Starting /dee2/code/volunteer_pipeline.sh ERR3450066 current disk space = 1543058857984 free memory = 1600094508 ERR3450066 SRAfilesize 85b5348e823d192e81fee15901033f09 ERR3450066.sra ERR3450066.sra file validated ERR3450066 is paired end ERR3450066 is conventional basespace ERR3450066 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450066_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10425 37.0 37.0 37.0 37.0 37.0 2 36.405 37.0 37.0 37.0 37.0 37.0 3 36.396 37.0 37.0 37.0 37.0 37.0 4 36.4275 37.0 37.0 37.0 37.0 37.0 5 36.533 37.0 37.0 37.0 37.0 37.0 6 36.576 37.0 37.0 37.0 37.0 37.0 7 36.484 37.0 37.0 37.0 37.0 37.0 8 36.4605 37.0 37.0 37.0 37.0 37.0 9 36.5415 37.0 37.0 37.0 37.0 37.0 10-11 36.519999999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.556 37.0 37.0 37.0 37.0 37.0 14-15 36.52875 37.0 37.0 37.0 37.0 37.0 16-17 36.4885 37.0 37.0 37.0 37.0 37.0 18-19 36.496 37.0 37.0 37.0 37.0 37.0 20-21 36.5215 37.0 37.0 37.0 37.0 37.0 22-23 36.48524999999999 37.0 37.0 37.0 37.0 37.0 24-25 36.439499999999995 37.0 37.0 37.0 37.0 37.0 26-27 36.4 37.0 37.0 37.0 37.0 37.0 28-29 36.42225 37.0 37.0 37.0 37.0 37.0 30-31 36.377250000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.385999999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.30475 37.0 37.0 37.0 37.0 37.0 36-37 36.34625 37.0 37.0 37.0 37.0 37.0 38-39 36.3625 37.0 37.0 37.0 37.0 37.0 40-41 36.36125 37.0 37.0 37.0 37.0 37.0 42-43 36.38075 37.0 37.0 37.0 37.0 37.0 44-45 36.166250000000005 37.0 37.0 37.0 37.0 37.0 46-47 36.1595 37.0 37.0 37.0 37.0 37.0 48-49 36.272999999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.218 37.0 37.0 37.0 37.0 37.0 52-53 36.305 37.0 37.0 37.0 37.0 37.0 54-55 36.198 37.0 37.0 37.0 37.0 37.0 56-57 36.269 37.0 37.0 37.0 37.0 37.0 58-59 36.12075 37.0 37.0 37.0 37.0 37.0 60-61 36.031 37.0 37.0 37.0 37.0 37.0 62-63 36.08825 37.0 37.0 37.0 37.0 37.0 64-65 35.9855 37.0 37.0 37.0 37.0 37.0 66-67 36.09375 37.0 37.0 37.0 37.0 37.0 68-69 36.0745 37.0 37.0 37.0 37.0 37.0 70-71 35.935500000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.8065 37.0 37.0 37.0 37.0 37.0 74-75 36.135999999999996 37.0 37.0 37.0 37.0 37.0 76-77 36.153499999999994 37.0 37.0 37.0 37.0 37.0 78-79 36.0745 37.0 37.0 37.0 37.0 37.0 80-81 36.177 37.0 37.0 37.0 37.0 37.0 82-83 36.04 37.0 37.0 37.0 37.0 37.0 84-85 36.074749999999995 37.0 37.0 37.0 37.0 37.0 86-87 36.006 37.0 37.0 37.0 37.0 37.0 88-89 36.05575 37.0 37.0 37.0 37.0 37.0 90-91 35.93625 37.0 37.0 37.0 37.0 37.0 92-93 36.0505 37.0 37.0 37.0 37.0 37.0 94-95 36.03175 37.0 37.0 37.0 37.0 37.0 96-97 35.95 37.0 37.0 37.0 37.0 37.0 98-99 35.885999999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.89775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 2.0 23 1.0 24 7.0 25 7.0 26 7.0 27 12.0 28 24.0 29 37.0 30 45.0 31 47.0 32 57.0 33 77.0 34 123.0 35 188.0 36 1669.0 37 1694.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.266884258096916 10.067788099422547 10.820989204117499 39.84433843836304 2 22.0 12.925 29.675 35.4 3 21.45 17.4 24.25 36.9 4 28.275 22.35 18.025 31.35 5 27.35 26.575 22.325 23.75 6 23.625 30.375000000000004 24.175 21.825 7 19.875 22.375 37.3 20.45 8 21.575 20.75 29.075 28.599999999999998 9 22.775000000000002 21.9 30.4 24.925 10-11 24.275 27.325 22.125 26.275 12-13 23.45 23.2625 25.474999999999998 27.8125 14-15 23.0 25.4875 25.85 25.662499999999998 16-17 23.849999999999998 23.4125 26.0 26.737499999999997 18-19 24.712500000000002 24.575 24.8125 25.900000000000002 20-21 23.400000000000002 24.6125 25.724999999999998 26.2625 22-23 24.85 24.087500000000002 24.4875 26.575 24-25 24.7875 24.05 24.212500000000002 26.950000000000003 26-27 23.375 24.175 25.224999999999998 27.224999999999998 28-29 25.05 24.675 24.3 25.974999999999998 30-31 25.674999999999997 23.2375 24.375 26.7125 32-33 23.5125 24.5 24.525 27.462500000000002 34-35 24.474999999999998 23.2125 24.637500000000003 27.675 36-37 24.1875 23.549999999999997 24.375 27.8875 38-39 23.8625 23.6625 24.85 27.625 40-41 24.712500000000002 24.525 23.8625 26.900000000000002 42-43 25.087500000000002 24.025 23.425 27.462500000000002 44-45 24.625 24.4 24.2875 26.687499999999996 46-47 23.5875 24.224999999999998 25.412499999999998 26.775 48-49 24.962500000000002 22.85 24.3 27.8875 50-51 24.95 22.95 24.2875 27.8125 52-53 24.975 23.1375 23.5 28.3875 54-55 24.675 24.2875 23.2625 27.775 56-57 23.9375 23.5625 25.1 27.400000000000002 58-59 23.5125 24.1125 24.6875 27.6875 60-61 25.15 23.2125 24.337500000000002 27.3 62-63 24.712500000000002 23.0625 25.224999999999998 27.0 64-65 24.75 23.7875 25.324999999999996 26.137500000000003 66-67 24.625 24.1875 23.5375 27.650000000000002 68-69 25.3125 24.25 23.425 27.0125 70-71 25.525 24.275 23.325000000000003 26.875 72-73 24.887500000000003 24.825 23.0875 27.200000000000003 74-75 24.1375 23.75 24.637500000000003 27.474999999999998 76-77 25.55 23.7875 23.7125 26.950000000000003 78-79 25.5125 24.9 23.025000000000002 26.5625 80-81 25.75 24.3 22.525000000000002 27.425 82-83 26.5125 24.2375 23.6125 25.637500000000003 84-85 25.2375 24.45 23.5 26.8125 86-87 25.0625 23.7875 24.2875 26.8625 88-89 25.4 24.6875 22.225 27.6875 90-91 25.0125 24.575 23.425 26.987499999999997 92-93 25.8125 23.95 23.525 26.7125 94-95 25.7 25.3 22.7 26.3 96-97 24.9875 25.025 23.75 26.237500000000004 98-99 24.2625 24.6625 23.95 27.125 100-101 24.962500000000002 24.075 22.9625 28.000000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.0 2 1.5 3 1.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 1.5 26 1.5 27 2.5 28 1.5 29 2.0 30 2.0 31 3.5 32 6.5 33 7.0 34 9.0 35 18.5 36 28.5 37 31.0 38 32.5 39 48.0 40 71.0 41 103.5 42 121.5 43 134.0 44 146.5 45 150.5 46 171.5 47 183.5 48 175.0 49 171.5 50 176.5 51 181.0 52 181.0 53 159.0 54 145.5 55 148.0 56 146.5 57 131.5 58 105.5 59 90.5 60 77.5 61 76.0 62 75.0 63 73.5 64 67.5 65 52.5 66 52.0 67 48.5 68 53.0 69 50.5 70 36.5 71 30.0 72 28.5 73 37.5 74 33.0 75 23.5 76 22.0 77 14.5 78 10.5 79 6.5 80 3.0 81 4.0 82 3.5 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.35 #Duplication Level Percentage of deduplicated Percentage of total 1 89.95472552348613 79.475 2 8.290888511601585 14.649999999999999 3 0.9620826259196379 2.55 4 0.5093378607809848 1.7999999999999998 5 0.1414827391058291 0.625 6 0.11318619128466327 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028296547821165818 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit CTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAGAAGCTAGCTG 6 0.15 No Hit GTCGAGTTATCATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCT 6 0.15 No Hit GGCTGAGGTCTCGTTCGTTAACGGAATTAACCAGACAAATCGCTCCACCA 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) GCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCT 5 0.125 No Hit GCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCG 5 0.125 No Hit CGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCC 5 0.125 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 5 0.125 No Hit CCCCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.07500000000000001 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1375 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.3375 0.0 0.0 0.0 0.0 42-43 0.38749999999999996 0.0 0.0 0.0 0.0 44-45 0.45 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.5125 0.0 0.0 0.0 0.0 50-51 0.5625 0.0 0.0 0.0 0.0 52-53 0.65 0.0 0.0 0.0 0.0 54-55 0.75 0.0 0.0 0.0 0.0 56-57 0.875 0.0 0.0 0.0 0.0 58-59 1.1 0.0 0.0 0.0 0.0 60-61 1.3624999999999998 0.0 0.0 0.0 0.0 62-63 1.625 0.0 0.0 0.0 0.0 64-65 1.9 0.0 0.0 0.0 0.0 66-67 2.1375 0.0 0.0 0.0 0.0 68-69 2.3625 0.0 0.0 0.0 0.0 70-71 2.6125 0.0 0.0 0.0 0.0 72-73 2.975 0.0 0.0 0.0 0.0 74-75 3.4375 0.0 0.0 0.0 0.0 76-77 3.8625 0.0 0.0 0.0 0.0 78-79 4.375 0.0 0.0 0.0 0.0 80-81 5.025 0.0 0.0 0.0 0.0 82-83 5.7625 0.0 0.0 0.0 0.0 84-85 6.2875 0.0 0.0 0.0 0.0 86-87 6.887499999999999 0.0 0.0 0.0 0.0 88-89 7.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCCA 15 0.009957196 47.5 90-91 >>END_MODULE ERR3450066 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450066_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31 37.0 37.0 37.0 37.0 37.0 2 36.1725 37.0 37.0 37.0 37.0 37.0 3 36.2495 37.0 37.0 37.0 37.0 37.0 4 36.176 37.0 37.0 37.0 37.0 37.0 5 36.351 37.0 37.0 37.0 37.0 37.0 6 36.3245 37.0 37.0 37.0 37.0 37.0 7 36.3055 37.0 37.0 37.0 37.0 37.0 8 36.328 37.0 37.0 37.0 37.0 37.0 9 36.346 37.0 37.0 37.0 37.0 37.0 10-11 36.19975 37.0 37.0 37.0 37.0 37.0 12-13 36.20325 37.0 37.0 37.0 37.0 37.0 14-15 36.179249999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.0795 37.0 37.0 37.0 37.0 37.0 18-19 36.134 37.0 37.0 37.0 37.0 37.0 20-21 36.15975 37.0 37.0 37.0 37.0 37.0 22-23 36.21825 37.0 37.0 37.0 37.0 37.0 24-25 36.088499999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.0065 37.0 37.0 37.0 37.0 37.0 28-29 35.93425 37.0 37.0 37.0 37.0 37.0 30-31 35.95675 37.0 37.0 37.0 37.0 37.0 32-33 35.94625 37.0 37.0 37.0 37.0 37.0 34-35 35.764250000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.8665 37.0 37.0 37.0 37.0 37.0 38-39 35.769999999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.786 37.0 37.0 37.0 37.0 37.0 42-43 35.769999999999996 37.0 37.0 37.0 37.0 37.0 44-45 35.93625 37.0 37.0 37.0 37.0 37.0 46-47 35.8715 37.0 37.0 37.0 37.0 37.0 48-49 35.936 37.0 37.0 37.0 37.0 37.0 50-51 35.82975 37.0 37.0 37.0 37.0 37.0 52-53 35.9015 37.0 37.0 37.0 37.0 37.0 54-55 35.88075 37.0 37.0 37.0 37.0 37.0 56-57 35.893 37.0 37.0 37.0 37.0 37.0 58-59 35.9105 37.0 37.0 37.0 37.0 37.0 60-61 35.93625 37.0 37.0 37.0 37.0 37.0 62-63 35.949 37.0 37.0 37.0 37.0 37.0 64-65 36.0225 37.0 37.0 37.0 37.0 37.0 66-67 35.90725 37.0 37.0 37.0 37.0 37.0 68-69 35.823499999999996 37.0 37.0 37.0 37.0 37.0 70-71 35.79675 37.0 37.0 37.0 37.0 37.0 72-73 35.79425 37.0 37.0 37.0 37.0 37.0 74-75 35.7215 37.0 37.0 37.0 37.0 37.0 76-77 35.61 37.0 37.0 37.0 37.0 37.0 78-79 35.659000000000006 37.0 37.0 37.0 37.0 37.0 80-81 35.66525 37.0 37.0 37.0 37.0 37.0 82-83 35.7205 37.0 37.0 37.0 37.0 37.0 84-85 35.66075 37.0 37.0 37.0 37.0 37.0 86-87 35.717 37.0 37.0 37.0 37.0 37.0 88-89 35.6775 37.0 37.0 37.0 37.0 37.0 90-91 35.68075 37.0 37.0 37.0 37.0 37.0 92-93 35.67 37.0 37.0 37.0 37.0 37.0 94-95 35.636750000000006 37.0 37.0 37.0 37.0 37.0 96-97 35.753 37.0 37.0 37.0 37.0 37.0 98-99 35.6195 37.0 37.0 37.0 37.0 37.0 100-101 35.59125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 2.0 17 5.0 18 7.0 19 5.0 20 10.0 21 10.0 22 12.0 23 13.0 24 11.0 25 7.0 26 12.0 27 15.0 28 20.0 29 17.0 30 28.0 31 37.0 32 53.0 33 85.0 34 126.0 35 346.0 36 2304.0 37 873.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.625 16.325 12.225 29.825000000000003 2 27.875 22.3 26.700000000000003 23.125 3 25.8 24.625 26.325 23.25 4 31.05 27.975 16.075 24.9 5 28.050000000000004 29.599999999999998 20.1 22.25 6 24.55 32.7 19.3 23.45 7 26.125 18.5 31.724999999999998 23.65 8 23.849999999999998 21.975 24.5 29.675 9 27.125 21.15 23.775 27.950000000000003 10-11 27.6 26.724999999999998 21.125 24.55 12-13 29.362500000000004 21.587500000000002 22.3125 26.737499999999997 14-15 27.1375 24.587500000000002 23.7 24.575 16-17 28.8875 24.15 22.425 24.5375 18-19 27.9375 24.7375 22.75 24.575 20-21 26.974999999999998 24.5 23.0125 25.5125 22-23 28.962500000000002 23.2625 22.95 24.825 24-25 27.8625 23.8375 23.0 25.3 26-27 27.825 25.525 21.875 24.775 28-29 28.775000000000002 24.85 22.975 23.400000000000002 30-31 27.5625 24.6625 22.7125 25.0625 32-33 27.625 25.124999999999996 22.5875 24.6625 34-35 27.5625 24.85 23.025000000000002 24.5625 36-37 28.325 23.0875 22.85 25.7375 38-39 27.437499999999996 24.4125 22.7125 25.4375 40-41 28.225 23.2625 22.8875 25.624999999999996 42-43 26.85 24.962500000000002 22.675 25.5125 44-45 28.325 24.525 22.1875 24.962500000000002 46-47 27.762500000000003 24.2625 23.2375 24.7375 48-49 27.1 24.4875 23.075000000000003 25.337500000000002 50-51 28.1125 24.762500000000003 22.0625 25.0625 52-53 28.1 23.65 23.2125 25.0375 54-55 28.275 24.15 22.662499999999998 24.9125 56-57 27.35 25.2125 22.6375 24.8 58-59 28.175 24.4 22.55 24.875 60-61 28.6125 24.275 22.35 24.762500000000003 62-63 27.425 24.6875 22.8125 25.074999999999996 64-65 28.3875 24.6 22.7375 24.275 66-67 27.450000000000003 25.374999999999996 21.987499999999997 25.1875 68-69 27.4125 25.650000000000002 22.7 24.2375 70-71 29.299999999999997 23.8875 22.475 24.337500000000002 72-73 29.012500000000003 24.349999999999998 22.625 24.0125 74-75 28.499999999999996 25.0625 22.912499999999998 23.525 76-77 28.249999999999996 24.025 23.2375 24.4875 78-79 28.9125 23.724999999999998 22.25 25.112499999999997 80-81 29.099999999999998 24.7875 21.8125 24.3 82-83 28.15 23.7875 23.0 25.0625 84-85 28.537499999999998 24.925 22.05 24.4875 86-87 28.1625 24.887500000000003 22.400000000000002 24.55 88-89 29.1125 25.112499999999997 21.6875 24.087500000000002 90-91 28.762500000000003 25.937500000000004 22.0 23.3 92-93 29.3875 25.074999999999996 21.75 23.7875 94-95 28.787499999999998 25.05 22.7 23.4625 96-97 28.825 25.650000000000002 22.287499999999998 23.2375 98-99 28.8375 25.0 22.400000000000002 23.7625 100-101 29.512500000000003 24.462500000000002 23.825 22.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 2.0 13 2.5 14 1.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.5 20 2.0 21 1.0 22 1.0 23 1.5 24 1.5 25 3.0 26 4.0 27 2.5 28 1.0 29 0.5 30 1.0 31 2.5 32 3.0 33 3.0 34 6.5 35 16.0 36 20.5 37 24.5 38 40.5 39 60.0 40 71.5 41 89.0 42 114.5 43 125.5 44 134.0 45 145.5 46 168.5 47 193.5 48 186.0 49 170.0 50 153.5 51 150.5 52 163.5 53 148.0 54 130.0 55 133.5 56 138.5 57 122.0 58 98.0 59 95.5 60 87.0 61 86.5 62 106.0 63 93.5 64 64.5 65 62.5 66 66.5 67 61.5 68 58.5 69 56.0 70 51.0 71 44.5 72 35.5 73 31.5 74 33.5 75 25.0 76 14.5 77 12.5 78 12.5 79 10.5 80 8.0 81 5.0 82 1.5 83 2.5 84 4.0 85 3.0 86 3.0 87 1.5 88 1.0 89 1.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.5 97 1.0 98 1.0 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.09261857984843 80.25 2 8.391804658995229 14.95 3 1.0103845074375526 2.7 4 0.280662363177098 1.0 5 0.140331181588549 0.625 6 0.056132472635419595 0.3 7 0.028066236317709797 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 7 0.17500000000000002 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit GATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC 6 0.15 No Hit TACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CGAGTATATAGCCTTGGCCGACAGGCCCGGGTAATCTTGGGAAATTTCAT 5 0.125 No Hit TCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGAC 5 0.125 No Hit GTAATCTTGGGAAATTTCATCGTGATGGGGATAGATCATTGCAATTGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.07500000000000001 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1375 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.4125 0.0 0.0 0.0 0.0 44-45 0.475 0.0 0.0 0.0 0.0 46-47 0.5 0.0 0.0 0.0 0.0 48-49 0.5375 0.0 0.0 0.0 0.0 50-51 0.5874999999999999 0.0 0.0 0.0 0.0 52-53 0.675 0.0 0.0 0.0 0.0 54-55 0.775 0.0 0.0 0.0 0.0 56-57 0.9 0.0 0.0 0.0 0.0 58-59 1.1375 0.0 0.0 0.0 0.0 60-61 1.4125 0.0 0.0 0.0 0.0 62-63 1.65 0.0 0.0 0.0 0.0 64-65 1.925 0.0 0.0 0.0 0.0 66-67 2.2125 0.0 0.0 0.0 0.0 68-69 2.4375 0.0 0.0 0.0 0.0 70-71 2.6875 0.0 0.0 0.0 0.0 72-73 3.0125 0.0 0.0 0.0 0.0 74-75 3.4625000000000004 0.0 0.0 0.0 0.0 76-77 3.875 0.0 0.0 0.0 0.0 78-79 4.375 0.0 0.0 0.0 0.0 80-81 5.0125 0.0 0.0 0.0 0.0 82-83 5.75 0.0 0.0 0.0 0.0 84-85 6.2875 0.0 0.0 0.0 0.0 86-87 6.875 0.0 0.0 0.0 0.0 88-89 7.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512633 spots for ERR3450066.sra Written 1512633 spots for ERR3450066.sra Read 1512642 spots for ERR3450066.sra Written 1512642 spots for ERR3450066.sra SRR ids: ['ERR3450066.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qng3wqkw ERR3450066.sra spots: 30252669 blocks: [[1, 1512633], [1512634, 3025266], [3025267, 4537899], [4537900, 6050532], [6050533, 7563165], [7563166, 9075798], [9075799, 10588431], [10588432, 12101064], [12101065, 13613697], [13613698, 15126330], [15126331, 16638963], [16638964, 18151596], [18151597, 19664229], [19664230, 21176862], [21176863, 22689495], [22689496, 24202128], [24202129, 25714761], [25714762, 27227394], [27227395, 28740027], [28740028, 30252669]] ERR3450066 file size 7275574 ERR3450066 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450066 ERR3450066_1.fastq ERR3450066_2.fastq Input file: ERR3450066_1.fastq Paired file: ERR3450066_2.fastq trimmed: ERR3450066-trimmed-pair1.fastq, ERR3450066-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:23:41 2024 >> started Sat Dec 7 14:24:07 2024 >> done (26.125s) 30252669 read pairs processed; of these: 236 ( 0.00%) short read pairs filtered out after trimming by size control 78612 ( 0.26%) empty read pairs filtered out after trimming by size control 30173821 (99.74%) read pairs available; of these: 3598840 (11.93%) trimmed read pairs available after processing 26574981 (88.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 53 0.00% 19 118 0.00% 20 333 0.00% 21 816 0.00% 22 998 0.00% 23 445 0.00% 24 538 0.00% 25 689 0.00% 26 1030 0.00% 27 1375 0.00% 28 1958 0.01% 29 2432 0.01% 30 2992 0.01% 31 3634 0.01% 32 3683 0.01% 33 3601 0.01% 34 3484 0.01% 35 3508 0.01% 36 3886 0.01% 37 4443 0.01% 38 5253 0.02% 39 6026 0.02% 40 6972 0.02% 41 8178 0.03% 42 9004 0.03% 43 9373 0.03% 44 9135 0.03% 45 8969 0.03% 46 9450 0.03% 47 10621 0.04% 48 11671 0.04% 49 12897 0.04% 50 14279 0.05% 51 15392 0.05% 52 17306 0.06% 53 18086 0.06% 54 18952 0.06% 55 19906 0.07% 56 20594 0.07% 57 21680 0.07% 58 23631 0.08% 59 25662 0.09% 60 27491 0.09% 61 30550 0.10% 62 33184 0.11% 63 35509 0.12% 64 37050 0.12% 65 38321 0.13% 66 39594 0.13% 67 42584 0.14% 68 44135 0.15% 69 45824 0.15% 70 47886 0.16% 71 51248 0.17% 72 55306 0.18% 73 57693 0.19% 74 60757 0.20% 75 62991 0.21% 76 64191 0.21% 77 66812 0.22% 78 69643 0.23% 79 72636 0.24% 80 74953 0.25% 81 78135 0.26% 82 82602 0.27% 83 84953 0.28% 84 87144 0.29% 85 91198 0.30% 86 93607 0.31% 87 96853 0.32% 88 100188 0.33% 89 103961 0.34% 90 106441 0.35% 91 110867 0.37% 92 116420 0.39% 93 118158 0.39% 94 122421 0.41% 95 125253 0.42% 96 127591 0.42% 97 131617 0.44% 98 133395 0.44% 99 134703 0.45% 100 151922 0.50% 101 26574981 88.07% 30173821 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=2.4 sequence=GTCAAATTAAGCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATAAGCAACATCCGCCGATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGACCGGAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGACCCGGCCAATTAAGGCTAGGAGCGCATCGCCGGCTGAAGGGTCGAGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=172.17 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=21.0 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=2.0 sequence=CAAGTGTTGGATT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=207.49 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=22.6 sequence=CGGCGGCGGCGC ERR3450066 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:24:38 Started mapping on | Dec 07 14:24:38 Finished on | Dec 07 14:26:54 Mapping speed, Million of reads per hour | 798.72 Number of input reads | 30173821 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 21807589 Uniquely mapped reads % | 72.27% Average mapped length | 196.95 Number of splices: Total | 13621473 Number of splices: Annotated (sjdb) | 12907217 Number of splices: GT/AG | 13441834 Number of splices: GC/AG | 155040 Number of splices: AT/AC | 8794 Number of splices: Non-canonical | 15805 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1841551 % of reads mapped to multiple loci | 6.10% Number of reads mapped to too many loci | 1136275 % of reads mapped to too many loci | 3.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 14.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6524681 6524681 6524681 N_multimapping 1841551 1841551 1841551 N_noFeature 800343 21022124 1270122 N_ambiguous 387932 3174 76217 UnstrandedReadsAssigned:20619314 PositiveStrandReadsAssigned:782291 NegativeStrandReadsAssigned:20461250 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450066 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450066-trimmed-pair1.fastq ERR3450066-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,173,821 reads, 21,749,664 reads pseudoaligned [quant] estimated average fragment length: 179.118 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 ERR3450066.ke.tsv 35125 ERR3450066.se.tsv 88098 total ==> ERR3450066.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758 0 0 PNS24247 1044 865.882 34.5592 2.74801 PNS24249 1928 1749.88 298.744 11.7545 PNS24246 1044 865.882 34.5592 2.74801 PNS24248 1044 865.882 34.5592 2.74801 PNS24244 1471 1292.88 52.5784 2.80003 PNS24243 293 134.322 0 0 KQK14069 1603 1424.88 2799.95 135.296 KQK14071 474 299.339 170.143 39.1348 ==> ERR3450066.se.tsv <== BRADI_1g14170v3 3052 BRADI_1g53295v3 36 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 2733 BRADI_1g74790v3 195 BRADI_1g09890v3 23 BRADI_1g77505v3 289 BRADI_1g48960v3 0 ERR3450066 completed mapping pipeline successfully