Starting /dee2/code/volunteer_pipeline.sh ERR3450056 current disk space = 1543127941120 free memory = 1592597928 ERR3450056 SRAfilesize 9238094b192c324d205678874fcfae08 ERR3450056.sra ERR3450056.sra file validated ERR3450056 is paired end ERR3450056 is conventional basespace ERR3450056 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450056_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.12725 37.0 37.0 37.0 37.0 37.0 2 36.4505 37.0 37.0 37.0 37.0 37.0 3 36.451 37.0 37.0 37.0 37.0 37.0 4 36.3825 37.0 37.0 37.0 37.0 37.0 5 36.5155 37.0 37.0 37.0 37.0 37.0 6 36.469 37.0 37.0 37.0 37.0 37.0 7 36.471 37.0 37.0 37.0 37.0 37.0 8 36.508 37.0 37.0 37.0 37.0 37.0 9 36.5 37.0 37.0 37.0 37.0 37.0 10-11 36.4315 37.0 37.0 37.0 37.0 37.0 12-13 36.442 37.0 37.0 37.0 37.0 37.0 14-15 36.5155 37.0 37.0 37.0 37.0 37.0 16-17 36.50675 37.0 37.0 37.0 37.0 37.0 18-19 36.49225 37.0 37.0 37.0 37.0 37.0 20-21 36.397999999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.38875 37.0 37.0 37.0 37.0 37.0 24-25 36.423249999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.408 37.0 37.0 37.0 37.0 37.0 28-29 36.3665 37.0 37.0 37.0 37.0 37.0 30-31 36.30175 37.0 37.0 37.0 37.0 37.0 32-33 36.3 37.0 37.0 37.0 37.0 37.0 34-35 36.2615 37.0 37.0 37.0 37.0 37.0 36-37 36.29 37.0 37.0 37.0 37.0 37.0 38-39 36.265 37.0 37.0 37.0 37.0 37.0 40-41 36.198 37.0 37.0 37.0 37.0 37.0 42-43 36.259 37.0 37.0 37.0 37.0 37.0 44-45 36.21925 37.0 37.0 37.0 37.0 37.0 46-47 36.139250000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.16475 37.0 37.0 37.0 37.0 37.0 50-51 36.163 37.0 37.0 37.0 37.0 37.0 52-53 36.15025 37.0 37.0 37.0 37.0 37.0 54-55 36.13275 37.0 37.0 37.0 37.0 37.0 56-57 36.142250000000004 37.0 37.0 37.0 37.0 37.0 58-59 36.17725 37.0 37.0 37.0 37.0 37.0 60-61 36.17425 37.0 37.0 37.0 37.0 37.0 62-63 36.03175 37.0 37.0 37.0 37.0 37.0 64-65 36.065 37.0 37.0 37.0 37.0 37.0 66-67 36.086 37.0 37.0 37.0 37.0 37.0 68-69 36.084 37.0 37.0 37.0 37.0 37.0 70-71 36.04475 37.0 37.0 37.0 37.0 37.0 72-73 36.0165 37.0 37.0 37.0 37.0 37.0 74-75 36.1125 37.0 37.0 37.0 37.0 37.0 76-77 36.14625 37.0 37.0 37.0 37.0 37.0 78-79 36.15 37.0 37.0 37.0 37.0 37.0 80-81 36.09925 37.0 37.0 37.0 37.0 37.0 82-83 36.04575 37.0 37.0 37.0 37.0 37.0 84-85 36.119 37.0 37.0 37.0 37.0 37.0 86-87 36.08875 37.0 37.0 37.0 37.0 37.0 88-89 36.12425 37.0 37.0 37.0 37.0 37.0 90-91 36.019000000000005 37.0 37.0 37.0 37.0 37.0 92-93 36.009 37.0 37.0 37.0 37.0 37.0 94-95 36.034499999999994 37.0 37.0 37.0 37.0 37.0 96-97 36.051249999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.88175 37.0 37.0 37.0 37.0 37.0 100-101 35.91775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 7.0 24 4.0 25 14.0 26 11.0 27 13.0 28 14.0 29 35.0 30 35.0 31 43.0 32 74.0 33 66.0 34 122.0 35 202.0 36 1785.0 37 1571.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.22403003754694 10.713391739674593 10.713391739674593 39.34918648310388 2 22.1 14.025000000000002 29.95 33.925 3 22.55 19.225 24.725 33.5 4 28.4 24.15 18.375 29.075 5 26.424999999999997 29.425 21.125 23.025000000000002 6 22.975 31.2 24.55 21.275 7 19.7 23.275000000000002 37.35 19.675 8 22.575 22.6 28.15 26.674999999999997 9 23.025000000000002 21.075 31.3 24.6 10-11 25.362499999999997 28.225 21.9375 24.474999999999998 12-13 24.15 23.7125 25.525 26.6125 14-15 23.400000000000002 24.875 26.0375 25.687500000000004 16-17 24.6625 24.8 25.4 25.137500000000003 18-19 24.1375 25.424999999999997 24.45 25.9875 20-21 24.0625 25.837500000000002 24.375 25.724999999999998 22-23 24.1875 23.400000000000002 25.1875 27.224999999999998 24-25 23.7875 24.9875 24.175 27.05 26-27 24.1125 25.2375 24.775 25.874999999999996 28-29 24.6 23.849999999999998 24.375 27.175 30-31 23.275000000000002 24.8 24.175 27.750000000000004 32-33 23.5 24.525 24.75 27.224999999999998 34-35 25.174999999999997 24.375 24.125 26.325 36-37 24.575 25.4625 24.175 25.7875 38-39 24.8625 25.624999999999996 24.349999999999998 25.162499999999998 40-41 25.074999999999996 25.2375 23.7 25.9875 42-43 24.8 25.374999999999996 23.974999999999998 25.85 44-45 24.825 24.3 24.1875 26.687499999999996 46-47 24.875 24.9375 24.2875 25.900000000000002 48-49 23.9 24.887500000000003 23.724999999999998 27.487499999999997 50-51 25.15 24.95 23.7125 26.187500000000004 52-53 25.5625 25.1 23.3375 26.0 54-55 25.087500000000002 24.025 24.099999999999998 26.787499999999998 56-57 25.5 23.8625 23.875 26.7625 58-59 25.4875 23.9 24.3625 26.25 60-61 25.074999999999996 23.5625 24.0375 27.325 62-63 24.1625 24.25 23.8125 27.775 64-65 25.55 23.8125 24.1875 26.450000000000003 66-67 25.2 24.0375 23.2875 27.474999999999998 68-69 24.962500000000002 25.0125 24.2 25.825 70-71 24.925 23.962500000000002 24.6 26.5125 72-73 25.074999999999996 24.15 23.4875 27.287499999999998 74-75 25.4375 24.474999999999998 23.6875 26.400000000000002 76-77 26.7625 24.5 22.825 25.912499999999998 78-79 25.724999999999998 24.7 23.45 26.125 80-81 25.05 25.124999999999996 23.4125 26.4125 82-83 25.674999999999997 23.6625 23.9875 26.674999999999997 84-85 25.687500000000004 24.4 23.0125 26.900000000000002 86-87 24.95 24.474999999999998 23.3 27.275 88-89 25.05 24.6 23.9375 26.4125 90-91 26.424999999999997 24.5375 22.9875 26.05 92-93 24.75 24.4875 24.4375 26.325 94-95 25.937500000000004 23.625 22.8875 27.55 96-97 24.4375 23.974999999999998 24.212500000000002 27.375 98-99 26.1 24.3 23.849999999999998 25.75 100-101 26.424999999999997 23.75 23.974999999999998 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 10.0 2 3.5 3 2.0 4 1.0 5 0.5 6 1.5 7 2.0 8 1.5 9 1.5 10 1.5 11 1.5 12 0.5 13 0.0 14 0.0 15 0.5 16 4.0 17 4.0 18 0.5 19 1.5 20 2.0 21 0.5 22 0.0 23 1.0 24 1.0 25 0.5 26 2.5 27 2.5 28 1.0 29 1.0 30 1.0 31 3.0 32 8.0 33 14.0 34 16.5 35 21.0 36 28.0 37 47.0 38 63.0 39 63.5 40 87.0 41 115.5 42 131.0 43 148.5 44 151.0 45 165.5 46 180.0 47 180.5 48 176.0 49 163.0 50 167.0 51 157.5 52 137.0 53 129.5 54 126.5 55 122.0 56 111.0 57 101.5 58 94.0 59 73.5 60 67.5 61 74.5 62 63.0 63 60.0 64 65.5 65 66.5 66 61.5 67 59.5 68 64.0 69 57.0 70 57.0 71 47.0 72 38.0 73 41.5 74 34.5 75 27.0 76 21.5 77 18.0 78 11.0 79 7.0 80 5.0 81 3.5 82 3.5 83 4.0 84 2.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.01216814159292 82.27499999999999 2 8.047566371681416 14.549999999999999 3 0.6637168141592921 1.7999999999999998 4 0.2488938053097345 0.8999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02765486725663717 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 19 0.475 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.11249999999999999 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.2875 0.0 0.0 0.0 0.0 50-51 0.3375 0.0 0.0 0.0 0.0 52-53 0.4375 0.0 0.0 0.0 0.0 54-55 0.5125 0.0 0.0 0.0 0.0 56-57 0.575 0.0 0.0 0.0 0.0 58-59 0.625 0.0 0.0 0.0 0.0 60-61 0.725 0.0 0.0 0.0 0.0 62-63 0.7625 0.0 0.0 0.0 0.0 64-65 0.8125 0.0 0.0 0.0 0.0 66-67 1.0375 0.0 0.0 0.0 0.0 68-69 1.1749999999999998 0.0 0.0 0.0 0.0 70-71 1.35 0.0 0.0 0.0 0.0 72-73 1.5375 0.0 0.0 0.0 0.0 74-75 1.75 0.0 0.0 0.0 0.0 76-77 1.9625 0.0 0.0 0.0 0.0 78-79 2.2750000000000004 0.0 0.0 0.0 0.0 80-81 2.5375 0.0 0.0 0.0 0.0 82-83 2.95 0.0 0.0 0.0 0.0 84-85 3.2125 0.0 0.0 0.0 0.0 86-87 3.6125 0.0 0.0 0.0 0.0 88-89 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450056 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450056_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.793 37.0 37.0 37.0 37.0 37.0 2 35.882 37.0 37.0 37.0 37.0 37.0 3 35.931 37.0 37.0 37.0 37.0 37.0 4 36.1015 37.0 37.0 37.0 37.0 37.0 5 36.239 37.0 37.0 37.0 37.0 37.0 6 36.07625 37.0 37.0 37.0 37.0 37.0 7 36.002 37.0 37.0 37.0 37.0 37.0 8 36.0555 37.0 37.0 37.0 37.0 37.0 9 36.201 37.0 37.0 37.0 37.0 37.0 10-11 36.0545 37.0 37.0 37.0 37.0 37.0 12-13 36.05 37.0 37.0 37.0 37.0 37.0 14-15 36.042 37.0 37.0 37.0 37.0 37.0 16-17 36.04775 37.0 37.0 37.0 37.0 37.0 18-19 36.070625 37.0 37.0 37.0 37.0 37.0 20-21 35.976749999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.101625 37.0 37.0 37.0 37.0 37.0 24-25 35.991 37.0 37.0 37.0 37.0 37.0 26-27 35.994749999999996 37.0 37.0 37.0 37.0 37.0 28-29 35.94975 37.0 37.0 37.0 37.0 37.0 30-31 35.94 37.0 37.0 37.0 37.0 37.0 32-33 35.8685 37.0 37.0 37.0 37.0 37.0 34-35 35.841499999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.870999999999995 37.0 37.0 37.0 37.0 37.0 38-39 35.89 37.0 37.0 37.0 37.0 37.0 40-41 35.851 37.0 37.0 37.0 37.0 37.0 42-43 35.817499999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.791 37.0 37.0 37.0 37.0 37.0 46-47 35.75675 37.0 37.0 37.0 37.0 37.0 48-49 35.79 37.0 37.0 37.0 37.0 37.0 50-51 35.72975 37.0 37.0 37.0 37.0 37.0 52-53 35.855999999999995 37.0 37.0 37.0 37.0 37.0 54-55 35.834500000000006 37.0 37.0 37.0 37.0 37.0 56-57 35.71175 37.0 37.0 37.0 37.0 37.0 58-59 35.70925 37.0 37.0 37.0 37.0 37.0 60-61 35.693 37.0 37.0 37.0 37.0 37.0 62-63 35.76925 37.0 37.0 37.0 37.0 37.0 64-65 35.658500000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.6945 37.0 37.0 37.0 37.0 37.0 68-69 35.646125 37.0 37.0 37.0 37.0 37.0 70-71 35.68075 37.0 37.0 37.0 37.0 37.0 72-73 35.5875 37.0 37.0 37.0 37.0 37.0 74-75 35.553875 37.0 37.0 37.0 37.0 37.0 76-77 35.6895 37.0 37.0 37.0 37.0 37.0 78-79 35.77275 37.0 37.0 37.0 37.0 37.0 80-81 35.64125 37.0 37.0 37.0 37.0 37.0 82-83 35.642625 37.0 37.0 37.0 37.0 37.0 84-85 35.62325 37.0 37.0 37.0 37.0 37.0 86-87 35.81 37.0 37.0 37.0 37.0 37.0 88-89 35.771 37.0 37.0 37.0 37.0 37.0 90-91 35.693250000000006 37.0 37.0 37.0 37.0 37.0 92-93 35.77075 37.0 37.0 37.0 37.0 37.0 94-95 35.681 37.0 37.0 37.0 37.0 37.0 96-97 35.7065 37.0 37.0 37.0 37.0 37.0 98-99 35.71125 37.0 37.0 37.0 37.0 37.0 100-101 35.705625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 5.0 17 1.0 18 6.0 19 3.0 20 5.0 21 6.0 22 11.0 23 21.0 24 12.0 25 12.0 26 11.0 27 32.0 28 21.0 29 27.0 30 45.0 31 51.0 32 41.0 33 92.0 34 128.0 35 306.0 36 2233.0 37 927.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.925 17.075000000000003 11.85 31.15 2 26.663331665832917 22.26113056528264 26.588294147073537 24.487243621810904 3 25.5 24.8 26.1 23.599999999999998 4 30.25 26.700000000000003 17.675 25.374999999999996 5 29.45 29.525000000000002 18.8 22.225 6 23.755938984746187 33.633408352088026 19.954988747186796 22.655663915978995 7 24.2 18.8 31.2 25.8 8 24.4 20.150000000000002 23.5 31.95 9 25.55 21.375 25.55 27.525 10-11 28.787499999999998 25.837500000000002 19.175 26.200000000000003 12-13 28.1 21.8125 21.987499999999997 28.1 14-15 25.687500000000004 25.0125 23.4125 25.887500000000003 16-17 27.5625 23.95 22.412499999999998 26.075 18-19 26.503312914114264 25.340667583447928 22.815351918989872 25.340667583447928 20-21 26.987499999999997 25.174999999999997 22.45 25.387500000000003 22-23 27.50343792974122 24.803100387548444 22.515314414301788 25.17814726840855 24-25 26.9125 24.4 23.1625 25.525 26-27 26.737499999999997 24.85 22.4625 25.95 28-29 27.737499999999997 23.875 22.6 25.7875 30-31 27.737499999999997 24.337500000000002 22.675 25.25 32-33 25.424999999999997 23.9875 23.7375 26.85 34-35 27.0625 24.7 23.0 25.2375 36-37 27.275 24.4 22.2 26.125 38-39 26.9625 23.0875 24.224999999999998 25.724999999999998 40-41 27.537499999999998 23.9875 22.6125 25.8625 42-43 25.693923480870218 24.431107776944234 23.78094523630908 26.094023505876468 44-45 26.413206603301653 24.562281140570285 23.186593296648326 25.83791895947974 46-47 28.012500000000003 24.05 22.425 25.5125 48-49 25.624999999999996 25.374999999999996 23.1875 25.8125 50-51 25.974999999999998 24.775 23.474999999999998 25.775 52-53 26.900000000000002 23.7375 23.3375 26.025 54-55 26.85 23.9875 23.225 25.937500000000004 56-57 25.974999999999998 24.0 24.6625 25.362499999999997 58-59 28.462500000000002 23.3875 22.900000000000002 25.25 60-61 26.737499999999997 25.6 22.8125 24.85 62-63 26.4125 24.5625 23.825 25.2 64-65 26.1625 24.7375 24.0625 25.0375 66-67 26.887499999999996 24.7 23.549999999999997 24.8625 68-69 26.778347293411674 25.015626953369168 23.777972246530815 24.428053506688336 70-71 28.60715178794699 23.943485871467868 23.030757689422355 24.418604651162788 72-73 26.80090045022511 24.23711855927964 23.524262131065534 25.437718859429715 74-75 26.147305239464803 24.0090033762661 24.234087782918596 25.609603601350507 76-77 28.037499999999998 23.2375 23.1625 25.5625 78-79 26.8625 25.124999999999996 23.275000000000002 24.7375 80-81 26.556639159789945 25.531382845711427 23.1807951987997 24.731182795698924 82-83 28.01600200025003 24.62807850981373 22.7903487935992 24.56557069633704 84-85 26.387500000000003 23.825 24.337500000000002 25.45 86-87 27.8625 24.1875 23.150000000000002 24.8 88-89 28.462500000000002 23.8125 22.4625 25.2625 90-91 28.0625 24.7875 22.6375 24.5125 92-93 27.776388194097045 24.72486243121561 22.511255627813906 24.987493746873437 94-95 27.406851712928233 24.731182795698924 22.218054513628406 25.64391097774444 96-97 27.181795448862218 25.03125781445361 23.330832708177045 24.456114028507127 98-99 27.644411102775695 25.731432858214554 22.73068267066767 23.893473368342086 100-101 28.89111138892362 24.00300037504688 22.215276909613703 24.8906113264158 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.5 2 3.0 3 2.5 4 1.5 5 1.0 6 1.5 7 1.5 8 1.5 9 2.5 10 1.5 11 0.5 12 3.5 13 4.0 14 3.0 15 3.5 16 2.5 17 2.5 18 2.0 19 1.0 20 1.5 21 2.5 22 3.0 23 2.0 24 1.0 25 1.0 26 2.5 27 4.0 28 4.0 29 3.0 30 1.5 31 6.0 32 9.5 33 8.5 34 11.5 35 16.5 36 25.0 37 29.0 38 39.5 39 65.0 40 84.5 41 111.0 42 135.5 43 138.5 44 138.5 45 150.5 46 153.5 47 158.0 48 168.0 49 163.5 50 157.5 51 142.5 52 131.0 53 130.0 54 119.0 55 109.0 56 116.5 57 112.5 58 96.5 59 88.5 60 86.5 61 81.5 62 76.0 63 71.5 64 70.5 65 73.0 66 70.0 67 65.0 68 62.0 69 67.0 70 68.5 71 59.0 72 47.0 73 41.0 74 42.0 75 36.5 76 23.5 77 19.5 78 16.5 79 10.5 80 7.5 81 5.0 82 3.5 83 3.0 84 2.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.025 44-45 0.05 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.025 72-73 0.05 74-75 0.0375 76-77 0.0 78-79 0.0 80-81 0.025 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.05 94-95 0.025 96-97 0.025 98-99 0.025 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6231804449327 83.39999999999999 2 7.278220269156825 13.25 3 0.7964844822850866 2.175 4 0.274649821477616 1.0 5 0.0 0.0 6 0.0 0.0 7 0.027464982147761604 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1375 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.2875 0.0 0.0 0.0 0.0 50-51 0.3375 0.0 0.0 0.0 0.0 52-53 0.4375 0.0 0.0 0.0 0.0 54-55 0.5125 0.0 0.0 0.0 0.0 56-57 0.575 0.0 0.0 0.0 0.0 58-59 0.625 0.0 0.0 0.0 0.0 60-61 0.7375 0.0 0.0 0.0 0.0 62-63 0.7875000000000001 0.0 0.0 0.0 0.0 64-65 0.8374999999999999 0.0 0.0 0.0 0.0 66-67 1.0625 0.0 0.0 0.0 0.0 68-69 1.1875 0.0 0.0 0.0 0.0 70-71 1.35 0.0 0.0 0.0 0.0 72-73 1.5375 0.0 0.0 0.0 0.0 74-75 1.75 0.0 0.0 0.0 0.0 76-77 1.9625 0.0 0.0 0.0 0.0 78-79 2.2750000000000004 0.0 0.0 0.0 0.0 80-81 2.55 0.0 0.0 0.0 0.0 82-83 2.9749999999999996 0.0 0.0 0.0 0.0 84-85 3.2375 0.0 0.0 0.0 0.0 86-87 3.6375 0.0 0.0 0.0 0.0 88-89 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789001 spots for ERR3450056.sra Written 789001 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra Read 789000 spots for ERR3450056.sra Written 789000 spots for ERR3450056.sra SRR ids: ['ERR3450056.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jj77y0za ERR3450056.sra spots: 15780001 blocks: [[1, 789000], [789001, 1578000], [1578001, 2367000], [2367001, 3156000], [3156001, 3945000], [3945001, 4734000], [4734001, 5523000], [5523001, 6312000], [6312001, 7101000], [7101001, 7890000], [7890001, 8679000], [8679001, 9468000], [9468001, 10257000], [10257001, 11046000], [11046001, 11835000], [11835001, 12624000], [12624001, 13413000], [13413001, 14202000], [14202001, 14991000], [14991001, 15780001]] ERR3450056 file size 3784608 ERR3450056 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450056 ERR3450056_1.fastq ERR3450056_2.fastq Input file: ERR3450056_1.fastq Paired file: ERR3450056_2.fastq trimmed: ERR3450056-trimmed-pair1.fastq, ERR3450056-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:09:14 2024 >> started Sat Dec 7 14:09:36 2024 >> done (21.630s) 15780001 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 15577 ( 0.10%) empty read pairs filtered out after trimming by size control 15764338 (99.90%) read pairs available; of these: 1153619 ( 7.32%) trimmed read pairs available after processing 14610719 (92.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 30 0.00% 20 92 0.00% 21 231 0.00% 22 303 0.00% 23 158 0.00% 24 163 0.00% 25 221 0.00% 26 284 0.00% 27 362 0.00% 28 518 0.00% 29 697 0.00% 30 850 0.01% 31 1004 0.01% 32 991 0.01% 33 915 0.01% 34 983 0.01% 35 977 0.01% 36 1149 0.01% 37 1247 0.01% 38 1427 0.01% 39 1640 0.01% 40 2022 0.01% 41 2352 0.01% 42 2578 0.02% 43 2664 0.02% 44 2518 0.02% 45 2552 0.02% 46 2724 0.02% 47 2970 0.02% 48 3189 0.02% 49 3533 0.02% 50 4073 0.03% 51 4392 0.03% 52 4751 0.03% 53 5105 0.03% 54 5531 0.04% 55 5653 0.04% 56 5934 0.04% 57 6270 0.04% 58 6762 0.04% 59 7093 0.04% 60 7763 0.05% 61 8503 0.05% 62 9432 0.06% 63 9979 0.06% 64 10580 0.07% 65 10839 0.07% 66 11205 0.07% 67 12024 0.08% 68 12697 0.08% 69 13100 0.08% 70 14376 0.09% 71 15179 0.10% 72 16089 0.10% 73 17008 0.11% 74 17663 0.11% 75 19110 0.12% 76 19312 0.12% 77 20285 0.13% 78 21333 0.14% 79 22466 0.14% 80 23558 0.15% 81 24577 0.16% 82 25720 0.16% 83 27113 0.17% 84 28151 0.18% 85 29553 0.19% 86 30439 0.19% 87 31384 0.20% 88 33086 0.21% 89 34154 0.22% 90 35206 0.22% 91 37248 0.24% 92 38403 0.24% 93 39761 0.25% 94 41799 0.27% 95 43023 0.27% 96 43893 0.28% 97 45710 0.29% 98 47126 0.30% 99 47814 0.30% 100 60034 0.38% 101 14610719 92.68% 15764338 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=26 prefix-density=0.21 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=267.85 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=25.1 sequence=GCCGCCGCCGCG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=388.67 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=25.2 sequence=CGCCGCCGCCAT ERR3450056 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:10:08 Started mapping on | Dec 07 14:10:08 Finished on | Dec 07 14:11:26 Mapping speed, Million of reads per hour | 727.58 Number of input reads | 15764338 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 13659204 Uniquely mapped reads % | 86.65% Average mapped length | 198.76 Number of splices: Total | 8545269 Number of splices: Annotated (sjdb) | 8102386 Number of splices: GT/AG | 8435109 Number of splices: GC/AG | 95234 Number of splices: AT/AC | 5116 Number of splices: Non-canonical | 9810 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 655193 % of reads mapped to multiple loci | 4.16% Number of reads mapped to too many loci | 164076 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 4.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1449941 1449941 1449941 N_multimapping 655193 655193 655193 N_noFeature 335282 13193252 596317 N_ambiguous 252034 1918 49866 UnstrandedReadsAssigned:13071888 PositiveStrandReadsAssigned:464034 NegativeStrandReadsAssigned:13013021 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450056 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450056-trimmed-pair1.fastq ERR3450056-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,764,338 reads, 13,740,559 reads pseudoaligned [quant] estimated average fragment length: 195.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 ERR3450056.ke.tsv 35125 ERR3450056.se.tsv 88098 total ==> ERR3450056.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.19 0 0 PNS24247 1044 849.046 25.8065 3.35115 PNS24249 1928 1733.05 171.202 10.8917 PNS24246 1044 849.046 25.8065 3.35115 PNS24248 1044 849.046 25.8065 3.35115 PNS24244 1471 1276.05 24.3782 2.10636 PNS24243 293 123.588 0 0 KQK14069 1603 1408.05 4916.59 384.985 KQK14071 474 284.026 167.839 65.1525 ==> ERR3450056.se.tsv <== BRADI_1g14170v3 5170 BRADI_1g53295v3 15 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 2298 BRADI_1g74790v3 122 BRADI_1g09890v3 13 BRADI_1g77505v3 173 BRADI_1g48960v3 2 ERR3450056 completed mapping pipeline successfully