Starting /dee2/code/volunteer_pipeline.sh ERR3450073 current disk space = 1543007928320 free memory = 1603160056 ERR3450073 SRAfilesize 70780632e7d1beb3caf66495ee0ac262 ERR3450073.sra ERR3450073.sra file validated ERR3450073 is paired end ERR3450073 is conventional basespace ERR3450073 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450073_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.01425 37.0 37.0 37.0 37.0 37.0 2 36.321 37.0 37.0 37.0 37.0 37.0 3 36.3215 37.0 37.0 37.0 37.0 37.0 4 36.494 37.0 37.0 37.0 37.0 37.0 5 36.517 37.0 37.0 37.0 37.0 37.0 6 36.4435 37.0 37.0 37.0 37.0 37.0 7 36.5175 37.0 37.0 37.0 37.0 37.0 8 36.5055 37.0 37.0 37.0 37.0 37.0 9 36.439 37.0 37.0 37.0 37.0 37.0 10-11 36.41475 37.0 37.0 37.0 37.0 37.0 12-13 36.54675 37.0 37.0 37.0 37.0 37.0 14-15 36.535 37.0 37.0 37.0 37.0 37.0 16-17 36.479749999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.49225 37.0 37.0 37.0 37.0 37.0 20-21 36.447 37.0 37.0 37.0 37.0 37.0 22-23 36.494 37.0 37.0 37.0 37.0 37.0 24-25 36.409 37.0 37.0 37.0 37.0 37.0 26-27 36.4505 37.0 37.0 37.0 37.0 37.0 28-29 36.405 37.0 37.0 37.0 37.0 37.0 30-31 36.3885 37.0 37.0 37.0 37.0 37.0 32-33 36.421 37.0 37.0 37.0 37.0 37.0 34-35 36.307500000000005 37.0 37.0 37.0 37.0 37.0 36-37 36.317 37.0 37.0 37.0 37.0 37.0 38-39 36.32925 37.0 37.0 37.0 37.0 37.0 40-41 36.311 37.0 37.0 37.0 37.0 37.0 42-43 36.3065 37.0 37.0 37.0 37.0 37.0 44-45 36.23075 37.0 37.0 37.0 37.0 37.0 46-47 36.135999999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.30625 37.0 37.0 37.0 37.0 37.0 50-51 36.194 37.0 37.0 37.0 37.0 37.0 52-53 36.185249999999996 37.0 37.0 37.0 37.0 37.0 54-55 36.20425 37.0 37.0 37.0 37.0 37.0 56-57 36.175749999999994 37.0 37.0 37.0 37.0 37.0 58-59 36.137 37.0 37.0 37.0 37.0 37.0 60-61 36.1285 37.0 37.0 37.0 37.0 37.0 62-63 36.085499999999996 37.0 37.0 37.0 37.0 37.0 64-65 36.09625 37.0 37.0 37.0 37.0 37.0 66-67 36.174 37.0 37.0 37.0 37.0 37.0 68-69 36.167249999999996 37.0 37.0 37.0 37.0 37.0 70-71 36.152 37.0 37.0 37.0 37.0 37.0 72-73 36.1155 37.0 37.0 37.0 37.0 37.0 74-75 36.14275 37.0 37.0 37.0 37.0 37.0 76-77 36.19225 37.0 37.0 37.0 37.0 37.0 78-79 36.0665 37.0 37.0 37.0 37.0 37.0 80-81 36.14775 37.0 37.0 37.0 37.0 37.0 82-83 36.04575 37.0 37.0 37.0 37.0 37.0 84-85 36.102500000000006 37.0 37.0 37.0 37.0 37.0 86-87 36.160250000000005 37.0 37.0 37.0 37.0 37.0 88-89 36.12525 37.0 37.0 37.0 37.0 37.0 90-91 36.12525 37.0 37.0 37.0 37.0 37.0 92-93 36.14675 37.0 37.0 37.0 37.0 37.0 94-95 36.14275 37.0 37.0 37.0 37.0 37.0 96-97 36.037 37.0 37.0 37.0 37.0 37.0 98-99 36.10725 37.0 37.0 37.0 37.0 37.0 100-101 36.015249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 7.0 25 12.0 26 13.0 27 17.0 28 27.0 29 30.0 30 32.0 31 39.0 32 70.0 33 76.0 34 109.0 35 173.0 36 1623.0 37 1770.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.42767295597484 10.264150943396226 11.79874213836478 37.50943396226415 2 22.525000000000002 14.649999999999999 26.950000000000003 35.875 3 21.224999999999998 18.7 24.9 35.175 4 28.775000000000002 23.275000000000002 16.900000000000002 31.05 5 27.750000000000004 28.050000000000004 20.825 23.375 6 23.05 30.45 24.175 22.325 7 20.424999999999997 23.5 35.625 20.45 8 21.925 21.95 28.625 27.500000000000004 9 22.775000000000002 20.7 30.975 25.55 10-11 23.9 28.349999999999998 22.8375 24.9125 12-13 24.1125 22.675 25.575 27.6375 14-15 24.0625 24.45 25.387500000000003 26.1 16-17 24.0125 24.3875 25.837500000000002 25.7625 18-19 24.7875 23.2125 26.087500000000002 25.912499999999998 20-21 25.0625 23.9875 24.625 26.325 22-23 24.85 24.762500000000003 23.7875 26.6 24-25 24.575 23.7875 25.1 26.5375 26-27 24.3875 24.575 23.2875 27.750000000000004 28-29 25.45 24.3 23.4875 26.7625 30-31 24.3 24.05 24.337500000000002 27.3125 32-33 24.9375 23.0375 24.4875 27.537499999999998 34-35 25.374999999999996 24.15 23.95 26.525 36-37 24.587500000000002 23.9125 24.2875 27.212500000000002 38-39 25.025 24.825 23.775 26.375 40-41 23.9125 24.675 24.025 27.3875 42-43 24.8 24.099999999999998 24.099999999999998 27.0 44-45 24.65 24.337500000000002 24.1125 26.900000000000002 46-47 25.587500000000002 23.849999999999998 24.1875 26.375 48-49 24.525 23.4375 24.8125 27.224999999999998 50-51 24.8125 24.3625 24.2375 26.5875 52-53 25.4875 23.5125 24.15 26.85 54-55 25.3 23.474999999999998 24.962500000000002 26.2625 56-57 25.55 23.1125 25.324999999999996 26.0125 58-59 24.4 24.1375 23.225 28.237499999999997 60-61 24.8 23.6125 24.4 27.187499999999996 62-63 25.15 23.1625 24.1125 27.575 64-65 25.1 23.849999999999998 24.3 26.75 66-67 24.65 23.9375 23.45 27.962500000000002 68-69 25.35 24.087500000000002 23.875 26.687499999999996 70-71 25.074999999999996 24.4375 24.212500000000002 26.275 72-73 25.662499999999998 23.95 23.5625 26.825 74-75 25.650000000000002 24.275 22.8375 27.237499999999997 76-77 26.075 25.624999999999996 23.25 25.05 78-79 25.2875 25.1 22.225 27.3875 80-81 25.324999999999996 23.4625 23.75 27.462500000000002 82-83 26.5875 24.275 22.287499999999998 26.85 84-85 26.674999999999997 23.6875 23.0375 26.6 86-87 25.15 24.349999999999998 23.849999999999998 26.650000000000002 88-89 25.4625 24.1125 23.3625 27.0625 90-91 24.837500000000002 24.8125 22.875 27.474999999999998 92-93 25.887500000000003 23.95 23.9125 26.25 94-95 24.7375 23.8875 24.5125 26.8625 96-97 25.1875 24.6875 23.2125 26.9125 98-99 26.0625 24.212500000000002 23.05 26.674999999999997 100-101 24.8 24.45 23.45 27.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 7.0 2 1.5 3 0.0 4 2.0 5 2.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.5 11 1.5 12 1.0 13 2.5 14 2.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 2.0 25 2.0 26 0.0 27 1.0 28 1.0 29 0.5 30 1.5 31 2.0 32 2.5 33 4.0 34 7.0 35 17.0 36 32.0 37 37.5 38 45.0 39 67.5 40 82.0 41 87.0 42 113.0 43 135.5 44 153.0 45 171.5 46 187.0 47 198.0 48 177.0 49 171.0 50 165.5 51 146.0 52 142.0 53 151.5 54 146.0 55 139.5 56 133.5 57 109.5 58 95.0 59 96.5 60 94.5 61 73.0 62 60.0 63 60.0 64 57.0 65 58.0 66 61.0 67 58.0 68 57.0 69 58.0 70 50.0 71 40.0 72 35.0 73 36.0 74 40.0 75 28.0 76 21.0 77 22.5 78 13.0 79 6.0 80 6.0 81 3.5 82 3.0 83 2.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.74228523769808 81.6 2 7.978871281623576 14.35 3 0.9730330831248262 2.625 4 0.19460661662496526 0.7000000000000001 5 0.027800945232137893 0.125 6 0.055601890464275786 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027800945232137893 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 37bp) CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACT 6 0.15 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.4125 0.0 0.0 0.0 0.0 60-61 0.575 0.0 0.0 0.0 0.0 62-63 0.725 0.0 0.0 0.0 0.0 64-65 0.8625 0.0 0.0 0.0 0.0 66-67 0.9875 0.0 0.0 0.0 0.0 68-69 1.2 0.0 0.0 0.0 0.0 70-71 1.3250000000000002 0.0 0.0 0.0 0.0 72-73 1.475 0.0 0.0 0.0 0.0125 74-75 1.6625 0.0 0.0 0.0 0.025 76-77 2.0125 0.0 0.0 0.0 0.025 78-79 2.4375 0.0 0.0 0.0 0.025 80-81 2.6625 0.0 0.0 0.0 0.025 82-83 3.125 0.0 0.0 0.0 0.025 84-85 3.4000000000000004 0.0 0.0 0.0 0.025 86-87 3.875 0.0 0.0 0.0 0.025 88-89 4.35 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450073 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450073_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8215 37.0 37.0 37.0 37.0 37.0 2 35.911 37.0 37.0 37.0 37.0 37.0 3 35.9075 37.0 37.0 37.0 37.0 37.0 4 36.0585 37.0 37.0 37.0 37.0 37.0 5 36.2275 37.0 37.0 37.0 37.0 37.0 6 36.228 37.0 37.0 37.0 37.0 37.0 7 36.1545 37.0 37.0 37.0 37.0 37.0 8 36.194 37.0 37.0 37.0 37.0 37.0 9 36.1215 37.0 37.0 37.0 37.0 37.0 10-11 36.13425 37.0 37.0 37.0 37.0 37.0 12-13 36.14475 37.0 37.0 37.0 37.0 37.0 14-15 36.03975 37.0 37.0 37.0 37.0 37.0 16-17 36.05325 37.0 37.0 37.0 37.0 37.0 18-19 36.14675 37.0 37.0 37.0 37.0 37.0 20-21 36.09925 37.0 37.0 37.0 37.0 37.0 22-23 36.1385 37.0 37.0 37.0 37.0 37.0 24-25 36.0865 37.0 37.0 37.0 37.0 37.0 26-27 35.977000000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.03675 37.0 37.0 37.0 37.0 37.0 30-31 35.941 37.0 37.0 37.0 37.0 37.0 32-33 35.860749999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.998000000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.86175 37.0 37.0 37.0 37.0 37.0 38-39 35.827749999999995 37.0 37.0 37.0 37.0 37.0 40-41 35.833749999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.829750000000004 37.0 37.0 37.0 37.0 37.0 44-45 35.79075 37.0 37.0 37.0 37.0 37.0 46-47 35.783249999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.81125 37.0 37.0 37.0 37.0 37.0 50-51 35.775000000000006 37.0 37.0 37.0 37.0 37.0 52-53 35.783500000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.80825 37.0 37.0 37.0 37.0 37.0 56-57 35.781000000000006 37.0 37.0 37.0 37.0 37.0 58-59 35.708749999999995 37.0 37.0 37.0 37.0 37.0 60-61 35.713 37.0 37.0 37.0 37.0 37.0 62-63 35.661500000000004 37.0 37.0 37.0 37.0 37.0 64-65 35.697500000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.7445 37.0 37.0 37.0 37.0 37.0 68-69 35.70225 37.0 37.0 37.0 37.0 37.0 70-71 35.66775 37.0 37.0 37.0 37.0 37.0 72-73 35.626999999999995 37.0 37.0 37.0 37.0 37.0 74-75 35.554500000000004 37.0 37.0 37.0 37.0 37.0 76-77 35.6745 37.0 37.0 37.0 37.0 37.0 78-79 35.63175 37.0 37.0 37.0 37.0 37.0 80-81 35.6175 37.0 37.0 37.0 37.0 37.0 82-83 35.586 37.0 37.0 37.0 37.0 37.0 84-85 35.58275 37.0 37.0 37.0 37.0 37.0 86-87 35.787000000000006 37.0 37.0 37.0 37.0 37.0 88-89 35.64575 37.0 37.0 37.0 37.0 37.0 90-91 35.669 37.0 37.0 37.0 37.0 37.0 92-93 35.72775 37.0 37.0 37.0 37.0 37.0 94-95 35.739999999999995 37.0 37.0 37.0 37.0 37.0 96-97 35.76 37.0 37.0 37.0 37.0 37.0 98-99 35.67375 37.0 37.0 37.0 37.0 37.0 100-101 35.6255 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 4.0 16 7.0 17 3.0 18 6.0 19 4.0 20 4.0 21 5.0 22 11.0 23 12.0 24 18.0 25 17.0 26 20.0 27 20.0 28 22.0 29 37.0 30 37.0 31 47.0 32 66.0 33 68.0 34 110.0 35 253.0 36 2140.0 37 1086.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35 17.45 12.025 30.175 2 27.650000000000002 22.75 25.874999999999996 23.724999999999998 3 25.3 24.45 26.400000000000002 23.849999999999998 4 29.675 26.825 17.224999999999998 26.275 5 29.575000000000003 28.525 19.225 22.675 6 24.325 32.225 19.75 23.7 7 25.25 18.6 31.825 24.325 8 25.5 21.349999999999998 23.35 29.799999999999997 9 25.95 22.625 24.175 27.250000000000004 10-11 28.749999999999996 26.200000000000003 19.1 25.95 12-13 28.212500000000002 20.8125 23.275000000000002 27.700000000000003 14-15 26.674999999999997 24.5625 23.2125 25.55 16-17 28.0875 24.425 21.925 25.5625 18-19 27.575 25.1 21.95 25.374999999999996 20-21 26.9125 25.174999999999997 21.25 26.6625 22-23 28.4375 23.8625 22.425 25.275 24-25 27.900000000000002 24.65 21.975 25.474999999999998 26-27 27.875 24.85 22.55 24.725 28-29 27.900000000000002 24.65 21.775 25.674999999999997 30-31 27.212500000000002 24.474999999999998 22.650000000000002 25.662499999999998 32-33 27.800000000000004 24.425 21.8875 25.887500000000003 34-35 27.975 24.875 22.1875 24.962500000000002 36-37 27.737499999999997 23.625 22.8625 25.775 38-39 27.1 24.725 22.45 25.724999999999998 40-41 27.400000000000002 24.224999999999998 22.6875 25.687500000000004 42-43 26.887499999999996 23.599999999999998 23.575 25.937500000000004 44-45 26.75 24.5375 22.5875 26.125 46-47 27.250000000000004 23.974999999999998 23.0125 25.7625 48-49 27.3125 24.85 22.912499999999998 24.925 50-51 26.2625 24.837500000000002 22.5125 26.387500000000003 52-53 27.2625 24.0 22.9875 25.75 54-55 27.0125 24.125 22.787499999999998 26.075 56-57 26.8125 24.5625 23.075000000000003 25.55 58-59 26.775 24.2 23.5375 25.4875 60-61 27.275 24.55 23.175 25.0 62-63 27.1125 23.45 24.0 25.4375 64-65 27.6 23.925 23.5625 24.9125 66-67 27.0125 23.7875 23.1625 26.0375 68-69 27.537499999999998 24.25 23.1 25.112499999999997 70-71 27.537499999999998 24.462500000000002 22.575 25.424999999999997 72-73 26.8125 25.4 22.2625 25.525 74-75 26.700000000000003 24.6 23.45 25.25 76-77 27.450000000000003 23.9125 23.2875 25.35 78-79 26.9125 24.075 24.0375 24.975 80-81 26.8375 24.3125 23.175 25.674999999999997 82-83 28.1625 23.3125 23.075000000000003 25.45 84-85 27.6625 24.05 23.075000000000003 25.2125 86-87 28.475 24.625 21.8875 25.0125 88-89 28.799999999999997 24.1375 22.8 24.2625 90-91 28.6875 24.6 22.575 24.1375 92-93 27.750000000000004 26.05 21.2 25.0 94-95 29.2375 24.212500000000002 21.349999999999998 25.2 96-97 28.875 24.349999999999998 21.45 25.324999999999996 98-99 29.525000000000002 25.474999999999998 21.1125 23.8875 100-101 29.575000000000003 24.6625 22.7125 23.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 1.5 11 2.0 12 1.5 13 2.5 14 3.5 15 3.5 16 2.5 17 1.5 18 1.5 19 2.5 20 2.5 21 1.5 22 1.0 23 1.0 24 0.5 25 1.5 26 2.0 27 1.5 28 1.5 29 2.0 30 3.0 31 5.0 32 5.0 33 6.0 34 8.5 35 15.0 36 20.0 37 27.0 38 40.0 39 46.5 40 63.0 41 86.5 42 110.0 43 134.0 44 154.5 45 160.0 46 158.5 47 168.0 48 172.0 49 171.5 50 157.0 51 144.0 52 144.0 53 138.5 54 131.5 55 133.5 56 128.5 57 114.0 58 101.0 59 91.5 60 89.5 61 89.5 62 78.0 63 70.5 64 74.0 65 75.5 66 76.5 67 67.5 68 63.5 69 68.0 70 62.0 71 50.0 72 50.5 73 38.5 74 27.0 75 28.5 76 27.0 77 25.0 78 17.0 79 8.5 80 7.5 81 7.5 82 3.5 83 2.0 84 2.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.5 98 1.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 91.47115650013801 82.85 2 7.341981783052718 13.3 3 0.7728401876897599 2.1 4 0.24841291747170852 0.8999999999999999 5 0.08280430582390284 0.375 6 0.05520287054926856 0.3 7 0.02760143527463428 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 6 0.15 No Hit GGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCAC 5 0.125 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GTTGGCCTTCGGGATCGGAGTAATGATTAATAGGGACAGTCGGGGGCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.35 0.0 0.0 0.0 0.0 58-59 0.4125 0.0 0.0 0.0 0.0 60-61 0.575 0.0 0.0 0.0 0.0 62-63 0.725 0.0 0.0 0.0 0.0 64-65 0.8374999999999999 0.0 0.0125 0.0 0.0 66-67 0.9624999999999999 0.0 0.025 0.0 0.0 68-69 1.175 0.0 0.025 0.0 0.0 70-71 1.2999999999999998 0.0 0.025 0.0 0.0 72-73 1.425 0.0 0.025 0.0 0.0 74-75 1.6125 0.0 0.025 0.0 0.0 76-77 1.9625000000000001 0.0 0.025 0.0 0.0 78-79 2.3875 0.0 0.025 0.0 0.0 80-81 2.6125 0.0 0.025 0.0 0.0 82-83 3.075 0.0 0.025 0.0 0.0 84-85 3.3499999999999996 0.0 0.025 0.0 0.0 86-87 3.8375000000000004 0.0 0.025 0.0 0.0 88-89 4.275 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAGA 15 0.009957196 47.5 90-91 >>END_MODULE Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112618 spots for ERR3450073.sra Written 2112618 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra Read 2112608 spots for ERR3450073.sra Written 2112608 spots for ERR3450073.sra SRR ids: ['ERR3450073.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xvl6l2kk ERR3450073.sra spots: 42252170 blocks: [[1, 2112608], [2112609, 4225216], [4225217, 6337824], [6337825, 8450432], [8450433, 10563040], [10563041, 12675648], [12675649, 14788256], [14788257, 16900864], [16900865, 19013472], [19013473, 21126080], [21126081, 23238688], [23238689, 25351296], [25351297, 27463904], [27463905, 29576512], [29576513, 31689120], [31689121, 33801728], [33801729, 35914336], [35914337, 38026944], [38026945, 40139552], [40139553, 42252170]] ERR3450073 file size 10169985 ERR3450073 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450073 ERR3450073_1.fastq ERR3450073_2.fastq Input file: ERR3450073_1.fastq Paired file: ERR3450073_2.fastq trimmed: ERR3450073-trimmed-pair1.fastq, ERR3450073-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:36:56 2024 >> started Sat Dec 7 14:37:32 2024 >> done (36.760s) 42252170 read pairs processed; of these: 238 ( 0.00%) short read pairs filtered out after trimming by size control 25515 ( 0.06%) empty read pairs filtered out after trimming by size control 42226417 (99.94%) read pairs available; of these: 3562556 ( 8.44%) trimmed read pairs available after processing 38663861 (91.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 43 0.00% 19 94 0.00% 20 311 0.00% 21 721 0.00% 22 740 0.00% 23 342 0.00% 24 321 0.00% 25 413 0.00% 26 636 0.00% 27 907 0.00% 28 1210 0.00% 29 1720 0.00% 30 2116 0.01% 31 2477 0.01% 32 2574 0.01% 33 2488 0.01% 34 2405 0.01% 35 2527 0.01% 36 2814 0.01% 37 3142 0.01% 38 3858 0.01% 39 4446 0.01% 40 5333 0.01% 41 6510 0.02% 42 6873 0.02% 43 7347 0.02% 44 6734 0.02% 45 6878 0.02% 46 7433 0.02% 47 8057 0.02% 48 9127 0.02% 49 10178 0.02% 50 11146 0.03% 51 12493 0.03% 52 13618 0.03% 53 14788 0.04% 54 15005 0.04% 55 16106 0.04% 56 16734 0.04% 57 17708 0.04% 58 19368 0.05% 59 21266 0.05% 60 22485 0.05% 61 25752 0.06% 62 27951 0.07% 63 29715 0.07% 64 31445 0.07% 65 32904 0.08% 66 34463 0.08% 67 36489 0.09% 68 37934 0.09% 69 39464 0.09% 70 43435 0.10% 71 46752 0.11% 72 50401 0.12% 73 53728 0.13% 74 55817 0.13% 75 58294 0.14% 76 60150 0.14% 77 62582 0.15% 78 64923 0.15% 79 68971 0.16% 80 71878 0.17% 81 75189 0.18% 82 80632 0.19% 83 84027 0.20% 84 88561 0.21% 85 92378 0.22% 86 95377 0.23% 87 99721 0.24% 88 103242 0.24% 89 107419 0.25% 90 111078 0.26% 91 118146 0.28% 92 122591 0.29% 93 127706 0.30% 94 133142 0.32% 95 136913 0.32% 96 140110 0.33% 97 146055 0.35% 98 149423 0.35% 99 150866 0.36% 100 175440 0.42% 101 38663861 91.56% 42226417 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=2.4 sequence=GTCAAATTAAGCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATAAGCAACATCCGCCGATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGACCGGAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGACCCGGCCAATTAAGGCTAGGAGCGCATCGCCGGCTGAAGGGTCGAGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=173.64 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.8 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=21 prefix-density=0.27 prefix-fanout=3.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=273.28 fanout-score-rank=1 prefix-density=1.46 prefix-fanout=15.5 sequence=CGCCGCCGCCGG ERR3450073 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:38:22 Started mapping on | Dec 07 14:38:22 Finished on | Dec 07 14:41:29 Mapping speed, Million of reads per hour | 812.91 Number of input reads | 42226417 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 32587166 Uniquely mapped reads % | 77.17% Average mapped length | 198.53 Number of splices: Total | 21149395 Number of splices: Annotated (sjdb) | 20101256 Number of splices: GT/AG | 20873996 Number of splices: GC/AG | 238105 Number of splices: AT/AC | 13315 Number of splices: Non-canonical | 23979 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1612791 % of reads mapped to multiple loci | 3.82% Number of reads mapped to too many loci | 1336707 % of reads mapped to too many loci | 3.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 12.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8026460 8026460 8026460 N_multimapping 1612791 1612791 1612791 N_noFeature 794374 31460620 1456746 N_ambiguous 561980 4726 103395 UnstrandedReadsAssigned:31230812 PositiveStrandReadsAssigned:1121820 NegativeStrandReadsAssigned:31027025 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450073 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450073-trimmed-pair1.fastq ERR3450073-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,226,417 reads, 32,482,741 reads pseudoaligned [quant] estimated average fragment length: 187.253 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,289 rounds 52973 ERR3450073.ke.tsv 35125 ERR3450073.se.tsv 88098 total ==> ERR3450073.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.92 38.838 2.31424 PNS24247 1044 857.747 40.9004 2.13077 PNS24249 1928 1741.75 397.514 10.1985 PNS24246 1044 857.747 40.9004 2.13077 PNS24248 1044 857.747 40.9004 2.13077 PNS24244 1471 1284.75 38.9467 1.35463 PNS24243 293 127.531 0 0 KQK14069 1603 1416.75 3474.97 109.604 KQK14071 474 291.216 191.979 29.4582 ==> ERR3450073.se.tsv <== BRADI_1g14170v3 3724 BRADI_1g53295v3 25 BRADI_1g59795v3 192 BRADI_1g07683v3 0 BRADI_1g00485v3 126 BRADI_1g20270v3 8449 BRADI_1g74790v3 307 BRADI_1g09890v3 48 BRADI_1g77505v3 502 BRADI_1g48960v3 1 ERR3450073 completed mapping pipeline successfully