Starting /dee2/code/volunteer_pipeline.sh ERR3450068 current disk space = 1543001227264 free memory = 1603224656 ERR3450068 SRAfilesize dde915cc5933c7ed8594b67df253d896 ERR3450068.sra ERR3450068.sra file validated ERR3450068 is paired end ERR3450068 is conventional basespace ERR3450068 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450068_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.964 37.0 37.0 37.0 37.0 37.0 2 36.384 37.0 37.0 37.0 37.0 37.0 3 36.415 37.0 37.0 37.0 37.0 37.0 4 36.4415 37.0 37.0 37.0 37.0 37.0 5 36.4615 37.0 37.0 37.0 37.0 37.0 6 36.5135 37.0 37.0 37.0 37.0 37.0 7 36.423 37.0 37.0 37.0 37.0 37.0 8 36.4455 37.0 37.0 37.0 37.0 37.0 9 36.5165 37.0 37.0 37.0 37.0 37.0 10-11 36.467749999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.47175 37.0 37.0 37.0 37.0 37.0 14-15 36.48175 37.0 37.0 37.0 37.0 37.0 16-17 36.476749999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.451499999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.45425 37.0 37.0 37.0 37.0 37.0 22-23 36.4785 37.0 37.0 37.0 37.0 37.0 24-25 36.471000000000004 37.0 37.0 37.0 37.0 37.0 26-27 36.3795 37.0 37.0 37.0 37.0 37.0 28-29 36.3905 37.0 37.0 37.0 37.0 37.0 30-31 36.319 37.0 37.0 37.0 37.0 37.0 32-33 36.275999999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.175 37.0 37.0 37.0 37.0 37.0 36-37 36.32475 37.0 37.0 37.0 37.0 37.0 38-39 36.379000000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.333 37.0 37.0 37.0 37.0 37.0 42-43 36.29175 37.0 37.0 37.0 37.0 37.0 44-45 36.175749999999994 37.0 37.0 37.0 37.0 37.0 46-47 36.119 37.0 37.0 37.0 37.0 37.0 48-49 36.230999999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.16275 37.0 37.0 37.0 37.0 37.0 52-53 36.13849999999999 37.0 37.0 37.0 37.0 37.0 54-55 35.98925 37.0 37.0 37.0 37.0 37.0 56-57 36.07925 37.0 37.0 37.0 37.0 37.0 58-59 35.98625 37.0 37.0 37.0 37.0 37.0 60-61 35.91525 37.0 37.0 37.0 37.0 37.0 62-63 35.997749999999996 37.0 37.0 37.0 37.0 37.0 64-65 35.94975 37.0 37.0 37.0 37.0 37.0 66-67 35.95725 37.0 37.0 37.0 37.0 37.0 68-69 36.012249999999995 37.0 37.0 37.0 37.0 37.0 70-71 35.834 37.0 37.0 37.0 37.0 37.0 72-73 35.684749999999994 37.0 37.0 37.0 37.0 37.0 74-75 36.047 37.0 37.0 37.0 37.0 37.0 76-77 36.0065 37.0 37.0 37.0 37.0 37.0 78-79 35.997249999999994 37.0 37.0 37.0 37.0 37.0 80-81 36.071749999999994 37.0 37.0 37.0 37.0 37.0 82-83 35.99725 37.0 37.0 37.0 37.0 37.0 84-85 35.972750000000005 37.0 37.0 37.0 37.0 37.0 86-87 35.9945 37.0 37.0 37.0 37.0 37.0 88-89 35.93875 37.0 37.0 37.0 37.0 37.0 90-91 36.014250000000004 37.0 37.0 37.0 37.0 37.0 92-93 35.8585 37.0 37.0 37.0 37.0 37.0 94-95 35.929249999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.796 37.0 37.0 37.0 37.0 37.0 98-99 35.917249999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.82025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 3.0 24 3.0 25 12.0 26 15.0 27 19.0 28 32.0 29 32.0 30 40.0 31 54.0 32 71.0 33 84.0 34 109.0 35 194.0 36 1769.0 37 1559.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.23653749370911 9.511826874685456 10.870659285354806 39.38097634625063 2 20.925 14.000000000000002 29.875 35.199999999999996 3 20.95 17.95 25.6 35.5 4 27.05 23.474999999999998 17.825 31.65 5 26.6 28.349999999999998 21.425 23.625 6 24.55 30.3 22.7 22.45 7 20.95 23.95 35.675000000000004 19.425 8 22.025 21.224999999999998 28.425 28.325 9 22.075 21.25 31.175000000000004 25.5 10-11 23.75 28.812500000000004 23.0375 24.4 12-13 23.674999999999997 22.6 26.3125 27.4125 14-15 22.95 25.974999999999998 25.587500000000002 25.4875 16-17 23.6625 24.65 24.887500000000003 26.8 18-19 24.3625 24.224999999999998 26.0375 25.374999999999996 20-21 24.25 25.575 24.3125 25.8625 22-23 24.9125 24.5125 24.337500000000002 26.237500000000004 24-25 24.6 24.837500000000002 24.275 26.2875 26-27 24.462500000000002 24.3125 25.4375 25.7875 28-29 24.2625 23.825 24.5625 27.35 30-31 23.974999999999998 23.849999999999998 24.75 27.425 32-33 24.1875 24.2875 24.637500000000003 26.887499999999996 34-35 24.462500000000002 24.587500000000002 24.8125 26.137500000000003 36-37 25.3125 23.400000000000002 24.15 27.1375 38-39 25.05 24.0125 24.6625 26.275 40-41 25.2625 24.325 23.8625 26.55 42-43 25.2125 24.4125 23.9 26.474999999999998 44-45 23.7625 24.25 25.637500000000003 26.35 46-47 25.2375 24.712500000000002 23.9875 26.0625 48-49 24.6625 24.212500000000002 24.9125 26.2125 50-51 23.9375 25.137500000000003 24.3 26.625 52-53 25.2875 24.9375 23.1375 26.637499999999996 54-55 24.5125 24.325 24.025 27.1375 56-57 24.6 23.875 24.625 26.900000000000002 58-59 24.4875 23.4875 24.1375 27.8875 60-61 24.6875 23.1625 24.925 27.224999999999998 62-63 24.887500000000003 24.712500000000002 23.075000000000003 27.325 64-65 24.349999999999998 24.4375 25.0375 26.174999999999997 66-67 24.8125 24.712500000000002 23.549999999999997 26.924999999999997 68-69 24.7 24.925 23.575 26.8 70-71 25.162499999999998 24.2875 23.7875 26.7625 72-73 25.0 24.6 23.974999999999998 26.424999999999997 74-75 25.650000000000002 24.375 23.2375 26.737499999999997 76-77 26.3 24.1625 23.175 26.3625 78-79 25.650000000000002 25.15 23.0 26.200000000000003 80-81 25.924999999999997 24.5125 23.175 26.387500000000003 82-83 26.200000000000003 23.875 24.025 25.900000000000002 84-85 25.5625 24.3 23.9875 26.150000000000002 86-87 23.7375 25.2625 24.075 26.924999999999997 88-89 24.95 24.474999999999998 23.125 27.450000000000003 90-91 25.7375 25.374999999999996 22.6375 26.25 92-93 25.825 24.8625 23.0125 26.3 94-95 26.0125 24.837500000000002 22.7 26.450000000000003 96-97 25.0625 24.099999999999998 23.1125 27.725 98-99 24.587500000000002 24.9875 23.474999999999998 26.950000000000003 100-101 26.2875 24.474999999999998 23.0375 26.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 9.0 2 2.5 3 1.0 4 1.0 5 2.0 6 1.5 7 1.0 8 1.5 9 2.5 10 3.0 11 1.5 12 1.0 13 0.5 14 0.0 15 0.5 16 2.0 17 1.5 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 3.5 28 3.0 29 2.5 30 1.5 31 3.5 32 8.0 33 7.5 34 10.0 35 17.0 36 29.0 37 35.0 38 40.5 39 64.0 40 85.0 41 93.0 42 111.5 43 132.0 44 139.0 45 153.0 46 170.0 47 186.5 48 187.0 49 186.5 50 179.5 51 157.0 52 163.0 53 171.0 54 152.5 55 141.5 56 136.0 57 112.5 58 104.0 59 100.0 60 77.5 61 63.5 62 63.0 63 67.0 64 69.0 65 70.5 66 66.0 67 54.5 68 49.5 69 47.5 70 35.0 71 33.0 72 39.0 73 30.0 74 20.5 75 12.5 76 9.5 77 11.0 78 11.5 79 12.0 80 8.5 81 6.5 82 4.5 83 2.5 84 1.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.76620825147347 80.85 2 7.465618860510806 13.3 3 1.2068481616615212 3.225 4 0.36486107213022734 1.3 5 0.11226494527083919 0.5 6 0.0 0.0 7 0.028066236317709797 0.17500000000000002 8 0.0 0.0 9 0.028066236317709797 0.22499999999999998 >10 0.028066236317709797 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 17 0.42500000000000004 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 3 (97% over 36bp) CCTCACGGTACTACTTCGCTATCGGTCACCCAGGAGTATTTAGCCTTGCA 5 0.125 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 5 0.125 No Hit GGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTC 5 0.125 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.21250000000000002 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.3625 0.0 0.0 0.0 0.0 42-43 0.3875 0.0 0.0 0.0 0.0 44-45 0.5125 0.0 0.0 0.0 0.0 46-47 0.6 0.0 0.0 0.0 0.0 48-49 0.7375 0.0 0.0 0.0 0.0 50-51 0.8374999999999999 0.0 0.0 0.0 0.0 52-53 0.9125 0.0 0.0 0.0 0.0 54-55 1.1375000000000002 0.0 0.0 0.0 0.0 56-57 1.3625 0.0 0.0 0.0 0.0 58-59 1.5375 0.0 0.0 0.0 0.0 60-61 1.7875 0.0 0.0 0.0 0.0 62-63 2.225 0.0 0.0 0.0 0.0 64-65 2.5999999999999996 0.0 0.0 0.0 0.0 66-67 2.7750000000000004 0.0 0.0 0.0 0.0 68-69 3.1125 0.0 0.0 0.0 0.0 70-71 3.4749999999999996 0.0 0.0 0.0 0.0 72-73 3.9 0.0 0.0 0.0 0.0 74-75 4.3375 0.0 0.0 0.0 0.0 76-77 4.775 0.0 0.0 0.0 0.0 78-79 5.4 0.0 0.0 0.0 0.0 80-81 5.975 0.0 0.0 0.0 0.0 82-83 6.4125 0.0 0.0 0.0 0.0 84-85 7.0875 0.0 0.0 0.0 0.0 86-87 7.6 0.0 0.0 0.0 0.0 88-89 8.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450068 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450068_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2015 37.0 37.0 37.0 37.0 37.0 2 36.0155 37.0 37.0 37.0 37.0 37.0 3 36.114 37.0 37.0 37.0 37.0 37.0 4 36.0155 37.0 37.0 37.0 37.0 37.0 5 36.2895 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 36.1645 37.0 37.0 37.0 37.0 37.0 8 36.1705 37.0 37.0 37.0 37.0 37.0 9 36.222 37.0 37.0 37.0 37.0 37.0 10-11 36.0735 37.0 37.0 37.0 37.0 37.0 12-13 36.1135 37.0 37.0 37.0 37.0 37.0 14-15 36.066 37.0 37.0 37.0 37.0 37.0 16-17 36.06 37.0 37.0 37.0 37.0 37.0 18-19 36.1005 37.0 37.0 37.0 37.0 37.0 20-21 35.9845 37.0 37.0 37.0 37.0 37.0 22-23 36.03325 37.0 37.0 37.0 37.0 37.0 24-25 35.9105 37.0 37.0 37.0 37.0 37.0 26-27 35.85925 37.0 37.0 37.0 37.0 37.0 28-29 35.79 37.0 37.0 37.0 37.0 37.0 30-31 35.866749999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.7565 37.0 37.0 37.0 37.0 37.0 34-35 35.692 37.0 37.0 37.0 37.0 37.0 36-37 35.63775 37.0 37.0 37.0 37.0 37.0 38-39 35.638 37.0 37.0 37.0 37.0 37.0 40-41 35.5485 37.0 37.0 37.0 37.0 37.0 42-43 35.682 37.0 37.0 37.0 37.0 37.0 44-45 35.619749999999996 37.0 37.0 37.0 37.0 37.0 46-47 35.67475 37.0 37.0 37.0 37.0 37.0 48-49 35.67275 37.0 37.0 37.0 37.0 37.0 50-51 35.68275 37.0 37.0 37.0 37.0 37.0 52-53 35.786 37.0 37.0 37.0 37.0 37.0 54-55 35.74025 37.0 37.0 37.0 37.0 37.0 56-57 35.72575 37.0 37.0 37.0 37.0 37.0 58-59 35.81175 37.0 37.0 37.0 37.0 37.0 60-61 35.8485 37.0 37.0 37.0 37.0 37.0 62-63 35.7965 37.0 37.0 37.0 37.0 37.0 64-65 35.79875 37.0 37.0 37.0 37.0 37.0 66-67 35.720749999999995 37.0 37.0 37.0 37.0 37.0 68-69 35.71 37.0 37.0 37.0 37.0 37.0 70-71 35.638000000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.6625 37.0 37.0 37.0 37.0 37.0 74-75 35.552 37.0 37.0 37.0 37.0 37.0 76-77 35.4795 37.0 37.0 37.0 37.0 37.0 78-79 35.412 37.0 37.0 37.0 37.0 37.0 80-81 35.33775 37.0 37.0 37.0 37.0 37.0 82-83 35.51575 37.0 37.0 37.0 37.0 37.0 84-85 35.4845 37.0 37.0 37.0 37.0 37.0 86-87 35.42275 37.0 37.0 37.0 37.0 37.0 88-89 35.48975 37.0 37.0 37.0 37.0 37.0 90-91 35.47875 37.0 37.0 37.0 37.0 37.0 92-93 35.54275 37.0 37.0 37.0 37.0 37.0 94-95 35.494 37.0 37.0 37.0 37.0 37.0 96-97 35.482749999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.3845 37.0 37.0 37.0 37.0 37.0 100-101 35.3705 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 4.0 17 7.0 18 5.0 19 5.0 20 10.0 21 13.0 22 6.0 23 8.0 24 9.0 25 20.0 26 16.0 27 20.0 28 24.0 29 33.0 30 35.0 31 47.0 32 67.0 33 89.0 34 155.0 35 360.0 36 2317.0 37 747.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125 16.7 13.100000000000001 29.075 2 26.75 24.099999999999998 25.35 23.799999999999997 3 26.775 23.674999999999997 25.174999999999997 24.375 4 29.549999999999997 26.400000000000002 18.85 25.2 5 29.475 29.225 19.475 21.825 6 23.9 32.0 20.849999999999998 23.25 7 26.375 18.875 30.349999999999998 24.4 8 24.95 20.775 22.900000000000002 31.374999999999996 9 27.725 22.075 24.175 26.025 10-11 28.349999999999998 27.025 19.7375 24.887500000000003 12-13 29.825000000000003 20.8125 23.549999999999997 25.8125 14-15 26.85 24.925 23.2625 24.962500000000002 16-17 28.512500000000003 23.9375 22.2125 25.337500000000002 18-19 28.5875 24.925 21.95 24.5375 20-21 27.400000000000002 25.587500000000002 22.650000000000002 24.3625 22-23 27.5625 23.8375 23.150000000000002 25.45 24-25 27.650000000000002 24.5375 22.45 25.362499999999997 26-27 27.4125 25.162499999999998 23.425 24.0 28-29 27.5875 24.575 22.8875 24.95 30-31 27.0625 23.0875 23.6375 26.2125 32-33 27.8625 23.575 23.05 25.5125 34-35 27.787499999999998 24.125 23.425 24.6625 36-37 27.6125 23.875 23.2125 25.3 38-39 27.474999999999998 23.7 23.8625 24.962500000000002 40-41 28.349999999999998 24.05 23.35 24.25 42-43 27.35 24.1875 22.7 25.7625 44-45 27.3375 23.6375 23.974999999999998 25.05 46-47 28.1875 23.2375 22.7125 25.8625 48-49 26.7125 24.375 23.275000000000002 25.637500000000003 50-51 27.175 25.124999999999996 23.2125 24.4875 52-53 27.037499999999998 25.05 23.075000000000003 24.837500000000002 54-55 28.925 23.6625 22.3625 25.05 56-57 26.474999999999998 25.15 23.9 24.474999999999998 58-59 28.1 24.4375 22.125 25.337500000000002 60-61 28.5625 23.7125 22.4625 25.2625 62-63 28.7 24.2625 22.7 24.337500000000002 64-65 28.549999999999997 24.375 22.650000000000002 24.425 66-67 27.237499999999997 24.275 22.45 26.0375 68-69 29.1875 24.099999999999998 23.3125 23.400000000000002 70-71 28.3875 24.7375 23.200000000000003 23.674999999999997 72-73 27.925 24.625 22.2625 25.1875 74-75 29.299999999999997 25.15 22.8875 22.662499999999998 76-77 28.749999999999996 24.525 22.8 23.925 78-79 28.4 24.5375 22.787499999999998 24.275 80-81 27.8875 25.5125 23.025000000000002 23.575 82-83 28.4375 24.1875 23.45 23.925 84-85 29.575000000000003 23.5125 22.85 24.0625 86-87 28.787499999999998 24.3875 22.787499999999998 24.0375 88-89 29.212500000000002 24.5375 22.7 23.549999999999997 90-91 30.425 23.962500000000002 22.825 22.787499999999998 92-93 30.525000000000002 24.762500000000003 21.9 22.8125 94-95 30.3 23.925 22.237499999999997 23.5375 96-97 29.912499999999998 24.7875 21.9375 23.3625 98-99 29.9375 24.25 22.7375 23.075000000000003 100-101 30.225 25.4875 22.1 22.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.5 8 2.5 9 2.0 10 0.5 11 1.0 12 2.5 13 1.5 14 0.5 15 0.5 16 0.5 17 2.5 18 3.5 19 1.5 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 1.5 26 1.5 27 1.0 28 1.5 29 1.0 30 1.0 31 3.5 32 7.0 33 8.5 34 9.0 35 13.0 36 15.0 37 29.5 38 45.5 39 56.5 40 80.0 41 94.0 42 108.0 43 130.0 44 146.0 45 166.0 46 170.0 47 166.5 48 166.5 49 167.5 50 167.5 51 147.0 52 144.0 53 161.5 54 152.0 55 132.0 56 125.0 57 113.0 58 92.5 59 87.5 60 86.5 61 86.5 62 88.5 63 74.0 64 74.0 65 71.5 66 57.0 67 53.5 68 65.5 69 69.5 70 51.5 71 46.5 72 48.0 73 35.0 74 27.5 75 23.0 76 14.5 77 13.0 78 12.5 79 7.0 80 5.0 81 5.5 82 4.0 83 3.0 84 2.0 85 2.0 86 2.5 87 2.0 88 1.0 89 1.0 90 1.5 91 1.0 92 0.0 93 0.5 94 0.5 95 2.0 96 2.5 97 0.5 98 0.0 99 2.5 100 10.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.56526548672566 82.775 2 7.273230088495575 13.15 3 0.7466814159292036 2.025 4 0.22123893805309736 0.8 5 0.08296460176991151 0.375 6 0.02765486725663717 0.15 7 0.02765486725663717 0.17500000000000002 8 0.02765486725663717 0.2 9 0.0 0.0 >10 0.02765486725663717 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 8 0.2 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 7 0.17500000000000002 No Hit CTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCG 6 0.15 No Hit GTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAA 5 0.125 No Hit GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 5 0.125 No Hit AGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.21250000000000002 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.3625 0.0 0.0 0.0 0.0 42-43 0.3875 0.0 0.0 0.0 0.0 44-45 0.5125 0.0 0.0 0.0 0.0 46-47 0.6 0.0 0.0 0.0 0.0 48-49 0.7375 0.0 0.0 0.0 0.0 50-51 0.8374999999999999 0.0 0.0 0.0 0.0 52-53 0.9125 0.0 0.0 0.0 0.0 54-55 1.1124999999999998 0.0 0.0 0.0 0.0 56-57 1.3375 0.0 0.0 0.0 0.0 58-59 1.5125000000000002 0.0 0.0 0.0 0.0 60-61 1.775 0.0 0.0 0.0 0.0 62-63 2.25 0.0 0.0 0.0 0.0 64-65 2.6375 0.0 0.0 0.0 0.0 66-67 2.825 0.0 0.0 0.0 0.0 68-69 3.1624999999999996 0.0 0.0 0.0 0.0 70-71 3.5250000000000004 0.0 0.0 0.0 0.0 72-73 3.95 0.0 0.0 0.0 0.0 74-75 4.3625 0.0 0.0 0.0 0.0 76-77 4.800000000000001 0.0 0.0 0.0 0.0 78-79 5.45 0.0 0.0 0.0 0.0 80-81 6.0 0.0 0.0 0.0 0.0 82-83 6.45 0.0 0.0 0.0 0.0 84-85 7.1 0.0 0.0 0.0 0.0 86-87 7.625 0.0 0.0 0.0 0.0 88-89 8.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATGAA 15 0.009957196 47.5 18-19 >>END_MODULE Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671885 spots for ERR3450068.sra Written 1671885 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra Read 1671867 spots for ERR3450068.sra Written 1671867 spots for ERR3450068.sra SRR ids: ['ERR3450068.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dy94ywfs ERR3450068.sra spots: 33437358 blocks: [[1, 1671867], [1671868, 3343734], [3343735, 5015601], [5015602, 6687468], [6687469, 8359335], [8359336, 10031202], [10031203, 11703069], [11703070, 13374936], [13374937, 15046803], [15046804, 16718670], [16718671, 18390537], [18390538, 20062404], [20062405, 21734271], [21734272, 23406138], [23406139, 25078005], [25078006, 26749872], [26749873, 28421739], [28421740, 30093606], [30093607, 31765473], [31765474, 33437358]] ERR3450068 file size 8043756 ERR3450068 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450068 ERR3450068_1.fastq ERR3450068_2.fastq Input file: ERR3450068_1.fastq Paired file: ERR3450068_2.fastq trimmed: ERR3450068-trimmed-pair1.fastq, ERR3450068-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:33:28 2024 >> started Sat Dec 7 14:33:56 2024 >> done (28.053s) 33437358 read pairs processed; of these: 310 ( 0.00%) short read pairs filtered out after trimming by size control 93610 ( 0.28%) empty read pairs filtered out after trimming by size control 33343438 (99.72%) read pairs available; of these: 3987636 (11.96%) trimmed read pairs available after processing 29355802 (88.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 67 0.00% 19 152 0.00% 20 389 0.00% 21 988 0.00% 22 1121 0.00% 23 525 0.00% 24 558 0.00% 25 690 0.00% 26 1046 0.00% 27 1492 0.00% 28 1999 0.01% 29 2693 0.01% 30 3119 0.01% 31 3985 0.01% 32 4070 0.01% 33 3963 0.01% 34 3910 0.01% 35 3926 0.01% 36 4393 0.01% 37 4699 0.01% 38 5617 0.02% 39 6539 0.02% 40 7512 0.02% 41 9054 0.03% 42 10206 0.03% 43 10499 0.03% 44 9670 0.03% 45 9952 0.03% 46 10452 0.03% 47 11611 0.03% 48 12622 0.04% 49 14242 0.04% 50 15959 0.05% 51 17557 0.05% 52 19291 0.06% 53 20086 0.06% 54 21102 0.06% 55 22307 0.07% 56 23197 0.07% 57 23953 0.07% 58 26260 0.08% 59 28616 0.09% 60 30740 0.09% 61 33713 0.10% 62 37208 0.11% 63 39786 0.12% 64 41318 0.12% 65 42695 0.13% 66 44650 0.13% 67 47044 0.14% 68 48762 0.15% 69 50732 0.15% 70 54086 0.16% 71 57655 0.17% 72 61351 0.18% 73 65161 0.20% 74 67716 0.20% 75 70147 0.21% 76 72377 0.22% 77 74261 0.22% 78 77117 0.23% 79 81106 0.24% 80 83425 0.25% 81 86788 0.26% 82 91234 0.27% 83 94238 0.28% 84 98167 0.29% 85 101783 0.31% 86 103710 0.31% 87 107744 0.32% 88 110991 0.33% 89 114926 0.34% 90 117875 0.35% 91 123945 0.37% 92 127661 0.38% 93 131056 0.39% 94 134718 0.40% 95 138515 0.42% 96 140508 0.42% 97 144488 0.43% 98 145592 0.44% 99 147673 0.44% 100 164885 0.49% 101 29355802 88.04% 33343438 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.31 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=165.00 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=21.0 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=2.0 sequence=AGCCAGAGGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=232.01 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=23.3 sequence=CGGCGGCGGCGC ERR3450068 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:34:30 Started mapping on | Dec 07 14:34:30 Finished on | Dec 07 14:36:57 Mapping speed, Million of reads per hour | 816.57 Number of input reads | 33343438 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 25269846 Uniquely mapped reads % | 75.79% Average mapped length | 196.90 Number of splices: Total | 15272863 Number of splices: Annotated (sjdb) | 14424786 Number of splices: GT/AG | 15071046 Number of splices: GC/AG | 174460 Number of splices: AT/AC | 8849 Number of splices: Non-canonical | 18508 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1704069 % of reads mapped to multiple loci | 5.11% Number of reads mapped to too many loci | 1111052 % of reads mapped to too many loci | 3.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 12.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6369523 6369523 6369523 N_multimapping 1704069 1704069 1704069 N_noFeature 847651 24302114 1435897 N_ambiguous 462888 3612 87469 UnstrandedReadsAssigned:23959307 PositiveStrandReadsAssigned:964120 NegativeStrandReadsAssigned:23746480 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450068 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450068-trimmed-pair1.fastq ERR3450068-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,343,438 reads, 25,076,790 reads pseudoaligned [quant] estimated average fragment length: 180.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,293 rounds 52973 ERR3450068.ke.tsv 35125 ERR3450068.se.tsv 88098 total ==> ERR3450068.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 756.435 0 0 PNS24247 1044 864.158 52.9319 3.73601 PNS24249 1928 1748.16 305.619 10.6631 PNS24246 1044 864.158 52.9319 3.73601 PNS24248 1044 864.158 52.9319 3.73601 PNS24244 1471 1291.16 76.5848 3.61782 PNS24243 293 133.643 1 0.456392 KQK14069 1603 1423.16 17599.8 754.287 KQK14071 474 297.864 817.467 167.392 ==> ERR3450068.se.tsv <== BRADI_1g14170v3 18855 BRADI_1g53295v3 73 BRADI_1g59795v3 307 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 1719 BRADI_1g74790v3 269 BRADI_1g09890v3 32 BRADI_1g77505v3 351 BRADI_1g48960v3 0 ERR3450068 completed mapping pipeline successfully