Starting /dee2/code/volunteer_pipeline.sh ERR3450064 current disk space = 1543036436480 free memory = 1599484956 ERR3450064 SRAfilesize 01ab30de3856e1c331883fc73a331743 ERR3450064.sra ERR3450064.sra file validated ERR3450064 is paired end ERR3450064 is conventional basespace ERR3450064 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450064_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15425 37.0 37.0 37.0 37.0 37.0 2 36.453 37.0 37.0 37.0 37.0 37.0 3 36.404 37.0 37.0 37.0 37.0 37.0 4 36.418 37.0 37.0 37.0 37.0 37.0 5 36.548 37.0 37.0 37.0 37.0 37.0 6 36.4955 37.0 37.0 37.0 37.0 37.0 7 36.4525 37.0 37.0 37.0 37.0 37.0 8 36.49 37.0 37.0 37.0 37.0 37.0 9 36.474 37.0 37.0 37.0 37.0 37.0 10-11 36.52175 37.0 37.0 37.0 37.0 37.0 12-13 36.52125 37.0 37.0 37.0 37.0 37.0 14-15 36.5065 37.0 37.0 37.0 37.0 37.0 16-17 36.514250000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.527 37.0 37.0 37.0 37.0 37.0 20-21 36.542249999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.48125 37.0 37.0 37.0 37.0 37.0 24-25 36.45725 37.0 37.0 37.0 37.0 37.0 26-27 36.3845 37.0 37.0 37.0 37.0 37.0 28-29 36.3925 37.0 37.0 37.0 37.0 37.0 30-31 36.3155 37.0 37.0 37.0 37.0 37.0 32-33 36.2825 37.0 37.0 37.0 37.0 37.0 34-35 36.26475 37.0 37.0 37.0 37.0 37.0 36-37 36.33325 37.0 37.0 37.0 37.0 37.0 38-39 36.314 37.0 37.0 37.0 37.0 37.0 40-41 36.283 37.0 37.0 37.0 37.0 37.0 42-43 36.2205 37.0 37.0 37.0 37.0 37.0 44-45 36.11625 37.0 37.0 37.0 37.0 37.0 46-47 36.119749999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.134 37.0 37.0 37.0 37.0 37.0 50-51 36.168499999999995 37.0 37.0 37.0 37.0 37.0 52-53 36.20575 37.0 37.0 37.0 37.0 37.0 54-55 36.113749999999996 37.0 37.0 37.0 37.0 37.0 56-57 36.1245 37.0 37.0 37.0 37.0 37.0 58-59 36.0445 37.0 37.0 37.0 37.0 37.0 60-61 36.09725 37.0 37.0 37.0 37.0 37.0 62-63 35.987 37.0 37.0 37.0 37.0 37.0 64-65 35.95575 37.0 37.0 37.0 37.0 37.0 66-67 36.048500000000004 37.0 37.0 37.0 37.0 37.0 68-69 35.955 37.0 37.0 37.0 37.0 37.0 70-71 35.835499999999996 37.0 37.0 37.0 37.0 37.0 72-73 35.7405 37.0 37.0 37.0 37.0 37.0 74-75 36.07475 37.0 37.0 37.0 37.0 37.0 76-77 36.08725 37.0 37.0 37.0 37.0 37.0 78-79 36.13 37.0 37.0 37.0 37.0 37.0 80-81 36.0385 37.0 37.0 37.0 37.0 37.0 82-83 36.10925 37.0 37.0 37.0 37.0 37.0 84-85 36.103 37.0 37.0 37.0 37.0 37.0 86-87 36.0995 37.0 37.0 37.0 37.0 37.0 88-89 35.99625 37.0 37.0 37.0 37.0 37.0 90-91 35.976 37.0 37.0 37.0 37.0 37.0 92-93 35.925 37.0 37.0 37.0 37.0 37.0 94-95 36.010999999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.936 37.0 37.0 37.0 37.0 37.0 98-99 35.9095 37.0 37.0 37.0 37.0 37.0 100-101 35.88175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 5.0 24 5.0 25 5.0 26 15.0 27 17.0 28 28.0 29 29.0 30 37.0 31 53.0 32 61.0 33 75.0 34 122.0 35 230.0 36 1774.0 37 1541.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.76784372652141 9.867267718507387 10.643626346105686 40.72126220886552 2 21.625 13.0 29.15 36.225 3 23.35 16.35 25.374999999999996 34.925 4 27.975 21.9 18.15 31.974999999999998 5 28.1 26.625 21.525 23.75 6 22.85 30.95 24.675 21.525 7 21.15 22.725 35.6 20.525 8 21.625 21.2 29.375 27.800000000000004 9 21.45 20.925 33.4 24.224999999999998 10-11 23.9375 27.950000000000003 23.1375 24.975 12-13 23.9375 23.3125 25.1875 27.5625 14-15 24.2875 23.1375 26.85 25.724999999999998 16-17 24.349999999999998 23.5625 26.237500000000004 25.85 18-19 24.675 24.0 24.725 26.6 20-21 24.45 24.7875 25.0625 25.7 22-23 24.0375 23.875 25.124999999999996 26.9625 24-25 25.25 23.7125 24.087500000000002 26.950000000000003 26-27 24.45 23.7625 24.525 27.2625 28-29 25.387500000000003 23.200000000000003 24.7375 26.674999999999997 30-31 24.875 23.6625 24.375 27.0875 32-33 25.0375 23.925 24.2375 26.8 34-35 25.0125 23.625 24.125 27.237499999999997 36-37 24.462500000000002 23.7375 24.425 27.375 38-39 24.712500000000002 24.375 24.837500000000002 26.075 40-41 24.2625 25.275 23.8875 26.575 42-43 25.35 23.4875 24.087500000000002 27.075 44-45 24.8 23.549999999999997 25.0125 26.637499999999996 46-47 25.124999999999996 23.2375 23.8625 27.775 48-49 24.3125 24.05 24.45 27.187499999999996 50-51 23.4625 24.3 24.9 27.3375 52-53 24.775 23.474999999999998 24.15 27.6 54-55 24.875 24.2875 24.349999999999998 26.487500000000004 56-57 24.712500000000002 23.8125 23.8125 27.6625 58-59 23.974999999999998 24.837500000000002 24.8 26.387500000000003 60-61 25.0625 22.237499999999997 25.15 27.55 62-63 25.0625 23.75 23.724999999999998 27.462500000000002 64-65 25.162499999999998 23.799999999999997 24.15 26.887499999999996 66-67 24.575 24.5375 23.325000000000003 27.5625 68-69 25.424999999999997 24.1375 23.25 27.187499999999996 70-71 25.162499999999998 24.0 23.549999999999997 27.287499999999998 72-73 25.575 24.4375 23.0 26.987499999999997 74-75 25.4 23.3875 23.6125 27.6 76-77 26.8375 23.7625 22.9375 26.4625 78-79 27.35 23.375 22.7625 26.5125 80-81 26.337500000000002 22.8375 23.7875 27.037499999999998 82-83 26.0125 24.087500000000002 24.2875 25.6125 84-85 25.9875 24.1125 23.125 26.775 86-87 25.374999999999996 24.0 23.425 27.200000000000003 88-89 25.662499999999998 23.8625 23.35 27.125 90-91 25.2125 24.6125 24.1125 26.0625 92-93 26.337500000000002 24.175 23.0375 26.450000000000003 94-95 24.675 24.625 23.2875 27.4125 96-97 25.900000000000002 23.2375 23.3 27.5625 98-99 24.6 24.325 24.3625 26.7125 100-101 25.775 25.5625 22.0 26.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.5 2 1.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 1.5 9 2.0 10 1.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 1.0 24 0.0 25 0.5 26 2.5 27 2.5 28 2.0 29 3.0 30 3.0 31 6.0 32 8.0 33 9.0 34 14.5 35 22.5 36 32.0 37 34.5 38 44.0 39 57.5 40 70.0 41 97.0 42 123.5 43 129.5 44 131.5 45 163.0 46 189.0 47 195.5 48 186.5 49 176.0 50 180.0 51 162.5 52 151.0 53 143.5 54 131.5 55 119.5 56 118.0 57 112.0 58 90.0 59 79.0 60 80.5 61 80.5 62 70.0 63 74.5 64 68.0 65 57.0 66 62.5 67 64.5 68 62.5 69 52.5 70 49.0 71 46.5 72 40.5 73 36.5 74 28.0 75 25.5 76 22.5 77 16.0 78 12.5 79 8.5 80 4.0 81 3.5 82 4.0 83 5.0 84 4.0 85 1.5 86 0.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.02514668901928 80.55 2 8.717518860016764 15.6 3 0.9499860296172116 2.55 4 0.2514668901927913 0.8999999999999999 5 0.02794076557697681 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02794076557697681 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTTT 5 0.125 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.16249999999999998 0.0 0.0 0.0 0.0 46-47 0.21250000000000002 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.3125 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.4125 0.0 0.0 0.0 0.0 56-57 0.4875 0.0 0.0 0.0 0.0 58-59 0.575 0.0 0.0 0.0 0.0 60-61 0.675 0.0 0.0 0.0 0.0 62-63 0.9375 0.0 0.0 0.0 0.0 64-65 1.1375000000000002 0.0 0.0 0.0 0.0 66-67 1.375 0.0 0.0 0.0 0.0 68-69 1.5375 0.0 0.0 0.0 0.0 70-71 1.7625 0.0 0.0 0.0 0.0 72-73 1.9375 0.0 0.0 0.0 0.0 74-75 2.1624999999999996 0.0 0.0 0.0 0.0 76-77 2.55 0.0 0.0 0.0 0.0 78-79 2.8499999999999996 0.0 0.0 0.0 0.0 80-81 3.0625 0.0 0.0 0.0 0.0 82-83 3.4625 0.0 0.0 0.0 0.0 84-85 3.85 0.0 0.0 0.0 0.0 86-87 4.1875 0.0 0.0 0.0 0.0 88-89 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450064 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450064_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.988 37.0 37.0 37.0 37.0 37.0 2 35.7875 37.0 37.0 37.0 37.0 37.0 3 35.902 37.0 37.0 37.0 37.0 37.0 4 35.9635 37.0 37.0 37.0 37.0 37.0 5 36.157 37.0 37.0 37.0 37.0 37.0 6 36.229 37.0 37.0 37.0 37.0 37.0 7 36.1 37.0 37.0 37.0 37.0 37.0 8 36.0105 37.0 37.0 37.0 37.0 37.0 9 36.121 37.0 37.0 37.0 37.0 37.0 10-11 35.9345 37.0 37.0 37.0 37.0 37.0 12-13 35.9485 37.0 37.0 37.0 37.0 37.0 14-15 35.93025 37.0 37.0 37.0 37.0 37.0 16-17 36.01375 37.0 37.0 37.0 37.0 37.0 18-19 36.02275 37.0 37.0 37.0 37.0 37.0 20-21 35.83025 37.0 37.0 37.0 37.0 37.0 22-23 35.92725 37.0 37.0 37.0 37.0 37.0 24-25 35.834625 37.0 37.0 37.0 37.0 37.0 26-27 35.721500000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.69075 37.0 37.0 37.0 37.0 37.0 30-31 35.6525 37.0 37.0 37.0 37.0 37.0 32-33 35.65925 37.0 37.0 37.0 37.0 37.0 34-35 35.557 37.0 37.0 37.0 37.0 37.0 36-37 35.46875 37.0 37.0 37.0 37.0 37.0 38-39 35.58525 37.0 37.0 37.0 37.0 37.0 40-41 35.540000000000006 37.0 37.0 37.0 37.0 37.0 42-43 35.48075 37.0 37.0 37.0 37.0 37.0 44-45 35.48825 37.0 37.0 37.0 37.0 37.0 46-47 35.614875 37.0 37.0 37.0 37.0 37.0 48-49 35.49025 37.0 37.0 37.0 37.0 37.0 50-51 35.60075 37.0 37.0 37.0 37.0 37.0 52-53 35.66975 37.0 37.0 37.0 37.0 37.0 54-55 35.55675 37.0 37.0 37.0 37.0 37.0 56-57 35.580749999999995 37.0 37.0 37.0 37.0 37.0 58-59 35.6665 37.0 37.0 37.0 37.0 37.0 60-61 35.59925 37.0 37.0 37.0 37.0 37.0 62-63 35.731750000000005 37.0 37.0 37.0 37.0 37.0 64-65 35.64775 37.0 37.0 37.0 37.0 37.0 66-67 35.546 37.0 37.0 37.0 37.0 37.0 68-69 35.670500000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.493 37.0 37.0 37.0 37.0 37.0 72-73 35.43375 37.0 37.0 37.0 37.0 37.0 74-75 35.421 37.0 37.0 37.0 37.0 37.0 76-77 35.473 37.0 37.0 37.0 37.0 37.0 78-79 35.42775 37.0 37.0 37.0 37.0 37.0 80-81 35.37975 37.0 37.0 37.0 37.0 37.0 82-83 35.3395 37.0 37.0 37.0 37.0 37.0 84-85 35.5265 37.0 37.0 37.0 37.0 37.0 86-87 35.470749999999995 37.0 37.0 37.0 37.0 37.0 88-89 35.516 37.0 37.0 37.0 37.0 37.0 90-91 35.54900000000001 37.0 37.0 37.0 37.0 37.0 92-93 35.4835 37.0 37.0 37.0 37.0 37.0 94-95 35.46475 37.0 37.0 37.0 37.0 37.0 96-97 35.4345 37.0 37.0 37.0 37.0 37.0 98-99 35.488 37.0 37.0 37.0 37.0 37.0 100-101 35.485875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 7.0 17 1.0 18 4.0 19 5.0 20 9.0 21 10.0 22 11.0 23 14.0 24 11.0 25 15.0 26 13.0 27 22.0 28 25.0 29 46.0 30 50.0 31 55.0 32 58.0 33 93.0 34 151.0 35 447.0 36 2359.0 37 592.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.975 16.025 13.225000000000001 29.775000000000002 2 26.663331665832917 22.461230615307652 26.463231615807903 24.412206103051524 3 24.75 25.1 25.374999999999996 24.775 4 31.15 26.075 17.125 25.650000000000002 5 28.975 29.049999999999997 18.725 23.25 6 24.012006003001503 31.540770385192594 20.535267633816908 23.911955977988995 7 26.275 18.55 30.4 24.775 8 25.7 21.45 22.275 30.575000000000003 9 26.025 23.875 23.65 26.450000000000003 10-11 28.7 26.7625 18.387500000000003 26.150000000000002 12-13 29.2375 22.2125 21.775 26.775 14-15 27.575 25.087500000000002 22.225 25.112499999999997 16-17 28.537499999999998 23.3 21.912499999999998 26.25 18-19 27.656914228557138 24.943735933983497 21.905476369092273 25.49387346836709 20-21 27.775 24.2 22.125 25.900000000000002 22-23 28.14453613403351 24.50612653163291 21.73043260815204 25.618904726181547 24-25 28.178522315289413 23.902987873484186 23.040380047505938 24.878109763720467 26-27 27.224999999999998 25.4875 22.025 25.2625 28-29 28.787499999999998 24.0 21.8625 25.35 30-31 27.5875 24.7 22.625 25.087500000000002 32-33 28.15 23.825 23.3125 24.712500000000002 34-35 27.712500000000002 24.637500000000003 22.3 25.35 36-37 27.825 23.7 22.375 26.1 38-39 27.250000000000004 24.675 22.9375 25.137500000000003 40-41 28.287499999999998 23.45 22.4875 25.775 42-43 27.206801700425103 24.668667166791696 22.405601400350086 25.71892973243311 44-45 27.926463231615806 23.761880940470235 23.23661830915458 25.07503751875938 46-47 28.353544193024128 23.627953494186773 22.14026753344168 25.87823477934742 48-49 27.656914228557138 24.5311327831958 21.36784196049012 26.44411102775694 50-51 27.950000000000003 24.224999999999998 22.112499999999997 25.7125 52-53 28.275 23.4625 22.3 25.9625 54-55 28.375 24.2 21.6 25.825 56-57 26.275 23.9375 24.0 25.7875 58-59 27.5625 24.725 22.537499999999998 25.174999999999997 60-61 27.0625 24.462500000000002 22.9875 25.4875 62-63 28.8625 23.875 22.0625 25.2 64-65 28.65 24.762500000000003 22.075 24.5125 66-67 27.800000000000004 23.599999999999998 22.537499999999998 26.0625 68-69 29.2 23.45 22.2625 25.087500000000002 70-71 28.526763381690845 23.974487243621812 21.92346173086543 25.57528764382191 72-73 28.264132066033014 24.287143571785894 21.96098049024512 25.48774387193597 74-75 27.60690172543136 24.8062015503876 21.792948237059264 25.79394848712178 76-77 28.1875 23.8125 23.125 24.875 78-79 28.487499999999997 22.7625 23.0125 25.7375 80-81 28.425 23.925 22.287499999999998 25.362499999999997 82-83 28.66966741685421 24.18104526131533 21.930482620655166 25.218804701175294 84-85 28.1125 24.2 21.75 25.937500000000004 86-87 28.749999999999996 24.25 22.5 24.5 88-89 28.7375 24.825 22.0 24.4375 90-91 28.299999999999997 23.175 22.9625 25.5625 92-93 29.439719859929962 24.499749874937468 21.473236618309155 24.58729364682341 94-95 29.519879969992495 25.23130782695674 21.29282320580145 23.95598899724931 96-97 30.325000000000003 23.7875 22.5875 23.3 98-99 29.232308077019255 25.543885971492873 22.393098274568644 22.83070767691923 100-101 30.336376141052895 23.546329873702636 22.44591721895711 23.67137676628736 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 2.0 14 3.0 15 1.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 1.0 23 1.5 24 1.5 25 0.5 26 1.0 27 2.5 28 2.5 29 2.0 30 1.5 31 1.5 32 3.5 33 5.0 34 7.0 35 13.0 36 21.0 37 31.5 38 42.5 39 54.0 40 57.5 41 82.0 42 115.0 43 121.0 44 129.0 45 143.5 46 160.5 47 186.5 48 199.0 49 181.5 50 162.0 51 148.5 52 135.5 53 126.5 54 121.0 55 122.0 56 125.0 57 113.5 58 114.0 59 104.5 60 94.0 61 101.0 62 92.0 63 76.0 64 73.5 65 72.0 66 62.5 67 62.0 68 64.5 69 63.5 70 56.0 71 46.5 72 41.0 73 41.0 74 33.5 75 26.5 76 27.0 77 18.0 78 11.0 79 11.0 80 8.0 81 5.0 82 6.5 83 8.0 84 4.5 85 2.0 86 1.0 87 1.5 88 1.5 89 1.0 90 1.0 91 1.0 92 0.5 93 0.5 94 1.5 95 2.5 96 2.0 97 0.5 98 2.5 99 6.0 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.025 20-21 0.0 22-23 0.025 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.025 44-45 0.05 46-47 0.0125 48-49 0.025 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.05 72-73 0.05 74-75 0.025 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.05 94-95 0.025 96-97 0.0 98-99 0.025 100-101 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27312896989783 82.625 2 7.649820491576913 13.850000000000001 3 0.8837337752002209 2.4 4 0.11046672190002761 0.4 5 0.027616680475006903 0.125 6 0.027616680475006903 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027616680475006903 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit TCGCCGTTTAGGCGACGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.16249999999999998 0.0 0.0 0.0 0.0 46-47 0.21250000000000002 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.3125 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.4125 0.0 0.0 0.0 0.0 56-57 0.4875 0.0 0.0 0.0 0.0 58-59 0.575 0.0 0.0 0.0 0.0 60-61 0.675 0.0 0.0 0.0 0.0 62-63 0.9375 0.0 0.0 0.0 0.0 64-65 1.1375000000000002 0.0 0.0 0.0 0.0 66-67 1.375 0.0 0.0 0.0 0.0 68-69 1.5375 0.0 0.0 0.0 0.0 70-71 1.775 0.0 0.0 0.0 0.0 72-73 1.9625 0.0 0.0 0.0 0.0 74-75 2.1875 0.0 0.0 0.0 0.0 76-77 2.525 0.0 0.0 0.0 0.0 78-79 2.825 0.0 0.0 0.0 0.0 80-81 3.0375 0.0 0.0 0.0 0.0 82-83 3.4375 0.0 0.0 0.0 0.0 84-85 3.85 0.0 0.0 0.0 0.0 86-87 4.1875 0.0 0.0 0.0 0.0 88-89 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865223 spots for ERR3450064.sra Written 865223 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra Read 865213 spots for ERR3450064.sra Written 865213 spots for ERR3450064.sra SRR ids: ['ERR3450064.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l98f5182 ERR3450064.sra spots: 17304270 blocks: [[1, 865213], [865214, 1730426], [1730427, 2595639], [2595640, 3460852], [3460853, 4326065], [4326066, 5191278], [5191279, 6056491], [6056492, 6921704], [6921705, 7786917], [7786918, 8652130], [8652131, 9517343], [9517344, 10382556], [10382557, 11247769], [11247770, 12112982], [12112983, 12978195], [12978196, 13843408], [13843409, 14708621], [14708622, 15573834], [15573835, 16439047], [16439048, 17304270]] ERR3450064 file size 4152278 ERR3450064 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450064 ERR3450064_1.fastq ERR3450064_2.fastq Input file: ERR3450064_1.fastq Paired file: ERR3450064_2.fastq trimmed: ERR3450064-trimmed-pair1.fastq, ERR3450064-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:20:42 2024 >> started Sat Dec 7 14:21:00 2024 >> done (17.703s) 17304270 read pairs processed; of these: 123 ( 0.00%) short read pairs filtered out after trimming by size control 67683 ( 0.39%) empty read pairs filtered out after trimming by size control 17236464 (99.61%) read pairs available; of these: 1634021 ( 9.48%) trimmed read pairs available after processing 15602443 (90.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 49 0.00% 20 159 0.00% 21 321 0.00% 22 342 0.00% 23 214 0.00% 24 214 0.00% 25 285 0.00% 26 381 0.00% 27 553 0.00% 28 716 0.00% 29 991 0.01% 30 1235 0.01% 31 1441 0.01% 32 1533 0.01% 33 1515 0.01% 34 1532 0.01% 35 1545 0.01% 36 1598 0.01% 37 1751 0.01% 38 2135 0.01% 39 2515 0.01% 40 2826 0.02% 41 3192 0.02% 42 3657 0.02% 43 3878 0.02% 44 3385 0.02% 45 3450 0.02% 46 3721 0.02% 47 4125 0.02% 48 4731 0.03% 49 5049 0.03% 50 5646 0.03% 51 6235 0.04% 52 6922 0.04% 53 7133 0.04% 54 7455 0.04% 55 8031 0.05% 56 8293 0.05% 57 8762 0.05% 58 9521 0.06% 59 10635 0.06% 60 11099 0.06% 61 12465 0.07% 62 13513 0.08% 63 14813 0.09% 64 15329 0.09% 65 15932 0.09% 66 16615 0.10% 67 17482 0.10% 68 18469 0.11% 69 19022 0.11% 70 20280 0.12% 71 22001 0.13% 72 23677 0.14% 73 24960 0.14% 74 26196 0.15% 75 27483 0.16% 76 28592 0.17% 77 29022 0.17% 78 30770 0.18% 79 32431 0.19% 80 33751 0.20% 81 35595 0.21% 82 37329 0.22% 83 39056 0.23% 84 40386 0.23% 85 42016 0.24% 86 43310 0.25% 87 45123 0.26% 88 46831 0.27% 89 48218 0.28% 90 49907 0.29% 91 52677 0.31% 92 55209 0.32% 93 56328 0.33% 94 58448 0.34% 95 60124 0.35% 96 60875 0.35% 97 63930 0.37% 98 65086 0.38% 99 66224 0.38% 100 75746 0.44% 101 15602443 90.52% 17236464 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=29 prefix-density=0.28 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=174.87 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=21.7 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.1 sequence=AGCCAGAGGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=214.76 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=22.8 sequence=CGGCGGCGGCGA ERR3450064 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:21:31 Started mapping on | Dec 07 14:21:31 Finished on | Dec 07 14:23:11 Mapping speed, Million of reads per hour | 620.51 Number of input reads | 17236464 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 13537442 Uniquely mapped reads % | 78.54% Average mapped length | 198.00 Number of splices: Total | 8451493 Number of splices: Annotated (sjdb) | 8005138 Number of splices: GT/AG | 8340986 Number of splices: GC/AG | 96002 Number of splices: AT/AC | 5054 Number of splices: Non-canonical | 9451 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 917727 % of reads mapped to multiple loci | 5.32% Number of reads mapped to too many loci | 436732 % of reads mapped to too many loci | 2.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 10.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2781295 2781295 2781295 N_multimapping 917727 917727 917727 N_noFeature 404185 13037002 705813 N_ambiguous 242336 1903 45819 UnstrandedReadsAssigned:12890921 PositiveStrandReadsAssigned:498537 NegativeStrandReadsAssigned:12785810 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450064 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450064-trimmed-pair1.fastq ERR3450064-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,236,464 reads, 13,561,073 reads pseudoaligned [quant] estimated average fragment length: 183.96 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 ERR3450064.ke.tsv 35125 ERR3450064.se.tsv 88098 total ==> ERR3450064.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.248 0.287643 0.042534 PNS24247 1044 861.04 28.9587 3.74607 PNS24249 1928 1745.04 149.323 9.53107 PNS24246 1044 861.04 28.9587 3.74607 PNS24248 1044 861.04 28.9587 3.74607 PNS24244 1471 1288.04 38.5131 3.33042 PNS24243 293 129.217 0 0 KQK14069 1603 1420.04 3839.7 301.174 KQK14071 474 294.478 215.993 81.6972 ==> ERR3450064.se.tsv <== BRADI_1g14170v3 4184 BRADI_1g53295v3 29 BRADI_1g59795v3 135 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 1345 BRADI_1g74790v3 217 BRADI_1g09890v3 14 BRADI_1g77505v3 155 BRADI_1g48960v3 0 ERR3450064 completed mapping pipeline successfully