Starting /dee2/code/volunteer_pipeline.sh ERR3450058
    current disk space = 1543039766528
    free memory = 1602559112 
ERR3450058 SRAfilesize
354b91f2c5f4a1ab1d0bc9e3fe23e8cf  ERR3450058.sra
ERR3450058.sra file validated
ERR3450058 is paired end
ERR3450058 is conventional basespace
ERR3450058 read1 length is 101 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	ERR3450058_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	101
%GC	52
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	36.154	37.0	37.0	37.0	37.0	37.0
2	36.32	37.0	37.0	37.0	37.0	37.0
3	36.2775	37.0	37.0	37.0	37.0	37.0
4	36.4075	37.0	37.0	37.0	37.0	37.0
5	36.3965	37.0	37.0	37.0	37.0	37.0
6	36.4275	37.0	37.0	37.0	37.0	37.0
7	36.469	37.0	37.0	37.0	37.0	37.0
8	36.49	37.0	37.0	37.0	37.0	37.0
9	36.4805	37.0	37.0	37.0	37.0	37.0
10-11	36.48825	37.0	37.0	37.0	37.0	37.0
12-13	36.444	37.0	37.0	37.0	37.0	37.0
14-15	36.43825	37.0	37.0	37.0	37.0	37.0
16-17	36.488	37.0	37.0	37.0	37.0	37.0
18-19	36.4065	37.0	37.0	37.0	37.0	37.0
20-21	36.40375	37.0	37.0	37.0	37.0	37.0
22-23	36.41525	37.0	37.0	37.0	37.0	37.0
24-25	36.445750000000004	37.0	37.0	37.0	37.0	37.0
26-27	36.33825	37.0	37.0	37.0	37.0	37.0
28-29	36.41375	37.0	37.0	37.0	37.0	37.0
30-31	36.33325	37.0	37.0	37.0	37.0	37.0
32-33	36.37025	37.0	37.0	37.0	37.0	37.0
34-35	36.304500000000004	37.0	37.0	37.0	37.0	37.0
36-37	36.22775	37.0	37.0	37.0	37.0	37.0
38-39	36.326750000000004	37.0	37.0	37.0	37.0	37.0
40-41	36.2905	37.0	37.0	37.0	37.0	37.0
42-43	36.25425	37.0	37.0	37.0	37.0	37.0
44-45	36.224500000000006	37.0	37.0	37.0	37.0	37.0
46-47	36.1635	37.0	37.0	37.0	37.0	37.0
48-49	36.194	37.0	37.0	37.0	37.0	37.0
50-51	36.245999999999995	37.0	37.0	37.0	37.0	37.0
52-53	36.199	37.0	37.0	37.0	37.0	37.0
54-55	36.179	37.0	37.0	37.0	37.0	37.0
56-57	36.135000000000005	37.0	37.0	37.0	37.0	37.0
58-59	36.1965	37.0	37.0	37.0	37.0	37.0
60-61	36.073	37.0	37.0	37.0	37.0	37.0
62-63	36.07525	37.0	37.0	37.0	37.0	37.0
64-65	36.0695	37.0	37.0	37.0	37.0	37.0
66-67	36.085499999999996	37.0	37.0	37.0	37.0	37.0
68-69	36.135	37.0	37.0	37.0	37.0	37.0
70-71	36.06075	37.0	37.0	37.0	37.0	37.0
72-73	36.051500000000004	37.0	37.0	37.0	37.0	37.0
74-75	36.0975	37.0	37.0	37.0	37.0	37.0
76-77	36.141000000000005	37.0	37.0	37.0	37.0	37.0
78-79	36.14675	37.0	37.0	37.0	37.0	37.0
80-81	36.12125	37.0	37.0	37.0	37.0	37.0
82-83	36.068749999999994	37.0	37.0	37.0	37.0	37.0
84-85	36.065	37.0	37.0	37.0	37.0	37.0
86-87	36.03775	37.0	37.0	37.0	37.0	37.0
88-89	36.115750000000006	37.0	37.0	37.0	37.0	37.0
90-91	36.08075	37.0	37.0	37.0	37.0	37.0
92-93	36.055499999999995	37.0	37.0	37.0	37.0	37.0
94-95	36.039249999999996	37.0	37.0	37.0	37.0	37.0
96-97	36.08125	37.0	37.0	37.0	37.0	37.0
98-99	36.00175	37.0	37.0	37.0	37.0	37.0
100-101	35.97575	37.0	37.0	37.0	37.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
21	1.0
22	3.0
23	0.0
24	6.0
25	13.0
26	10.0
27	23.0
28	21.0
29	26.0
30	43.0
31	49.0
32	57.0
33	81.0
34	101.0
35	194.0
36	1758.0
37	1614.0
>>END_MODULE
>>Per base sequence content	warn
#Base	G	A	T	C
1	41.27382146439318	9.854563691073219	10.882647943831495	37.9889669007021
2	21.85	13.925	27.900000000000002	36.325
3	23.849999999999998	17.1	23.849999999999998	35.199999999999996
4	29.849999999999998	22.425	17.125	30.599999999999998
5	27.150000000000002	28.299999999999997	21.075	23.474999999999998
6	24.349999999999998	30.099999999999998	22.7	22.85
7	20.575	22.1	37.425000000000004	19.900000000000002
8	23.625	19.5	29.799999999999997	27.075
9	22.575	21.95	30.45	25.025
10-11	23.7125	28.549999999999997	21.7375	26.0
12-13	24.575	22.6375	25.124999999999996	27.6625
14-15	23.1875	25.387500000000003	24.875	26.55
16-17	23.7125	24.0625	25.2625	26.9625
18-19	24.9875	25.8125	23.8125	25.387500000000003
20-21	24.325	24.712500000000002	24.8125	26.150000000000002
22-23	24.1375	24.587500000000002	24.5125	26.7625
24-25	24.4125	24.375	24.1625	27.05
26-27	23.8875	24.2375	23.9375	27.9375
28-29	25.45	24.325	22.9875	27.237499999999997
30-31	23.799999999999997	23.8875	24.337500000000002	27.975
32-33	24.6	24.1375	24.224999999999998	27.037499999999998
34-35	24.775	23.875	24.5125	26.8375
36-37	24.65	24.15	24.4125	26.787499999999998
38-39	25.275	24.4125	23.4375	26.875
40-41	24.712500000000002	24.462500000000002	23.962500000000002	26.8625
42-43	24.75	24.15	24.8625	26.237500000000004
44-45	25.55	23.4625	24.6625	26.325
46-47	26.05	24.0125	24.099999999999998	25.837500000000002
48-49	25.4875	22.8375	23.0	28.675
50-51	24.275	24.4375	24.3	26.987499999999997
52-53	25.4875	23.6875	24.0	26.825
54-55	25.0125	23.6625	23.7625	27.5625
56-57	25.4875	23.425	24.025	27.0625
58-59	25.7	24.3875	23.974999999999998	25.937500000000004
60-61	25.1	24.3125	23.525	27.0625
62-63	24.15	23.4375	24.3125	28.1
64-65	24.8625	23.6625	24.725	26.75
66-67	26.424999999999997	23.5875	23.625	26.3625
68-69	23.575	23.8375	24.1125	28.475
70-71	26.687499999999996	23.625	23.125	26.5625
72-73	26.887499999999996	24.0	22.475	26.637499999999996
74-75	25.324999999999996	23.400000000000002	24.3875	26.887499999999996
76-77	25.15	23.9875	23.65	27.212500000000002
78-79	26.2625	23.95	23.1625	26.625
80-81	24.337500000000002	24.3625	23.150000000000002	28.15
82-83	25.85	24.2875	22.075	27.787499999999998
84-85	25.9875	24.3625	22.5625	27.0875
86-87	25.275	24.275	24.462500000000002	25.9875
88-89	25.4875	23.0625	24.0125	27.437499999999996
90-91	25.674999999999997	24.8125	22.5875	26.924999999999997
92-93	26.4625	23.9	22.8875	26.75
94-95	25.4375	24.725	22.1875	27.650000000000002
96-97	24.9875	24.5375	22.375	28.1
98-99	25.05	23.1375	23.799999999999997	28.012500000000003
100-101	25.275	25.2	22.7625	26.7625
>>END_MODULE
>>Per sequence GC content	fail
#GC Content	Count
0	10.0
1	6.0
2	1.0
3	0.5
4	1.0
5	0.5
6	0.0
7	1.0
8	1.0
9	1.5
10	2.5
11	1.0
12	0.5
13	0.5
14	0.0
15	0.5
16	1.0
17	1.5
18	1.0
19	0.5
20	0.5
21	0.5
22	1.5
23	1.5
24	1.0
25	0.5
26	0.5
27	0.5
28	3.0
29	4.0
30	3.5
31	7.0
32	7.0
33	6.0
34	8.0
35	16.0
36	27.5
37	37.5
38	42.5
39	54.0
40	71.5
41	91.0
42	120.5
43	140.0
44	144.0
45	141.5
46	167.0
47	185.0
48	174.0
49	173.5
50	168.5
51	156.0
52	149.0
53	150.5
54	141.0
55	130.0
56	137.0
57	123.0
58	102.5
59	98.0
60	87.0
61	81.0
62	83.5
63	72.5
64	62.5
65	66.5
66	60.0
67	56.5
68	56.5
69	52.0
70	52.0
71	48.0
72	39.5
73	35.0
74	29.5
75	25.5
76	24.5
77	17.5
78	10.5
79	7.5
80	5.5
81	3.5
82	3.5
83	2.5
84	1.0
85	1.5
86	1.5
87	1.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.3
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-11	0.0
12-13	0.0
14-15	0.0
16-17	0.0
18-19	0.0
20-21	0.0
22-23	0.0
24-25	0.0
26-27	0.0
28-29	0.0
30-31	0.0
32-33	0.0
34-35	0.0
36-37	0.0
38-39	0.0
40-41	0.0
42-43	0.0
44-45	0.0
46-47	0.0
48-49	0.0
50-51	0.0
52-53	0.0
54-55	0.0
56-57	0.0
58-59	0.0
60-61	0.0
62-63	0.0
64-65	0.0
66-67	0.0
68-69	0.0
70-71	0.0
72-73	0.0
74-75	0.0
76-77	0.0
78-79	0.0
80-81	0.0
82-83	0.0
84-85	0.0
86-87	0.0
88-89	0.0
90-91	0.0
92-93	0.0
94-95	0.0
96-97	0.0
98-99	0.0
100-101	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
101	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	87.5
#Duplication Level	Percentage of deduplicated	Percentage of total
1	89.0	77.875
2	9.171428571428573	16.05
3	1.0571428571428572	2.775
4	0.4	1.4000000000000001
5	0.2285714285714286	1.0
6	0.08571428571428572	0.44999999999999996
7	0.028571428571428574	0.17500000000000002
8	0.0	0.0
9	0.0	0.0
>10	0.028571428571428574	0.27499999999999997
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA	11	0.27499999999999997	No Hit
GCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGACCC	7	0.17500000000000002	No Hit
GTCCCCTCTCTTTTCGAAGCTGTTTTGAATAAGCCGCAGCCTTTGCGTCT	6	0.15	No Hit
GCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGC	6	0.15	No Hit
GTCGAGTTATCATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCT	6	0.15	No Hit
TTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTCGCGA	5	0.125	No Hit
CGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATT	5	0.125	No Hit
CTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGT	5	0.125	No Hit
CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA	5	0.125	No Hit
CAGCCTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGC	5	0.125	No Hit
GGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTC	5	0.125	No Hit
CATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAAT	5	0.125	No Hit
CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT	5	0.125	No Hit
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0125	0.0	0.0	0.0	0.0
32-33	0.05	0.0	0.0	0.0	0.0
34-35	0.11249999999999999	0.0	0.0	0.0	0.0
36-37	0.16249999999999998	0.0	0.0	0.0	0.0
38-39	0.175	0.0	0.0	0.0	0.0
40-41	0.1875	0.0	0.0	0.0	0.0
42-43	0.2375	0.0	0.0	0.0	0.0
44-45	0.3	0.0	0.0	0.0	0.0
46-47	0.3125	0.0	0.0	0.0	0.0
48-49	0.3375	0.0	0.0	0.0	0.0
50-51	0.35	0.0	0.0	0.0	0.0
52-53	0.4	0.0	0.0	0.0	0.0
54-55	0.4875	0.0	0.0	0.0	0.0
56-57	0.5625	0.0	0.0	0.0	0.0
58-59	0.7	0.0	0.0	0.0	0.0
60-61	0.8125	0.0	0.0	0.0	0.0
62-63	0.925	0.0	0.0	0.0	0.0
64-65	1.0375	0.0	0.0	0.0	0.0
66-67	1.1625	0.0	0.0	0.0	0.0
68-69	1.3375	0.0	0.0	0.0	0.0
70-71	1.55	0.0	0.0	0.0	0.0
72-73	1.85	0.0	0.0	0.0	0.0
74-75	2.0	0.0	0.0	0.0	0.0
76-77	2.2249999999999996	0.0	0.0	0.0	0.0
78-79	2.5	0.0	0.0	0.0	0.0
80-81	2.7874999999999996	0.0	0.0	0.0	0.0
82-83	3.2625	0.0	0.0	0.0	0.0
84-85	3.575	0.0	0.0	0.0	0.0
86-87	3.9000000000000004	0.0	0.0	0.0	0.0
88-89	4.175	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	pass
>>END_MODULE
ERR3450058 read2 length is 101 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	ERR3450058_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	101
%GC	52
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	35.673	37.0	37.0	37.0	37.0	37.0
2	35.92025	37.0	37.0	37.0	37.0	37.0
3	35.8705	37.0	37.0	37.0	37.0	37.0
4	36.0185	37.0	37.0	37.0	37.0	37.0
5	36.007	37.0	37.0	37.0	37.0	37.0
6	36.0125	37.0	37.0	37.0	37.0	37.0
7	35.977	37.0	37.0	37.0	37.0	37.0
8	36.1025	37.0	37.0	37.0	37.0	37.0
9	36.022	37.0	37.0	37.0	37.0	37.0
10-11	36.01675	37.0	37.0	37.0	37.0	37.0
12-13	36.013	37.0	37.0	37.0	37.0	37.0
14-15	35.99875	37.0	37.0	37.0	37.0	37.0
16-17	36.08525	37.0	37.0	37.0	37.0	37.0
18-19	36.041	37.0	37.0	37.0	37.0	37.0
20-21	35.9905	37.0	37.0	37.0	37.0	37.0
22-23	36.01375	37.0	37.0	37.0	37.0	37.0
24-25	35.86925	37.0	37.0	37.0	37.0	37.0
26-27	36.0025	37.0	37.0	37.0	37.0	37.0
28-29	35.9585	37.0	37.0	37.0	37.0	37.0
30-31	35.98725	37.0	37.0	37.0	37.0	37.0
32-33	35.89175	37.0	37.0	37.0	37.0	37.0
34-35	35.8485	37.0	37.0	37.0	37.0	37.0
36-37	35.798249999999996	37.0	37.0	37.0	37.0	37.0
38-39	35.737	37.0	37.0	37.0	37.0	37.0
40-41	35.76225	37.0	37.0	37.0	37.0	37.0
42-43	35.759625	37.0	37.0	37.0	37.0	37.0
44-45	35.737375	37.0	37.0	37.0	37.0	37.0
46-47	35.7265	37.0	37.0	37.0	37.0	37.0
48-49	35.71925	37.0	37.0	37.0	37.0	37.0
50-51	35.70575	37.0	37.0	37.0	37.0	37.0
52-53	35.785250000000005	37.0	37.0	37.0	37.0	37.0
54-55	35.665499999999994	37.0	37.0	37.0	37.0	37.0
56-57	35.65475	37.0	37.0	37.0	37.0	37.0
58-59	35.607749999999996	37.0	37.0	37.0	37.0	37.0
60-61	35.58475	37.0	37.0	37.0	37.0	37.0
62-63	35.6445	37.0	37.0	37.0	37.0	37.0
64-65	35.584	37.0	37.0	37.0	37.0	37.0
66-67	35.70125	37.0	37.0	37.0	37.0	37.0
68-69	35.59325	37.0	37.0	37.0	37.0	37.0
70-71	35.52575	37.0	37.0	37.0	37.0	37.0
72-73	35.505125	37.0	37.0	37.0	37.0	37.0
74-75	35.464124999999996	37.0	37.0	37.0	37.0	37.0
76-77	35.534499999999994	37.0	37.0	37.0	37.0	37.0
78-79	35.51925	37.0	37.0	37.0	37.0	37.0
80-81	35.39475	37.0	37.0	37.0	37.0	37.0
82-83	35.411500000000004	37.0	37.0	37.0	37.0	37.0
84-85	35.534	37.0	37.0	37.0	37.0	37.0
86-87	35.63675	37.0	37.0	37.0	37.0	37.0
88-89	35.589749999999995	37.0	37.0	37.0	37.0	37.0
90-91	35.569500000000005	37.0	37.0	37.0	37.0	37.0
92-93	35.681125	37.0	37.0	37.0	37.0	37.0
94-95	35.701	37.0	37.0	37.0	37.0	37.0
96-97	35.609750000000005	37.0	37.0	37.0	37.0	37.0
98-99	35.5245	37.0	37.0	37.0	37.0	37.0
100-101	35.493	37.0	37.0	37.0	37.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
13	1.0
14	1.0
15	3.0
16	1.0
17	4.0
18	2.0
19	4.0
20	9.0
21	11.0
22	8.0
23	11.0
24	11.0
25	22.0
26	19.0
27	21.0
28	34.0
29	27.0
30	42.0
31	57.0
32	77.0
33	89.0
34	131.0
35	342.0
36	2223.0
37	850.0
>>END_MODULE
>>Per base sequence content	warn
#Base	G	A	T	C
1	40.725	16.375	12.225	30.675
2	27.581895473868467	22.780695173793447	25.78144536134033	23.85596399099775
3	25.474999999999998	24.125	26.025	24.375
4	28.475	28.425	18.5	24.6
5	31.075000000000003	28.875	17.4	22.650000000000002
6	23.075000000000003	32.775	21.175	22.975
7	25.8	19.475	31.05	23.674999999999997
8	25.724999999999998	20.200000000000003	23.674999999999997	30.4
9	26.05	22.5	25.474999999999998	25.974999999999998
10-11	28.8625	27.0875	19.162499999999998	24.887500000000003
12-13	28.475	22.0125	22.375	27.1375
14-15	27.0	24.7	22.825	25.474999999999998
16-17	27.325	24.712500000000002	22.7375	25.224999999999998
18-19	27.625	24.55	22.375	25.45
20-21	27.200000000000003	24.224999999999998	23.1125	25.4625
22-23	27.3375	24.775	22.6875	25.2
24-25	27.675	24.675	23.0125	24.637500000000003
26-27	26.487500000000004	24.65	23.6625	25.2
28-29	27.537499999999998	24.5625	21.7875	26.1125
30-31	27.250000000000004	24.8	22.912499999999998	25.0375
32-33	27.5875	24.125	23.8875	24.4
34-35	27.325	24.525	22.3125	25.837500000000002
36-37	28.175	24.575	21.45	25.8
38-39	27.3	24.825	23.200000000000003	24.675
40-41	27.750000000000004	24.125	22.7	25.424999999999997
42-43	27.61595199399925	23.615451931491435	24.04050506313289	24.72809101137642
44-45	27.378422302787847	24.103012876609576	23.777972246530815	24.74059257407176
46-47	27.200000000000003	22.8	23.3125	26.687499999999996
48-49	26.887499999999996	25.0375	22.900000000000002	25.174999999999997
50-51	27.787499999999998	24.625	22.775000000000002	24.8125
52-53	26.5375	24.1125	24.0125	25.337500000000002
54-55	26.5375	24.2625	23.4875	25.7125
56-57	25.974999999999998	25.25	23.9375	24.837500000000002
58-59	27.8875	23.5625	23.0625	25.4875
60-61	27.537499999999998	24.2625	22.9875	25.2125
62-63	26.8375	24.45	24.125	24.587500000000002
64-65	27.437499999999996	24.325	23.1125	25.124999999999996
66-67	26.55	23.7375	23.6625	26.05
68-69	25.424999999999997	25.912499999999998	22.875	25.7875
70-71	27.375	24.087500000000002	23.6125	24.925
72-73	27.765970746343292	24.04050506313289	23.32791598949869	24.86560820102513
74-75	26.428303537942245	24.24053006625828	23.415426928366045	25.91573946743343
76-77	26.974999999999998	23.875	23.4125	25.7375
78-79	27.037499999999998	24.15	23.4875	25.324999999999996
80-81	26.375	23.825	24.7375	25.0625
82-83	27.200000000000003	24.05	22.900000000000002	25.85
84-85	26.437500000000004	23.9	23.2875	26.375
86-87	26.937499999999996	24.25	22.8125	26.0
88-89	29.099999999999998	24.637500000000003	22.45	23.8125
90-91	28.15	24.825	23.1875	23.8375
92-93	28.328541067633456	25.51568946118265	22.665333166645834	23.49043630453807
94-95	29.275000000000002	23.7625	22.6	24.3625
96-97	28.575	24.5	22.1	24.825
98-99	28.675	23.575	23.375	24.375
100-101	30.325000000000003	23.525	22.900000000000002	23.25
>>END_MODULE
>>Per sequence GC content	fail
#GC Content	Count
0	0.0
1	0.0
2	0.5
3	1.0
4	1.5
5	1.0
6	1.5
7	3.0
8	1.5
9	2.0
10	2.5
11	1.0
12	0.5
13	1.0
14	2.0
15	1.5
16	2.0
17	3.0
18	1.5
19	1.0
20	3.5
21	4.0
22	2.0
23	0.5
24	0.5
25	0.5
26	0.0
27	2.0
28	3.5
29	3.0
30	2.5
31	1.5
32	4.0
33	7.5
34	9.0
35	18.0
36	27.5
37	33.5
38	49.5
39	61.5
40	72.0
41	91.5
42	124.0
43	143.0
44	137.0
45	139.5
46	152.0
47	173.5
48	173.0
49	165.5
50	160.0
51	143.5
52	145.0
53	160.0
54	150.0
55	125.0
56	120.5
57	116.0
58	97.5
59	78.0
60	77.0
61	82.5
62	81.0
63	77.5
64	67.5
65	68.5
66	73.0
67	68.0
68	68.5
69	64.0
70	56.0
71	49.0
72	38.5
73	28.5
74	32.0
75	30.5
76	26.0
77	24.0
78	15.0
79	13.5
80	9.0
81	3.0
82	3.5
83	3.0
84	1.0
85	0.5
86	0.0
87	1.0
88	2.0
89	1.5
90	0.5
91	0.0
92	0.0
93	0.5
94	0.5
95	0.5
96	0.5
97	0.0
98	0.0
99	0.0
100	2.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.0
2	0.025
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-11	0.0
12-13	0.0
14-15	0.0
16-17	0.0
18-19	0.0
20-21	0.0
22-23	0.0
24-25	0.0
26-27	0.0
28-29	0.0
30-31	0.0
32-33	0.0
34-35	0.0
36-37	0.0
38-39	0.0
40-41	0.0
42-43	0.0125
44-45	0.0125
46-47	0.0
48-49	0.0
50-51	0.0
52-53	0.0
54-55	0.0
56-57	0.0
58-59	0.0
60-61	0.0
62-63	0.0
64-65	0.0
66-67	0.0
68-69	0.0
70-71	0.0
72-73	0.0125
74-75	0.0125
76-77	0.0
78-79	0.0
80-81	0.0
82-83	0.0
84-85	0.0
86-87	0.0
88-89	0.0
90-91	0.0
92-93	0.0125
94-95	0.0
96-97	0.0
98-99	0.0
100-101	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
101	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	88.775
#Duplication Level	Percentage of deduplicated	Percentage of total
1	89.66488313151225	79.60000000000001
2	8.842579555054913	15.7
3	0.9574767671078569	2.55
4	0.36609405801182765	1.3
5	0.08448324415657561	0.375
6	0.056322162771050406	0.3
7	0.028161081385525203	0.17500000000000002
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC	7	0.17500000000000002	No Hit
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	6	0.15	No Hit
CTACATATGAGCACCAGGATACTTCCTTCAGTACTGTAGTGCCCATCGAG	6	0.15	No Hit
CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA	5	0.125	No Hit
CTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTT	5	0.125	No Hit
CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT	5	0.125	No Hit
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0125	0.0	0.0	0.0	0.0
32-33	0.05	0.0	0.0	0.0	0.0
34-35	0.11249999999999999	0.0	0.0	0.0	0.0
36-37	0.16249999999999998	0.0	0.0	0.0	0.0
38-39	0.175	0.0	0.0	0.0	0.0
40-41	0.1875	0.0	0.0	0.0	0.0
42-43	0.2375	0.0	0.0	0.0	0.0
44-45	0.3	0.0	0.0	0.0	0.0
46-47	0.3125	0.0	0.0	0.0	0.0
48-49	0.3375	0.0	0.0	0.0	0.0
50-51	0.35	0.0	0.0	0.0	0.0
52-53	0.4	0.0	0.0	0.0	0.0
54-55	0.4875	0.0	0.0	0.0	0.0
56-57	0.5625	0.0	0.0	0.0	0.0
58-59	0.7	0.0	0.0	0.0	0.0
60-61	0.8125	0.0	0.0	0.0	0.0
62-63	0.9375	0.0	0.0	0.0	0.0
64-65	1.0625	0.0	0.0	0.0	0.0
66-67	1.1875	0.0	0.0	0.0	0.0
68-69	1.3625	0.0	0.0	0.0	0.0
70-71	1.575	0.0	0.0	0.0	0.0
72-73	1.875	0.0	0.0	0.0	0.0
74-75	2.025	0.0	0.0	0.0	0.0
76-77	2.25	0.0	0.0	0.0	0.0
78-79	2.5	0.0	0.0	0.0	0.0
80-81	2.7874999999999996	0.0	0.0	0.0	0.0
82-83	3.25	0.0	0.0	0.0	0.0
84-85	3.55	0.0	0.0	0.0	0.0
86-87	3.875	0.0	0.0	0.0	0.0
88-89	4.15	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	pass
>>END_MODULE
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694488 spots for ERR3450058.sra
Written 694488 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
Read 694486 spots for ERR3450058.sra
Written 694486 spots for ERR3450058.sra
SRR ids: ['ERR3450058.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_8qkl2c9x
ERR3450058.sra spots: 13889722
blocks: [[1, 694486], [694487, 1388972], [1388973, 2083458], [2083459, 2777944], [2777945, 3472430], [3472431, 4166916], [4166917, 4861402], [4861403, 5555888], [5555889, 6250374], [6250375, 6944860], [6944861, 7639346], [7639347, 8333832], [8333833, 9028318], [9028319, 9722804], [9722805, 10417290], [10417291, 11111776], [11111777, 11806262], [11806263, 12500748], [12500749, 13195234], [13195235, 13889722]]
ERR3450058 file size 3328652
ERR3450058 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450058 ERR3450058_1.fastq ERR3450058_2.fastq
Input file:	ERR3450058_1.fastq
Paired file:	ERR3450058_2.fastq
trimmed:	ERR3450058-trimmed-pair1.fastq, ERR3450058-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Sat Dec  7 14:11:12 2024 >> started

Sat Dec  7 14:11:24 2024 >> done (12.139s)
13889722 read pairs processed; of these:
     110 ( 0.00%) short read pairs filtered out after trimming by size control
   15186 ( 0.11%) empty read pairs filtered out after trimming by size control
13874426 (99.89%) read pairs available; of these:
 1020325 ( 7.35%) trimmed read pairs available after processing
12854101 (92.65%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	      11	  0.00%
 19	      25	  0.00%
 20	      79	  0.00%
 21	     192	  0.00%
 22	     220	  0.00%
 23	     107	  0.00%
 24	      85	  0.00%
 25	     142	  0.00%
 26	     210	  0.00%
 27	     271	  0.00%
 28	     417	  0.00%
 29	     545	  0.00%
 30	     666	  0.00%
 31	     841	  0.01%
 32	     870	  0.01%
 33	     759	  0.01%
 34	     798	  0.01%
 35	     826	  0.01%
 36	     863	  0.01%
 37	     989	  0.01%
 38	    1130	  0.01%
 39	    1296	  0.01%
 40	    1526	  0.01%
 41	    1899	  0.01%
 42	    2039	  0.01%
 43	    2089	  0.02%
 44	    1907	  0.01%
 45	    1893	  0.01%
 46	    2097	  0.02%
 47	    2240	  0.02%
 48	    2465	  0.02%
 49	    2844	  0.02%
 50	    3042	  0.02%
 51	    3471	  0.03%
 52	    3715	  0.03%
 53	    4099	  0.03%
 54	    4296	  0.03%
 55	    4389	  0.03%
 56	    4681	  0.03%
 57	    4896	  0.04%
 58	    5322	  0.04%
 59	    5850	  0.04%
 60	    6285	  0.05%
 61	    7019	  0.05%
 62	    7742	  0.06%
 63	    8172	  0.06%
 64	    8784	  0.06%
 65	    9023	  0.07%
 66	    9471	  0.07%
 67	   10133	  0.07%
 68	   10759	  0.08%
 69	   11039	  0.08%
 70	   11800	  0.09%
 71	   13075	  0.09%
 72	   14287	  0.10%
 73	   14833	  0.11%
 74	   15553	  0.11%
 75	   16483	  0.12%
 76	   17357	  0.13%
 77	   17717	  0.13%
 78	   18334	  0.13%
 79	   19588	  0.14%
 80	   20309	  0.15%
 81	   21189	  0.15%
 82	   22885	  0.16%
 83	   23815	  0.17%
 84	   24827	  0.18%
 85	   26306	  0.19%
 86	   27100	  0.20%
 87	   28020	  0.20%
 88	   29434	  0.21%
 89	   31149	  0.22%
 90	   31732	  0.23%
 91	   34118	  0.25%
 92	   35891	  0.26%
 93	   36724	  0.26%
 94	   38461	  0.28%
 95	   39831	  0.29%
 96	   41067	  0.30%
 97	   42537	  0.31%
 98	   44078	  0.32%
 99	   44652	  0.32%
100	   52644	  0.38%
101	12854101	 92.65%
13874426 reads passed initial QC


criterion=sequence-density
sequence-density=0.35
sequence-density-rank=1
fanout-score=1.97
fanout-score-rank=33
prefix-density=0.35
prefix-fanout=2.0
sequence=GTATTTAGCCTTG


criterion=fanout-score
sequence-density=0.07
sequence-density-rank=17
fanout-score=247.19
fanout-score-rank=1
prefix-density=0.65
prefix-fanout=24.9
sequence=GCCGCCGCCGCC


criterion=sequence-density
sequence-density=0.19
sequence-density-rank=1
fanout-score=1.99
fanout-score-rank=34
prefix-density=0.19
prefix-fanout=2.0
sequence=CAAGTGTTGGATT


criterion=fanout-score
sequence-density=0.08
sequence-density-rank=22
fanout-score=306.25
fanout-score-rank=1
prefix-density=0.84
prefix-fanout=27.7
sequence=GGCGGCGGCGGTGG
ERR3450058 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Dec 07 14:11:54
                             Started mapping on |	Dec 07 14:11:54
                                    Finished on |	Dec 07 14:13:08
       Mapping speed, Million of reads per hour |	674.97

                          Number of input reads |	13874426
                      Average input read length |	199
                                    UNIQUE READS:
                   Uniquely mapped reads number |	10329936
                        Uniquely mapped reads % |	74.45%
                          Average mapped length |	198.92
                       Number of splices: Total |	6239089
            Number of splices: Annotated (sjdb) |	5901258
                       Number of splices: GT/AG |	6159940
                       Number of splices: GC/AG |	67809
                       Number of splices: AT/AC |	3943
               Number of splices: Non-canonical |	7397
                      Mismatch rate per base, % |	0.25%
                         Deletion rate per base |	0.01%
                        Deletion average length |	2.15
                        Insertion rate per base |	0.01%
                       Insertion average length |	1.97
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	557877
             % of reads mapped to multiple loci |	4.02%
        Number of reads mapped to too many loci |	471382
             % of reads mapped to too many loci |	3.40%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	3.32%
                     % of reads unmapped: other |	14.81%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	2986613	2986613	2986613
N_multimapping	557877	557877	557877
N_noFeature	336909	9954249	560419
N_ambiguous	181563	1477	30581
UnstrandedReadsAssigned:9811464 PositiveStrandReadsAssigned:374210 NegativeStrandReadsAssigned:9738936
Dataset is classified negative stranded
MeadianReadLen=101 20thPercentileLength=101 echo kmer=97
ERR3450058 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,972
[index] number of k-mers: 66,720,672
[index] number of equivalence classes: 111,837
[quant] running in paired-end mode
[quant] will process pair 1: ERR3450058-trimmed-pair1.fastq
                             ERR3450058-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 13,874,426 reads, 10,193,285 reads pseudoaligned
[quant] estimated average fragment length: 190.438
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,222 rounds

  52973 ERR3450058.ke.tsv
  35125 ERR3450058.se.tsv
  88098 total
==> ERR3450058.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
PNS24245	936	746.706	0	0
PNS24247	1044	854.562	20.0028	3.47333
PNS24249	1928	1738.56	137.576	11.7422
PNS24246	1044	854.562	20.0028	3.47333
PNS24248	1044	854.562	20.0028	3.47333
PNS24244	1471	1281.56	20.4158	2.36389
PNS24243	293	125.047	0	0
KQK14069	1603	1413.56	2299.72	241.412
KQK14071	474	288.343	108.558	55.8667

==> ERR3450058.se.tsv <==
BRADI_1g14170v3	2482
BRADI_1g53295v3	25
BRADI_1g59795v3	100
BRADI_1g07683v3	0
BRADI_1g00485v3	20
BRADI_1g20270v3	1430
BRADI_1g74790v3	168
BRADI_1g09890v3	31
BRADI_1g77505v3	125
BRADI_1g48960v3	0
ERR3450058 completed mapping pipeline successfully
