Starting /dee2/code/volunteer_pipeline.sh ERR3450059 current disk space = 1543107035136 free memory = 1600385248 ERR3450059 SRAfilesize 99baf3acef94993a1ffa9e9d8d3efb9e ERR3450059.sra ERR3450059.sra file validated ERR3450059 is paired end ERR3450059 is conventional basespace ERR3450059 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450059_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.07825 37.0 37.0 37.0 37.0 37.0 2 36.337 37.0 37.0 37.0 37.0 37.0 3 36.432 37.0 37.0 37.0 37.0 37.0 4 36.5175 37.0 37.0 37.0 37.0 37.0 5 36.5285 37.0 37.0 37.0 37.0 37.0 6 36.52 37.0 37.0 37.0 37.0 37.0 7 36.572 37.0 37.0 37.0 37.0 37.0 8 36.523 37.0 37.0 37.0 37.0 37.0 9 36.539 37.0 37.0 37.0 37.0 37.0 10-11 36.57 37.0 37.0 37.0 37.0 37.0 12-13 36.51025 37.0 37.0 37.0 37.0 37.0 14-15 36.541250000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.52925 37.0 37.0 37.0 37.0 37.0 18-19 36.4645 37.0 37.0 37.0 37.0 37.0 20-21 36.573499999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.46775 37.0 37.0 37.0 37.0 37.0 24-25 36.5445 37.0 37.0 37.0 37.0 37.0 26-27 36.47475 37.0 37.0 37.0 37.0 37.0 28-29 36.47225 37.0 37.0 37.0 37.0 37.0 30-31 36.4435 37.0 37.0 37.0 37.0 37.0 32-33 36.396 37.0 37.0 37.0 37.0 37.0 34-35 36.41475 37.0 37.0 37.0 37.0 37.0 36-37 36.327 37.0 37.0 37.0 37.0 37.0 38-39 36.41225 37.0 37.0 37.0 37.0 37.0 40-41 36.30975 37.0 37.0 37.0 37.0 37.0 42-43 36.38075 37.0 37.0 37.0 37.0 37.0 44-45 36.2825 37.0 37.0 37.0 37.0 37.0 46-47 36.267 37.0 37.0 37.0 37.0 37.0 48-49 36.300250000000005 37.0 37.0 37.0 37.0 37.0 50-51 36.24925 37.0 37.0 37.0 37.0 37.0 52-53 36.32575 37.0 37.0 37.0 37.0 37.0 54-55 36.2485 37.0 37.0 37.0 37.0 37.0 56-57 36.2845 37.0 37.0 37.0 37.0 37.0 58-59 36.21275 37.0 37.0 37.0 37.0 37.0 60-61 36.21425 37.0 37.0 37.0 37.0 37.0 62-63 36.15675 37.0 37.0 37.0 37.0 37.0 64-65 36.19475 37.0 37.0 37.0 37.0 37.0 66-67 36.176249999999996 37.0 37.0 37.0 37.0 37.0 68-69 36.23925 37.0 37.0 37.0 37.0 37.0 70-71 36.17275 37.0 37.0 37.0 37.0 37.0 72-73 36.17425 37.0 37.0 37.0 37.0 37.0 74-75 36.229749999999996 37.0 37.0 37.0 37.0 37.0 76-77 36.195750000000004 37.0 37.0 37.0 37.0 37.0 78-79 36.25075 37.0 37.0 37.0 37.0 37.0 80-81 36.19025 37.0 37.0 37.0 37.0 37.0 82-83 36.204750000000004 37.0 37.0 37.0 37.0 37.0 84-85 36.107 37.0 37.0 37.0 37.0 37.0 86-87 36.164 37.0 37.0 37.0 37.0 37.0 88-89 36.2185 37.0 37.0 37.0 37.0 37.0 90-91 36.101 37.0 37.0 37.0 37.0 37.0 92-93 36.08475 37.0 37.0 37.0 37.0 37.0 94-95 36.15475 37.0 37.0 37.0 37.0 37.0 96-97 36.02775 37.0 37.0 37.0 37.0 37.0 98-99 36.0435 37.0 37.0 37.0 37.0 37.0 100-101 36.084 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 4.0 25 8.0 26 9.0 27 13.0 28 27.0 29 27.0 30 38.0 31 44.0 32 62.0 33 64.0 34 105.0 35 155.0 36 1655.0 37 1786.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.794420708720786 9.675797939180699 10.153304850464941 38.376476501633576 2 23.599999999999998 13.15 29.349999999999998 33.900000000000006 3 21.075 17.45 25.1 36.375 4 28.249999999999996 23.849999999999998 18.175 29.725 5 27.150000000000002 27.775 22.275 22.8 6 24.4 31.2 22.075 22.325 7 21.55 22.2 36.85 19.400000000000002 8 19.525000000000002 20.925 30.925000000000004 28.625 9 23.974999999999998 20.474999999999998 30.175 25.374999999999996 10-11 23.400000000000002 29.2 21.512500000000003 25.887500000000003 12-13 24.7375 22.6125 25.275 27.375 14-15 24.224999999999998 24.1625 26.0 25.6125 16-17 24.25 24.337500000000002 24.7875 26.625 18-19 24.4 25.0375 25.412499999999998 25.15 20-21 24.675 24.1125 24.762500000000003 26.450000000000003 22-23 25.174999999999997 24.3625 24.1125 26.35 24-25 25.0375 24.2 23.75 27.0125 26-27 24.3 23.2625 24.6125 27.825 28-29 24.825 24.9375 24.175 26.0625 30-31 25.0375 24.0625 24.0 26.900000000000002 32-33 23.7625 23.599999999999998 24.775 27.8625 34-35 24.3875 24.224999999999998 24.4 26.987499999999997 36-37 25.974999999999998 23.962500000000002 23.7875 26.275 38-39 23.9125 24.5 24.1875 27.400000000000002 40-41 24.462500000000002 24.5125 23.75 27.275 42-43 24.6875 24.3875 24.5625 26.3625 44-45 24.2875 23.974999999999998 24.675 27.0625 46-47 26.35 23.95 23.775 25.924999999999997 48-49 24.075 24.875 23.5 27.55 50-51 24.625 22.675 25.087500000000002 27.6125 52-53 24.6625 23.9875 24.099999999999998 27.250000000000004 54-55 24.9875 23.5875 23.9375 27.487499999999997 56-57 24.875 23.549999999999997 24.762500000000003 26.8125 58-59 24.925 24.224999999999998 23.65 27.200000000000003 60-61 25.887500000000003 23.5625 23.799999999999997 26.75 62-63 24.55 24.325 23.599999999999998 27.525 64-65 24.9 23.9 24.2625 26.937499999999996 66-67 24.975 23.6125 24.3125 27.1 68-69 25.0125 23.4375 24.4125 27.1375 70-71 25.525 23.5875 23.4375 27.450000000000003 72-73 25.4625 24.05 23.8625 26.625 74-75 25.25 24.2375 24.375 26.137500000000003 76-77 27.1125 24.1625 23.3125 25.412499999999998 78-79 25.3 23.6875 23.525 27.487499999999997 80-81 24.5 24.1625 24.025 27.3125 82-83 25.95 24.212500000000002 23.05 26.787499999999998 84-85 25.5375 23.599999999999998 22.8125 28.050000000000004 86-87 24.45 23.875 24.55 27.125 88-89 25.474999999999998 23.599999999999998 24.0375 26.887499999999996 90-91 25.924999999999997 24.5 22.475 27.1 92-93 25.575 23.8375 24.05 26.5375 94-95 25.887500000000003 24.099999999999998 23.2375 26.775 96-97 25.85 24.025 22.3 27.825 98-99 25.2875 23.7875 23.625 27.3 100-101 25.8 24.4 22.2625 27.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.5 3 0.5 4 2.0 5 2.5 6 1.0 7 2.0 8 2.0 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 2.5 25 4.0 26 2.5 27 2.5 28 3.0 29 2.0 30 2.5 31 6.0 32 7.5 33 8.5 34 17.0 35 22.5 36 27.5 37 32.0 38 37.5 39 51.5 40 70.5 41 100.5 42 123.5 43 126.5 44 140.5 45 159.0 46 164.0 47 168.0 48 170.5 49 166.0 50 159.0 51 157.5 52 165.5 53 165.0 54 148.5 55 133.0 56 130.0 57 124.0 58 111.0 59 102.0 60 90.0 61 83.0 62 78.0 63 69.5 64 61.5 65 60.5 66 61.0 67 66.0 68 59.5 69 41.5 70 46.5 71 46.0 72 31.5 73 29.5 74 28.5 75 21.0 76 18.0 77 17.0 78 14.0 79 10.0 80 7.0 81 5.5 82 3.5 83 3.0 84 1.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.58800666296501 82.475 2 6.829539144919488 12.3 3 0.971682398667407 2.625 4 0.44419766796224325 1.6 5 0.055524708495280406 0.25 6 0.055524708495280406 0.3 7 0.0 0.0 8 0.027762354247640203 0.2 9 0.0 0.0 >10 0.027762354247640203 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCAT 8 0.2 No Hit GGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGC 6 0.15 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit CTGTTATTGCCTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAG 5 0.125 No Hit CCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.07500000000000001 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.1875 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.30000000000000004 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.3625 0.0 0.0 0.0 0.0 62-63 0.5 0.0 0.0 0.0 0.0 64-65 0.55 0.0 0.0 0.0 0.0 66-67 0.6125 0.0 0.0 0.0 0.0 68-69 0.75 0.0 0.0 0.0 0.0 70-71 0.875 0.0 0.0 0.0 0.0 72-73 1.2000000000000002 0.0 0.0 0.0 0.0 74-75 1.5125 0.0 0.0 0.0 0.0 76-77 1.825 0.0 0.0 0.0 0.0 78-79 2.125 0.0 0.0 0.0 0.0 80-81 2.3625 0.0 0.0 0.0 0.0 82-83 2.6875 0.0 0.0 0.0 0.0 84-85 3.2125 0.0 0.0 0.0 0.0 86-87 3.85 0.0 0.0 0.0 0.0 88-89 4.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450059 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450059_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0275 37.0 37.0 37.0 37.0 37.0 2 35.897 37.0 37.0 37.0 37.0 37.0 3 35.9945 37.0 37.0 37.0 37.0 37.0 4 36.0815 37.0 37.0 37.0 37.0 37.0 5 36.2515 37.0 37.0 37.0 37.0 37.0 6 36.2625 37.0 37.0 37.0 37.0 37.0 7 36.22 37.0 37.0 37.0 37.0 37.0 8 36.1275 37.0 37.0 37.0 37.0 37.0 9 36.1785 37.0 37.0 37.0 37.0 37.0 10-11 36.187250000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.154250000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.17725 37.0 37.0 37.0 37.0 37.0 16-17 36.1335 37.0 37.0 37.0 37.0 37.0 18-19 36.182500000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.1325 37.0 37.0 37.0 37.0 37.0 22-23 36.177499999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.13625 37.0 37.0 37.0 37.0 37.0 26-27 36.111000000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.1275 37.0 37.0 37.0 37.0 37.0 30-31 36.1285 37.0 37.0 37.0 37.0 37.0 32-33 36.079 37.0 37.0 37.0 37.0 37.0 34-35 36.00625 37.0 37.0 37.0 37.0 37.0 36-37 36.015249999999995 37.0 37.0 37.0 37.0 37.0 38-39 35.982749999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.9025 37.0 37.0 37.0 37.0 37.0 42-43 36.015249999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.954750000000004 37.0 37.0 37.0 37.0 37.0 46-47 35.9435 37.0 37.0 37.0 37.0 37.0 48-49 35.95525 37.0 37.0 37.0 37.0 37.0 50-51 35.921 37.0 37.0 37.0 37.0 37.0 52-53 35.955749999999995 37.0 37.0 37.0 37.0 37.0 54-55 35.93725 37.0 37.0 37.0 37.0 37.0 56-57 35.957750000000004 37.0 37.0 37.0 37.0 37.0 58-59 35.936499999999995 37.0 37.0 37.0 37.0 37.0 60-61 35.75275 37.0 37.0 37.0 37.0 37.0 62-63 35.812749999999994 37.0 37.0 37.0 37.0 37.0 64-65 35.880250000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.82575 37.0 37.0 37.0 37.0 37.0 68-69 35.74825 37.0 37.0 37.0 37.0 37.0 70-71 35.831 37.0 37.0 37.0 37.0 37.0 72-73 35.72175 37.0 37.0 37.0 37.0 37.0 74-75 35.79875 37.0 37.0 37.0 37.0 37.0 76-77 35.8515 37.0 37.0 37.0 37.0 37.0 78-79 35.7935 37.0 37.0 37.0 37.0 37.0 80-81 35.71925 37.0 37.0 37.0 37.0 37.0 82-83 35.699 37.0 37.0 37.0 37.0 37.0 84-85 35.776250000000005 37.0 37.0 37.0 37.0 37.0 86-87 35.90225 37.0 37.0 37.0 37.0 37.0 88-89 35.82625 37.0 37.0 37.0 37.0 37.0 90-91 35.853 37.0 37.0 37.0 37.0 37.0 92-93 35.85825 37.0 37.0 37.0 37.0 37.0 94-95 35.9 37.0 37.0 37.0 37.0 37.0 96-97 35.77175 37.0 37.0 37.0 37.0 37.0 98-99 35.84175 37.0 37.0 37.0 37.0 37.0 100-101 35.714 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 4.0 17 2.0 18 3.0 19 7.0 20 9.0 21 6.0 22 11.0 23 13.0 24 8.0 25 13.0 26 13.0 27 21.0 28 24.0 29 37.0 30 33.0 31 44.0 32 48.0 33 54.0 34 92.0 35 236.0 36 2118.0 37 1199.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.025 17.45 11.525 31.0 2 26.35 22.925 26.900000000000002 23.825 3 25.474999999999998 24.125 27.725 22.675 4 30.475 25.2 18.6 25.724999999999998 5 30.625000000000004 28.15 19.650000000000002 21.575 6 23.849999999999998 33.050000000000004 20.25 22.85 7 25.8 19.025 31.175000000000004 24.0 8 26.1 20.65 24.099999999999998 29.15 9 26.575 21.0 25.224999999999998 27.200000000000003 10-11 27.750000000000004 27.212500000000002 19.3625 25.674999999999997 12-13 29.775000000000002 21.5 22.1375 26.5875 14-15 27.1125 24.9375 22.900000000000002 25.05 16-17 27.3875 24.8 22.325 25.4875 18-19 27.35 25.687500000000004 22.5875 24.375 20-21 27.2625 25.3125 22.75 24.675 22-23 27.0625 24.7 22.662499999999998 25.575 24-25 27.825 24.175 22.8375 25.162499999999998 26-27 26.487500000000004 25.1875 22.5125 25.8125 28-29 27.400000000000002 24.637500000000003 22.4625 25.5 30-31 26.875 25.162499999999998 22.55 25.412499999999998 32-33 28.025 23.8625 22.8625 25.25 34-35 27.900000000000002 23.825 23.3625 24.9125 36-37 26.187500000000004 24.575 22.15 27.0875 38-39 27.3875 24.65 22.25 25.7125 40-41 27.250000000000004 24.1875 23.0375 25.525 42-43 26.950000000000003 24.275 22.525000000000002 26.25 44-45 26.137500000000003 25.324999999999996 22.6375 25.900000000000002 46-47 27.8375 23.45 23.2875 25.424999999999997 48-49 27.500000000000004 23.625 22.4625 26.4125 50-51 27.400000000000002 23.6125 23.25 25.7375 52-53 26.05 24.462500000000002 23.5125 25.974999999999998 54-55 26.924999999999997 23.5375 23.6125 25.924999999999997 56-57 26.8625 24.925 23.1375 25.074999999999996 58-59 26.9625 24.15 23.225 25.662499999999998 60-61 27.537499999999998 24.1875 23.1125 25.162499999999998 62-63 27.5875 24.087500000000002 23.65 24.675 64-65 27.0875 23.5875 23.0125 26.3125 66-67 26.950000000000003 24.587500000000002 22.6125 25.85 68-69 27.0 24.85 22.8125 25.337500000000002 70-71 28.325 23.525 22.650000000000002 25.5 72-73 26.7125 24.8 22.975 25.5125 74-75 26.9625 24.25 23.1625 25.624999999999996 76-77 27.737499999999997 24.1125 23.3375 24.8125 78-79 28.237499999999997 25.162499999999998 22.1375 24.462500000000002 80-81 27.224999999999998 24.837500000000002 23.4375 24.5 82-83 27.212500000000002 23.599999999999998 23.45 25.7375 84-85 27.8625 25.087500000000002 22.525000000000002 24.525 86-87 26.9125 25.1 22.45 25.5375 88-89 27.775 24.625 21.712500000000002 25.887500000000003 90-91 28.325 23.8625 22.287499999999998 25.525 92-93 27.212500000000002 26.637499999999996 22.675 23.474999999999998 94-95 27.925 24.6875 22.2 25.1875 96-97 29.2 24.875 21.25 24.675 98-99 28.125 25.25 22.775000000000002 23.849999999999998 100-101 28.15 24.55 23.125 24.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.5 6 0.5 7 1.0 8 2.0 9 3.5 10 2.5 11 1.5 12 2.0 13 0.5 14 0.5 15 1.0 16 1.5 17 1.5 18 2.0 19 2.0 20 1.5 21 2.5 22 1.5 23 0.5 24 1.0 25 2.5 26 4.0 27 3.5 28 2.0 29 2.0 30 4.5 31 5.0 32 4.5 33 8.5 34 10.0 35 11.5 36 21.0 37 28.5 38 39.0 39 58.0 40 75.0 41 90.5 42 119.0 43 135.5 44 130.0 45 145.5 46 151.0 47 154.5 48 158.0 49 160.5 50 177.5 51 159.0 52 147.5 53 152.0 54 142.5 55 137.0 56 128.0 57 119.0 58 103.5 59 92.5 60 93.5 61 90.0 62 91.0 63 85.0 64 78.0 65 75.5 66 67.5 67 61.0 68 54.5 69 51.5 70 58.0 71 60.5 72 49.5 73 36.0 74 29.0 75 22.5 76 18.0 77 15.5 78 13.5 79 9.0 80 5.0 81 5.0 82 2.5 83 1.5 84 1.0 85 0.0 86 1.0 87 1.5 88 1.5 89 2.0 90 1.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.98022521285361 83.72500000000001 2 6.783850590497116 12.35 3 0.8788794287283713 2.4 4 0.21971985718209283 0.8 5 0.08239494644328481 0.375 6 0.027464982147761604 0.15 7 0.0 0.0 8 0.027464982147761604 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 8 0.2 No Hit AGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGC 6 0.15 No Hit GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 5 0.125 No Hit GTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.07500000000000001 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.1875 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.30000000000000004 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.3625 0.0 0.0 0.0 0.0 62-63 0.5 0.0 0.0 0.0 0.0 64-65 0.55 0.0 0.0 0.0 0.0 66-67 0.6125 0.0 0.0 0.0 0.0 68-69 0.75 0.0 0.0 0.0 0.0 70-71 0.875 0.0 0.0 0.0 0.0 72-73 1.2000000000000002 0.0 0.0 0.0 0.0 74-75 1.5 0.0 0.0 0.0 0.0 76-77 1.8 0.0 0.0 0.0 0.0 78-79 2.075 0.0 0.0 0.0 0.0 80-81 2.3125 0.0 0.0 0.0 0.0 82-83 2.6624999999999996 0.0 0.0 0.0 0.0 84-85 3.2 0.0 0.0 0.0 0.0 86-87 3.8625 0.0 0.0 0.0 0.0 88-89 4.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932650 spots for ERR3450059.sra Written 1932650 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra Read 1932635 spots for ERR3450059.sra Written 1932635 spots for ERR3450059.sra SRR ids: ['ERR3450059.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jfdv6pix ERR3450059.sra spots: 38652715 blocks: [[1, 1932635], [1932636, 3865270], [3865271, 5797905], [5797906, 7730540], [7730541, 9663175], [9663176, 11595810], [11595811, 13528445], [13528446, 15461080], [15461081, 17393715], [17393716, 19326350], [19326351, 21258985], [21258986, 23191620], [23191621, 25124255], [25124256, 27056890], [27056891, 28989525], [28989526, 30922160], [30922161, 32854795], [32854796, 34787430], [34787431, 36720065], [36720066, 38652715]] ERR3450059 file size 9301757 ERR3450059 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450059 ERR3450059_1.fastq ERR3450059_2.fastq Input file: ERR3450059_1.fastq Paired file: ERR3450059_2.fastq trimmed: ERR3450059-trimmed-pair1.fastq, ERR3450059-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:12:44 2024 >> started Sat Dec 7 14:13:18 2024 >> done (33.933s) 38652715 read pairs processed; of these: 249 ( 0.00%) short read pairs filtered out after trimming by size control 27635 ( 0.07%) empty read pairs filtered out after trimming by size control 38624831 (99.93%) read pairs available; of these: 3392024 ( 8.78%) trimmed read pairs available after processing 35232807 (91.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 37 0.00% 19 63 0.00% 20 210 0.00% 21 523 0.00% 22 597 0.00% 23 302 0.00% 24 298 0.00% 25 409 0.00% 26 614 0.00% 27 889 0.00% 28 1216 0.00% 29 1761 0.00% 30 2096 0.01% 31 2587 0.01% 32 2626 0.01% 33 2472 0.01% 34 2599 0.01% 35 2602 0.01% 36 2967 0.01% 37 3370 0.01% 38 3793 0.01% 39 4552 0.01% 40 5286 0.01% 41 6236 0.02% 42 7168 0.02% 43 7300 0.02% 44 6763 0.02% 45 6570 0.02% 46 7136 0.02% 47 7999 0.02% 48 8767 0.02% 49 9596 0.02% 50 11119 0.03% 51 12293 0.03% 52 13584 0.04% 53 14026 0.04% 54 15295 0.04% 55 15641 0.04% 56 16664 0.04% 57 17625 0.05% 58 18559 0.05% 59 20634 0.05% 60 21998 0.06% 61 24565 0.06% 62 26937 0.07% 63 29080 0.08% 64 30224 0.08% 65 31549 0.08% 66 32920 0.09% 67 35466 0.09% 68 37235 0.10% 69 38537 0.10% 70 41092 0.11% 71 44375 0.11% 72 47963 0.12% 73 51092 0.13% 74 53382 0.14% 75 55648 0.14% 76 58295 0.15% 77 60156 0.16% 78 62843 0.16% 79 67261 0.17% 80 69391 0.18% 81 72466 0.19% 82 77499 0.20% 83 80572 0.21% 84 84280 0.22% 85 88174 0.23% 86 91166 0.24% 87 94731 0.25% 88 98590 0.26% 89 101897 0.26% 90 105670 0.27% 91 111508 0.29% 92 116526 0.30% 93 119821 0.31% 94 124566 0.32% 95 127886 0.33% 96 130186 0.34% 97 136664 0.35% 98 138351 0.36% 99 141471 0.37% 100 165147 0.43% 101 35232807 91.22% 38624831 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.30 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=162.82 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=21.1 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=2.3 sequence=AGCCAGAGGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=208.36 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=23.1 sequence=CGGCGGCGGCGC ERR3450059 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:14:02 Started mapping on | Dec 07 14:14:02 Finished on | Dec 07 14:17:26 Mapping speed, Million of reads per hour | 681.61 Number of input reads | 38624831 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 29158032 Uniquely mapped reads % | 75.49% Average mapped length | 198.43 Number of splices: Total | 18118329 Number of splices: Annotated (sjdb) | 17164308 Number of splices: GT/AG | 17884263 Number of splices: GC/AG | 201857 Number of splices: AT/AC | 11336 Number of splices: Non-canonical | 20873 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1995094 % of reads mapped to multiple loci | 5.17% Number of reads mapped to too many loci | 1174502 % of reads mapped to too many loci | 3.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 12.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7471705 7471705 7471705 N_multimapping 1995094 1995094 1995094 N_noFeature 978539 28101353 1601610 N_ambiguous 530159 4308 101785 UnstrandedReadsAssigned:27649334 PositiveStrandReadsAssigned:1052371 NegativeStrandReadsAssigned:27454637 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450059 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450059-trimmed-pair1.fastq ERR3450059-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,624,831 reads, 29,070,045 reads pseudoaligned [quant] estimated average fragment length: 187.662 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 ERR3450059.ke.tsv 35125 ERR3450059.se.tsv 88098 total ==> ERR3450059.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.541 0 0 PNS24247 1044 857.338 52.399 3.11968 PNS24249 1928 1741.34 354.442 10.3897 PNS24246 1044 857.338 52.399 3.11968 PNS24248 1044 857.338 52.399 3.11968 PNS24244 1471 1284.34 37.3614 1.48485 PNS24243 293 127.615 0 0 KQK14069 1603 1416.34 3640.86 131.213 KQK14071 474 291.252 146.261 25.6329 ==> ERR3450059.se.tsv <== BRADI_1g14170v3 3834 BRADI_1g53295v3 49 BRADI_1g59795v3 314 BRADI_1g07683v3 0 BRADI_1g00485v3 87 BRADI_1g20270v3 4330 BRADI_1g74790v3 273 BRADI_1g09890v3 46 BRADI_1g77505v3 369 BRADI_1g48960v3 1 ERR3450059 completed mapping pipeline successfully