120.0 56 117.0 57 101.5 58 107.5 59 97.0 60 75.5 61 81.0 62 69.5 63 63.0 64 86.0 65 87.0 66 71.0 67 69.0 68 64.0 69 54.5 70 57.0 71 51.5 72 43.5 73 41.0 74 32.0 75 19.5 76 16.0 77 17.5 78 12.5 79 6.5 80 5.5 81 3.0 82 3.0 83 3.0 84 1.5 85 1.5 86 0.5 87 2.5 88 2.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.775 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42049568365358 81.175 2 8.187134502923977 14.7 3 1.086048454469507 2.9250000000000003 4 0.2506265664160401 0.8999999999999999 5 0.0278473962684489 0.125 6 0.0 0.0 7 0.0278473962684489 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.2375 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.3875 0.0 0.0 0.0 0.0 46-47 0.4125 0.0 0.0 0.0 0.0 48-49 0.5125 0.0 0.0 0.0 0.0 50-51 0.5874999999999999 0.0 0.0 0.0 0.0 52-53 0.6625 0.0 0.0 0.0 0.0 54-55 0.7875000000000001 0.0 0.0 0.0 0.0 56-57 0.975 0.0 0.0 0.0 0.0 58-59 1.1625 0.0 0.0 0.0 0.0 60-61 1.3375 0.0 0.0 0.0 0.0 62-63 1.375 0.0 0.0 0.0 0.0 64-65 1.625 0.0 0.0 0.0 0.0 66-67 1.9125 0.0 0.0 0.0 0.0 68-69 2.0999999999999996 0.0 0.0 0.0 0.0 70-71 2.3125 0.0 0.0 0.0 0.0 72-73 2.55 0.0 0.0 0.0 0.0 74-75 3.125 0.0 0.0 0.0 0.0 76-77 3.475 0.0 0.0 0.0 0.0 78-79 3.975 0.0 0.0 0.0 0.0 80-81 4.3875 0.0 0.0 0.0 0.0 82-83 4.775 0.0 0.0 0.0 0.0 84-85 5.5375 0.0 0.0 0.0 0.0 86-87 6.175000000000001 0.0 0.0 0.0 0.0 88-89 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra Read 675324 spots for ERR3450053.sra Written 675324 spots for ERR3450053.sra Read 675317 spots for ERR3450053.sra Written 675317 spots for ERR3450053.sra SRR ids: ['ERR3450053.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o5p7wwre ERR3450053.sra spots: 13506347 blocks: [[1, 675317], [675318, 1350634], [1350635, 2025951], [2025952, 2701268], [2701269, 3376585], [3376586, 4051902], [4051903, 4727219], [4727220, 5402536], [5402537, 6077853], [6077854, 6753170], [6753171, 7428487], [7428488, 8103804], [8103805, 8779121], [8779122, 9454438], [9454439, 10129755], [10129756, 10805072], [10805073, 11480389], [11480390, 12155706], [12155707, 12831023], [12831024, 13506347]] ERR3450053 file size 3236178 ERR3450053 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450053 ERR3450053_1.fastq ERR3450053_2.fastq Input file: ERR3450053_1.fastq Paired file: ERR3450053_2.fastq trimmed: ERR3450053-trimmed-pair1.fastq, ERR3450053-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:06:12 2024 >> started Sat Dec 7 14:06:23 2024 >> done (10.768s) 13506347 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 24799 ( 0.18%) empty read pairs filtered out after trimming by size control 13481435 (99.82%) read pairs available; of these: 1435203 (10.65%) trimmed read pairs available after processing 12046232 (89.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 47 0.00% 20 111 0.00% 21 312 0.00% 22 399 0.00% 23 204 0.00% 24 205 0.00% 25 244 0.00% 26 364 0.00% 27 588 0.00% 28 811 0.01% 29 1089 0.01% 30 1286 0.01% 31 1503 0.01% 32 1650 0.01% 33 1580 0.01% 34 1615 0.01% 35 1592 0.01% 36 1732 0.01% 37 1852 0.01% 38 2325 0.02% 39 2592 0.02% 40 3212 0.02% 41 3714 0.03% 42 4191 0.03% 43 4255 0.03% 44 3810 0.03% 45 3756 0.03% 46 4074 0.03% 47 4456 0.03% 48 4870 0.04% 49 5468 0.04% 50 6050 0.04% 51 6552 0.05% 52 7321 0.05% 53 7739 0.06% 54 7943 0.06% 55 8303 0.06% 56 8761 0.06% 57 8985 0.07% 58 9789 0.07% 59 10962 0.08% 60 11586 0.09% 61 12272 0.09% 62 13533 0.10% 63 14364 0.11% 64 15046 0.11% 65 15366 0.11% 66 16134 0.12% 67 16753 0.12% 68 17366 0.13% 69 18205 0.14% 70 19546 0.14% 71 20971 0.16% 72 22018 0.16% 73 23436 0.17% 74 24297 0.18% 75 24961 0.19% 76 25454 0.19% 77 26784 0.20% 78 27158 0.20% 79 29036 0.22% 80 29697 0.22% 81 30807 0.23% 82 32612 0.24% 83 34132 0.25% 84 35101 0.26% 85 35924 0.27% 86 37020 0.27% 87 38254 0.28% 88 39389 0.29% 89 41152 0.31% 90 41853 0.31% 91 43381 0.32% 92 45637 0.34% 93 46700 0.35% 94 47993 0.36% 95 48801 0.36% 96 50260 0.37% 97 51368 0.38% 98 51884 0.38% 99 52560 0.39% 100 60057 0.45% 101 12046232 89.35% 13481435 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=1.9 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=186.50 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=22.2 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=24 prefix-density=0.17 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=203.74 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=22.4 sequence=CGGCGGCGGCGA ERR3450053 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:06:53 Started mapping on | Dec 07 14:06:53 Finished on | Dec 07 14:07:56 Mapping speed, Million of reads per hour | 770.37 Number of input reads | 13481435 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 10625374 Uniquely mapped reads % | 78.81% Average mapped length | 197.32 Number of splices: Total | 6615117 Number of splices: Annotated (sjdb) | 6266253 Number of splices: GT/AG | 6527851 Number of splices: GC/AG | 75607 Number of splices: AT/AC | 3878 Number of splices: Non-canonical | 7781 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 616995 % of reads mapped to multiple loci | 4.58% Number of reads mapped to too many loci | 367856 % of reads mapped to too many loci | 2.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 10.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2239066 2239066 2239066 N_multimapping 616995 616995 616995 N_noFeature 309299 10228440 547166 N_ambiguous 193510 1562 36122 UnstrandedReadsAssigned:10122565 PositiveStrandReadsAssigned:395372 NegativeStrandReadsAssigned:10042086 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450053 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450053-trimmed-pair1.fastq ERR3450053-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,481,435 reads, 10,577,797 reads pseudoaligned [quant] estimated average fragment length: 184.401 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 ERR3450053.ke.tsv 35125 ERR3450053.se.tsv 88098 total ==> ERR3450053.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.82 44.9033 8.50495 PNS24247 1044 860.599 18.6314 3.08694 PNS24249 1928 1744.6 107.679 8.80077 PNS24246 1044 860.599 18.6314 3.08694 PNS24248 1044 860.599 18.6314 3.08694 PNS24244 1471 1287.6 11.5233 1.27609 PNS24243 293 131.253 0 0 KQK14069 1603 1419.6 3800.86 381.77 KQK14071 474 294.544 238.585 115.499 ==> ERR3450053.se.tsv <== BRADI_1g14170v3 4179 BRADI_1g53295v3 19 BRADI_1g59795v3 105 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 1112 BRADI_1g74790v3 131 BRADI_1g09890v3 13 BRADI_1g77505v3 162 BRADI_1g48960v3 0 ERR3450053 completed mapping pipeline successfully