Starting /dee2/code/volunteer_pipeline.sh ERR3450067 current disk space = 1516103086080 free memory = 1607708592 ERR3450067 SRAfilesize fe0b2ffbe527bcdef3397d5a387f00cc ERR3450067.sra ERR3450067.sra file validated ERR3450067 is paired end ERR3450067 is conventional basespace ERR3450067 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450067_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20125 37.0 37.0 37.0 37.0 37.0 2 36.465 37.0 37.0 37.0 37.0 37.0 3 36.4255 37.0 37.0 37.0 37.0 37.0 4 36.5035 37.0 37.0 37.0 37.0 37.0 5 36.5035 37.0 37.0 37.0 37.0 37.0 6 36.6 37.0 37.0 37.0 37.0 37.0 7 36.5315 37.0 37.0 37.0 37.0 37.0 8 36.505 37.0 37.0 37.0 37.0 37.0 9 36.4995 37.0 37.0 37.0 37.0 37.0 10-11 36.56075 37.0 37.0 37.0 37.0 37.0 12-13 36.506249999999994 37.0 37.0 37.0 37.0 37.0 14-15 36.54725 37.0 37.0 37.0 37.0 37.0 16-17 36.51325 37.0 37.0 37.0 37.0 37.0 18-19 36.516 37.0 37.0 37.0 37.0 37.0 20-21 36.55875 37.0 37.0 37.0 37.0 37.0 22-23 36.50425 37.0 37.0 37.0 37.0 37.0 24-25 36.54075 37.0 37.0 37.0 37.0 37.0 26-27 36.45025 37.0 37.0 37.0 37.0 37.0 28-29 36.406 37.0 37.0 37.0 37.0 37.0 30-31 36.4405 37.0 37.0 37.0 37.0 37.0 32-33 36.281 37.0 37.0 37.0 37.0 37.0 34-35 36.242999999999995 37.0 37.0 37.0 37.0 37.0 36-37 36.3295 37.0 37.0 37.0 37.0 37.0 38-39 36.3035 37.0 37.0 37.0 37.0 37.0 40-41 36.31975 37.0 37.0 37.0 37.0 37.0 42-43 36.279875000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.248 37.0 37.0 37.0 37.0 37.0 46-47 36.14125 37.0 37.0 37.0 37.0 37.0 48-49 36.196 37.0 37.0 37.0 37.0 37.0 50-51 36.2155 37.0 37.0 37.0 37.0 37.0 52-53 36.191375 37.0 37.0 37.0 37.0 37.0 54-55 36.07575 37.0 37.0 37.0 37.0 37.0 56-57 36.16725 37.0 37.0 37.0 37.0 37.0 58-59 36.15025 37.0 37.0 37.0 37.0 37.0 60-61 36.04474999999999 37.0 37.0 37.0 37.0 37.0 62-63 36.04575 37.0 37.0 37.0 37.0 37.0 64-65 35.913250000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.9745 37.0 37.0 37.0 37.0 37.0 68-69 36.01725 37.0 37.0 37.0 37.0 37.0 70-71 35.817 37.0 37.0 37.0 37.0 37.0 72-73 35.717 37.0 37.0 37.0 37.0 37.0 74-75 35.9965 37.0 37.0 37.0 37.0 37.0 76-77 36.057500000000005 37.0 37.0 37.0 37.0 37.0 78-79 36.0895 37.0 37.0 37.0 37.0 37.0 80-81 36.02575 37.0 37.0 37.0 37.0 37.0 82-83 36.0805 37.0 37.0 37.0 37.0 37.0 84-85 35.986000000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.9615 37.0 37.0 37.0 37.0 37.0 88-89 35.961 37.0 37.0 37.0 37.0 37.0 90-91 35.89875 37.0 37.0 37.0 37.0 37.0 92-93 35.90725 37.0 37.0 37.0 37.0 37.0 94-95 36.000249999999994 37.0 37.0 37.0 37.0 37.0 96-97 35.91425 37.0 37.0 37.0 37.0 37.0 98-99 35.841 37.0 37.0 37.0 37.0 37.0 100-101 35.841750000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 6.0 25 8.0 26 9.0 27 22.0 28 18.0 29 35.0 30 52.0 31 66.0 32 55.0 33 66.0 34 108.0 35 209.0 36 1783.0 37 1560.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.19709491610318 9.691960931630353 9.015777610818933 40.09516654144753 2 21.099999999999998 12.825000000000001 30.2 35.875 3 21.9 16.425 26.200000000000003 35.475 4 28.275 23.025000000000002 17.275 31.424999999999997 5 27.224999999999998 27.6 20.9 24.275 6 23.775 31.374999999999996 24.25 20.599999999999998 7 20.45 23.25 35.525 20.775 8 21.375 20.525 30.025000000000002 28.075 9 22.125 20.375 32.5 25.0 10-11 23.9875 28.4125 22.4375 25.162499999999998 12-13 24.3 21.7 26.325 27.675 14-15 23.7 23.8375 25.912499999999998 26.55 16-17 23.9375 23.1 24.525 28.4375 18-19 24.587500000000002 24.637500000000003 24.9 25.874999999999996 20-21 24.887500000000003 23.6875 25.074999999999996 26.35 22-23 25.0 23.25 24.3 27.450000000000003 24-25 24.212500000000002 24.1125 24.4375 27.237499999999997 26-27 24.675 23.45 24.4875 27.3875 28-29 25.4625 22.8 24.337500000000002 27.400000000000002 30-31 24.325 23.25 24.5 27.925 32-33 24.4 22.7375 24.4125 28.449999999999996 34-35 25.8 23.8625 23.599999999999998 26.737499999999997 36-37 24.3625 23.375 24.4125 27.85 38-39 23.7375 23.400000000000002 25.3 27.5625 40-41 24.775 23.4625 24.9125 26.85 42-43 25.2281535191899 22.702837854731843 25.065633204150515 27.00337542192774 44-45 25.0125 23.3125 24.887500000000003 26.787499999999998 46-47 25.0625 23.275000000000002 23.7375 27.925 48-49 24.3125 23.549999999999997 23.325000000000003 28.812500000000004 50-51 24.525 23.45 24.3 27.725 52-53 25.715714464308036 24.1780222527816 23.19039879984998 26.915864483060382 54-55 25.6 24.1375 22.775000000000002 27.487499999999997 56-57 24.3625 23.1125 25.45 27.075 58-59 25.937500000000004 24.325 22.025 27.712500000000002 60-61 25.724999999999998 23.2125 24.4875 26.575 62-63 24.462500000000002 23.575 24.887500000000003 27.075 64-65 25.45 23.724999999999998 23.875 26.950000000000003 66-67 24.6625 24.25 24.4125 26.674999999999997 68-69 24.375 25.124999999999996 23.175 27.325 70-71 24.775 23.7875 23.0 28.4375 72-73 26.4625 23.6875 22.912499999999998 26.937499999999996 74-75 25.662499999999998 23.974999999999998 23.7625 26.6 76-77 26.0 24.1125 24.087500000000002 25.8 78-79 25.0 23.8875 23.2375 27.875 80-81 24.975 23.05 24.1875 27.787499999999998 82-83 25.95 23.875 23.4625 26.7125 84-85 25.35 23.200000000000003 23.724999999999998 27.725 86-87 25.912499999999998 23.925 23.5375 26.625 88-89 26.125 24.7875 23.375 25.7125 90-91 26.1 23.925 22.8875 27.0875 92-93 26.487500000000004 24.1625 22.9625 26.387500000000003 94-95 25.124999999999996 24.325 22.8625 27.6875 96-97 25.337500000000002 23.7 23.400000000000002 27.5625 98-99 26.025 23.2375 23.575 27.1625 100-101 25.0375 24.637500000000003 22.662499999999998 27.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 1.0 3 0.5 4 0.5 5 2.5 6 4.0 7 2.0 8 0.5 9 1.5 10 2.0 11 1.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.0 27 0.5 28 0.0 29 4.0 30 5.0 31 3.5 32 5.5 33 11.0 34 14.5 35 16.0 36 22.0 37 31.5 38 43.5 39 49.0 40 54.5 41 83.0 42 114.5 43 131.5 44 134.5 45 152.5 46 178.5 47 181.0 48 179.5 49 171.5 50 162.0 51 159.0 52 152.0 53 150.0 54 146.5 55 147.0 56 157.5 57 135.5 58 109.5 59 102.5 60 89.0 61 83.0 62 76.0 63 63.0 64 65.5 65 72.5 66 62.0 67 55.0 68 60.5 69 55.5 70 41.5 71 42.0 72 38.0 73 28.5 74 26.0 75 19.5 76 20.0 77 20.5 78 14.5 79 9.0 80 6.5 81 4.5 82 4.0 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.175 #Duplication Level Percentage of deduplicated Percentage of total 1 88.61485517636936 77.25 2 9.262976770863206 16.150000000000002 3 1.5199311729280183 3.975 4 0.2581015199311729 0.8999999999999999 5 0.1720676799541153 0.75 6 0.11471178663607685 0.6 7 0.028677946659019213 0.17500000000000002 8 0.028677946659019213 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCAT 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 38bp) GCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCT 6 0.15 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit CAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCT 6 0.15 No Hit CCCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAAT 6 0.15 No Hit GGCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTC 5 0.125 No Hit CCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGC 5 0.125 No Hit GCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTC 5 0.125 No Hit CGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCC 5 0.125 No Hit CTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAGAAGCTAGCTG 5 0.125 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0125 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.05 0.0 0.0 0.0 0.025 38-39 0.05 0.0 0.0 0.0 0.025 40-41 0.0625 0.0 0.0 0.0 0.025 42-43 0.125 0.0 0.0 0.0 0.025 44-45 0.125 0.0 0.0 0.0 0.025 46-47 0.16249999999999998 0.0 0.0 0.0 0.025 48-49 0.21250000000000002 0.0 0.0 0.0 0.025 50-51 0.2375 0.0 0.0 0.0 0.025 52-53 0.30000000000000004 0.0 0.0 0.0 0.025 54-55 0.5 0.0 0.0 0.0 0.025 56-57 0.6625 0.0 0.0 0.0 0.025 58-59 0.8 0.0 0.0 0.0 0.025 60-61 0.95 0.0 0.0 0.0 0.025 62-63 1.1625 0.0 0.0 0.0 0.025 64-65 1.4125 0.0 0.0 0.0 0.025 66-67 1.65 0.0 0.0 0.0 0.025 68-69 1.9625 0.0 0.0 0.0 0.025 70-71 2.225 0.0 0.0 0.0 0.025 72-73 2.5125 0.0 0.0 0.0 0.025 74-75 2.675 0.0 0.0 0.0 0.025 76-77 3.075 0.0 0.0 0.0 0.025 78-79 3.525 0.0 0.0 0.0 0.025 80-81 3.9125 0.0 0.0 0.0 0.025 82-83 4.45 0.0 0.0 0.0 0.025 84-85 5.1 0.0 0.0 0.0 0.025 86-87 5.6625 0.0 0.0 0.025 0.025 88-89 6.2125 0.0 0.0 0.025 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450067 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450067_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1635 37.0 37.0 37.0 37.0 37.0 2 36.0895 37.0 37.0 37.0 37.0 37.0 3 36.062 37.0 37.0 37.0 37.0 37.0 4 36.1295 37.0 37.0 37.0 37.0 37.0 5 36.2955 37.0 37.0 37.0 37.0 37.0 6 36.2105 37.0 37.0 37.0 37.0 37.0 7 36.178 37.0 37.0 37.0 37.0 37.0 8 36.1545 37.0 37.0 37.0 37.0 37.0 9 36.269 37.0 37.0 37.0 37.0 37.0 10-11 36.10825 37.0 37.0 37.0 37.0 37.0 12-13 36.05875 37.0 37.0 37.0 37.0 37.0 14-15 36.045249999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.15775 37.0 37.0 37.0 37.0 37.0 18-19 36.070750000000004 37.0 37.0 37.0 37.0 37.0 20-21 36.09225 37.0 37.0 37.0 37.0 37.0 22-23 36.12925 37.0 37.0 37.0 37.0 37.0 24-25 35.98425 37.0 37.0 37.0 37.0 37.0 26-27 35.93 37.0 37.0 37.0 37.0 37.0 28-29 35.83775 37.0 37.0 37.0 37.0 37.0 30-31 35.7825 37.0 37.0 37.0 37.0 37.0 32-33 35.7855 37.0 37.0 37.0 37.0 37.0 34-35 35.6875 37.0 37.0 37.0 37.0 37.0 36-37 35.7435 37.0 37.0 37.0 37.0 37.0 38-39 35.66325 37.0 37.0 37.0 37.0 37.0 40-41 35.6 37.0 37.0 37.0 37.0 37.0 42-43 35.791 37.0 37.0 37.0 37.0 37.0 44-45 35.71725 37.0 37.0 37.0 37.0 37.0 46-47 35.7565 37.0 37.0 37.0 37.0 37.0 48-49 35.78675 37.0 37.0 37.0 37.0 37.0 50-51 35.7225 37.0 37.0 37.0 37.0 37.0 52-53 35.782 37.0 37.0 37.0 37.0 37.0 54-55 35.650999999999996 37.0 37.0 37.0 37.0 37.0 56-57 35.729749999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.846500000000006 37.0 37.0 37.0 37.0 37.0 60-61 35.91025 37.0 37.0 37.0 37.0 37.0 62-63 35.8975 37.0 37.0 37.0 37.0 37.0 64-65 35.832499999999996 37.0 37.0 37.0 37.0 37.0 66-67 35.7245 37.0 37.0 37.0 37.0 37.0 68-69 35.80425 37.0 37.0 37.0 37.0 37.0 70-71 35.647999999999996 37.0 37.0 37.0 37.0 37.0 72-73 35.73925 37.0 37.0 37.0 37.0 37.0 74-75 35.64975 37.0 37.0 37.0 37.0 37.0 76-77 35.66625 37.0 37.0 37.0 37.0 37.0 78-79 35.649 37.0 37.0 37.0 37.0 37.0 80-81 35.502250000000004 37.0 37.0 37.0 37.0 37.0 82-83 35.60625 37.0 37.0 37.0 37.0 37.0 84-85 35.58025 37.0 37.0 37.0 37.0 37.0 86-87 35.73225 37.0 37.0 37.0 37.0 37.0 88-89 35.69199999999999 37.0 37.0 37.0 37.0 37.0 90-91 35.6445 37.0 37.0 37.0 37.0 37.0 92-93 35.667500000000004 37.0 37.0 37.0 37.0 37.0 94-95 35.670249999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.64575 37.0 37.0 37.0 37.0 37.0 98-99 35.6565 37.0 37.0 37.0 37.0 37.0 100-101 35.63775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 0.0 17 3.0 18 5.0 19 5.0 20 5.0 21 17.0 22 9.0 23 13.0 24 11.0 25 9.0 26 10.0 27 20.0 28 19.0 29 34.0 30 30.0 31 36.0 32 60.0 33 95.0 34 152.0 35 413.0 36 2350.0 37 701.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.3 17.075000000000003 12.4 28.225 2 26.400000000000002 22.95 25.85 24.8 3 26.25 22.625 26.150000000000002 24.975 4 29.549999999999997 27.200000000000003 18.3 24.95 5 31.075000000000003 29.225 18.65 21.05 6 24.125 33.925 19.25 22.7 7 25.775 18.825 30.65 24.75 8 24.825 21.224999999999998 23.799999999999997 30.15 9 25.825 22.5 24.55 27.125 10-11 28.6125 26.974999999999998 19.2625 25.15 12-13 29.5875 21.3 23.2125 25.900000000000002 14-15 27.6125 25.1 23.0875 24.2 16-17 28.325 23.5875 22.575 25.5125 18-19 28.625 24.1875 22.7625 24.425 20-21 27.3 24.7875 22.35 25.5625 22-23 28.4 24.6125 21.475 25.5125 24-25 27.125 24.6875 22.8 25.387500000000003 26-27 28.1625 23.8625 22.3625 25.6125 28-29 28.525 23.7875 21.912499999999998 25.775 30-31 27.9125 23.375 22.912499999999998 25.8 32-33 26.387500000000003 24.5375 22.8375 26.237500000000004 34-35 28.1125 23.75 22.5625 25.575 36-37 28.212500000000002 23.549999999999997 22.25 25.9875 38-39 27.650000000000002 24.1875 22.037499999999998 26.125 40-41 27.725 25.2375 21.55 25.4875 42-43 27.9375 24.625 22.575 24.8625 44-45 27.737499999999997 23.9125 22.3375 26.0125 46-47 28.1125 24.5125 22.55 24.825 48-49 28.050000000000004 23.9 22.1375 25.912499999999998 50-51 26.974999999999998 23.95 22.225 26.85 52-53 28.499999999999996 24.2 21.6875 25.6125 54-55 27.737499999999997 23.799999999999997 22.5 25.9625 56-57 27.3125 24.1625 22.6 25.924999999999997 58-59 27.3875 24.099999999999998 22.237499999999997 26.275 60-61 28.3375 23.3875 22.925 25.35 62-63 28.487499999999997 23.7125 22.525000000000002 25.275 64-65 29.0875 23.8625 22.162499999999998 24.887500000000003 66-67 29.0875 24.5 21.5 24.9125 68-69 28.050000000000004 24.275 22.475 25.2 70-71 28.9375 24.4125 22.6125 24.0375 72-73 28.4375 23.9875 22.8625 24.712500000000002 74-75 27.9125 24.0 23.2375 24.85 76-77 29.099999999999998 23.4625 22.625 24.8125 78-79 28.9 24.325 21.7875 24.9875 80-81 29.25 24.7375 22.112499999999997 23.9 82-83 29.025000000000002 23.5 22.6375 24.837500000000002 84-85 29.2875 24.212500000000002 22.875 23.625 86-87 28.925 24.875 21.6625 24.5375 88-89 28.775000000000002 24.55 21.7 24.975 90-91 30.112499999999997 23.6625 21.625 24.6 92-93 28.5875 24.875 22.4875 24.05 94-95 29.7375 24.8625 20.9875 24.4125 96-97 29.275000000000002 24.837500000000002 21.099999999999998 24.7875 98-99 28.575 24.95 22.975 23.5 100-101 29.125 25.0375 22.0125 23.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.5 13 1.5 14 0.5 15 0.0 16 1.0 17 2.5 18 1.5 19 0.5 20 1.0 21 2.0 22 1.5 23 0.0 24 0.0 25 1.0 26 2.0 27 1.0 28 0.0 29 2.0 30 3.0 31 1.5 32 4.0 33 6.5 34 8.5 35 14.0 36 21.5 37 29.5 38 41.5 39 55.0 40 63.5 41 76.0 42 94.0 43 120.5 44 146.5 45 154.0 46 156.0 47 166.0 48 173.0 49 176.0 50 155.5 51 145.5 52 153.0 53 153.5 54 147.5 55 139.5 56 135.0 57 118.0 58 114.0 59 96.0 60 82.0 61 85.5 62 72.5 63 63.5 64 65.5 65 78.0 66 79.0 67 73.0 68 77.0 69 72.0 70 60.0 71 48.5 72 39.0 73 42.0 74 42.0 75 27.5 76 19.0 77 13.0 78 9.0 79 7.5 80 7.5 81 8.5 82 5.0 83 2.5 84 3.0 85 2.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 1.0 96 1.5 97 0.5 98 1.0 99 1.0 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.37552981068099 79.07499999999999 2 9.155128567391918 16.2 3 1.186775925402656 3.15 4 0.16953941791466515 0.6 5 0.028256569652444195 0.125 6 0.0 0.0 7 0.028256569652444195 0.17500000000000002 8 0.028256569652444195 0.2 9 0.0 0.0 >10 0.028256569652444195 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit GTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTATATAGCC 8 0.2 No Hit GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 7 0.17500000000000002 No Hit TTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0625 0.0 0.0 0.0 0.0 42-43 0.1125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.16249999999999998 0.0 0.0 0.0 0.0 48-49 0.21250000000000002 0.0 0.0 0.0 0.0 50-51 0.2375 0.0 0.0 0.0 0.0 52-53 0.30000000000000004 0.0 0.0 0.0 0.0 54-55 0.5 0.0 0.0 0.0 0.0 56-57 0.6375 0.0 0.0 0.0 0.0 58-59 0.8 0.0 0.0 0.0 0.0 60-61 0.9624999999999999 0.0 0.0 0.0 0.0 62-63 1.15 0.0 0.0 0.0 0.0 64-65 1.3875000000000002 0.0 0.0 0.0 0.0 66-67 1.6 0.0 0.0 0.0 0.0 68-69 1.9125 0.0 0.0 0.0 0.0 70-71 2.175 0.0 0.0 0.0 0.0 72-73 2.4625 0.0 0.0 0.0 0.0 74-75 2.6500000000000004 0.0 0.0 0.0 0.0 76-77 3.0375 0.0 0.0 0.0 0.0 78-79 3.475 0.0 0.0 0.0 0.0 80-81 3.8625000000000003 0.0 0.0 0.0 0.0 82-83 4.4 0.0 0.0 0.0 0.0 84-85 5.050000000000001 0.0 0.0 0.0 0.0 86-87 5.625 0.0 0.0 0.0 0.0 88-89 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012095 spots for ERR3450067.sra Written 1012095 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra Read 1012090 spots for ERR3450067.sra Written 1012090 spots for ERR3450067.sra SRR ids: ['ERR3450067.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jt1q55mj ERR3450067.sra spots: 20241805 blocks: [[1, 1012090], [1012091, 2024180], [2024181, 3036270], [3036271, 4048360], [4048361, 5060450], [5060451, 6072540], [6072541, 7084630], [7084631, 8096720], [8096721, 9108810], [9108811, 10120900], [10120901, 11132990], [11132991, 12145080], [12145081, 13157170], [13157171, 14169260], [14169261, 15181350], [15181351, 16193440], [16193441, 17205530], [17205531, 18217620], [18217621, 19229710], [19229711, 20241805]] ERR3450067 file size 4860844 ERR3450067 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450067 ERR3450067_1.fastq ERR3450067_2.fastq Input file: ERR3450067_1.fastq Paired file: ERR3450067_2.fastq trimmed: ERR3450067-trimmed-pair1.fastq, ERR3450067-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:13:33 2024 >> started Thu Dec 12 02:13:52 2024 >> done (18.906s) 20241805 read pairs processed; of these: 171 ( 0.00%) short read pairs filtered out after trimming by size control 58057 ( 0.29%) empty read pairs filtered out after trimming by size control 20183577 (99.71%) read pairs available; of these: 2319582 (11.49%) trimmed read pairs available after processing 17863995 (88.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 55 0.00% 20 198 0.00% 21 435 0.00% 22 571 0.00% 23 278 0.00% 24 294 0.00% 25 385 0.00% 26 521 0.00% 27 703 0.00% 28 1040 0.01% 29 1369 0.01% 30 1736 0.01% 31 2086 0.01% 32 2168 0.01% 33 2027 0.01% 34 2155 0.01% 35 2079 0.01% 36 2292 0.01% 37 2597 0.01% 38 3034 0.02% 39 3511 0.02% 40 4081 0.02% 41 4877 0.02% 42 5354 0.03% 43 5784 0.03% 44 5127 0.03% 45 5081 0.03% 46 5565 0.03% 47 6219 0.03% 48 6696 0.03% 49 7392 0.04% 50 8364 0.04% 51 9498 0.05% 52 10518 0.05% 53 10941 0.05% 54 11513 0.06% 55 12064 0.06% 56 12502 0.06% 57 13170 0.07% 58 14528 0.07% 59 15566 0.08% 60 16906 0.08% 61 18864 0.09% 62 20460 0.10% 63 22157 0.11% 64 22801 0.11% 65 24054 0.12% 66 24986 0.12% 67 26242 0.13% 68 27455 0.14% 69 28402 0.14% 70 30862 0.15% 71 33011 0.16% 72 35455 0.18% 73 37257 0.18% 74 38640 0.19% 75 40270 0.20% 76 41763 0.21% 77 42812 0.21% 78 44725 0.22% 79 46665 0.23% 80 48234 0.24% 81 51000 0.25% 82 52851 0.26% 83 55244 0.27% 84 57534 0.29% 85 59902 0.30% 86 61428 0.30% 87 63309 0.31% 88 65761 0.33% 89 67379 0.33% 90 69607 0.34% 91 73345 0.36% 92 76154 0.38% 93 78956 0.39% 94 81049 0.40% 95 82935 0.41% 96 84702 0.42% 97 86791 0.43% 98 88324 0.44% 99 89282 0.44% 100 97602 0.48% 101 17863995 88.51% 20183577 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=1.9 sequence=TTTCCTCTGGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=214.91 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=23.0 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=1.9 sequence=CAAGTGTTGGATT criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=256.95 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=23.3 sequence=CGGCGGCGGCGC ERR3450067 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:14:25 Started mapping on | Dec 12 02:14:25 Finished on | Dec 12 02:16:13 Mapping speed, Million of reads per hour | 672.79 Number of input reads | 20183577 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 14583579 Uniquely mapped reads % | 72.25% Average mapped length | 197.24 Number of splices: Total | 8636448 Number of splices: Annotated (sjdb) | 8184445 Number of splices: GT/AG | 8523662 Number of splices: GC/AG | 96955 Number of splices: AT/AC | 5549 Number of splices: Non-canonical | 10282 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 931677 % of reads mapped to multiple loci | 4.62% Number of reads mapped to too many loci | 811813 % of reads mapped to too many loci | 4.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 15.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4668321 4668321 4668321 N_multimapping 931677 931677 931677 N_noFeature 463666 14018601 822230 N_ambiguous 247172 2179 42285 UnstrandedReadsAssigned:13872741 PositiveStrandReadsAssigned:562799 NegativeStrandReadsAssigned:13719064 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450067 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450067-trimmed-pair1.fastq ERR3450067-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,183,577 reads, 14,387,385 reads pseudoaligned [quant] estimated average fragment length: 180.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 ERR3450067.ke.tsv 35125 ERR3450067.se.tsv 88098 total ==> ERR3450067.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.175 1.52799 0.210931 PNS24247 1044 864.958 31.2907 3.78127 PNS24249 1928 1748.96 224.666 13.4269 PNS24246 1044 864.958 31.2907 3.78127 PNS24248 1044 864.958 31.2907 3.78127 PNS24244 1471 1291.96 18.9343 1.53185 PNS24243 293 133.327 0 0 KQK14069 1603 1423.96 6034.93 442.988 KQK14071 474 298.492 257.76 90.2611 ==> ERR3450067.se.tsv <== BRADI_1g14170v3 6404 BRADI_1g53295v3 34 BRADI_1g59795v3 101 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1273 BRADI_1g74790v3 115 BRADI_1g09890v3 26 BRADI_1g77505v3 140 BRADI_1g48960v3 0 ERR3450067 completed mapping pipeline successfully