Starting /dee2/code/volunteer_pipeline.sh ERR3450076 current disk space = 1542922342400 free memory = 1600139720 ERR3450076 SRAfilesize d420062a9d3356172f5c2eedbc3c5744 ERR3450076.sra ERR3450076.sra file validated ERR3450076 is paired end ERR3450076 is conventional basespace ERR3450076 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450076_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20725 37.0 37.0 37.0 37.0 37.0 2 36.402 37.0 37.0 37.0 37.0 37.0 3 36.4135 37.0 37.0 37.0 37.0 37.0 4 36.5875 37.0 37.0 37.0 37.0 37.0 5 36.4705 37.0 37.0 37.0 37.0 37.0 6 36.547 37.0 37.0 37.0 37.0 37.0 7 36.5035 37.0 37.0 37.0 37.0 37.0 8 36.482 37.0 37.0 37.0 37.0 37.0 9 36.429 37.0 37.0 37.0 37.0 37.0 10-11 36.459 37.0 37.0 37.0 37.0 37.0 12-13 36.466 37.0 37.0 37.0 37.0 37.0 14-15 36.433499999999995 37.0 37.0 37.0 37.0 37.0 16-17 36.455 37.0 37.0 37.0 37.0 37.0 18-19 36.4815 37.0 37.0 37.0 37.0 37.0 20-21 36.451 37.0 37.0 37.0 37.0 37.0 22-23 36.39725 37.0 37.0 37.0 37.0 37.0 24-25 36.475 37.0 37.0 37.0 37.0 37.0 26-27 36.380250000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.38225 37.0 37.0 37.0 37.0 37.0 30-31 36.29774999999999 37.0 37.0 37.0 37.0 37.0 32-33 36.29375 37.0 37.0 37.0 37.0 37.0 34-35 36.2785 37.0 37.0 37.0 37.0 37.0 36-37 36.314499999999995 37.0 37.0 37.0 37.0 37.0 38-39 36.260000000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.27275 37.0 37.0 37.0 37.0 37.0 42-43 36.160624999999996 37.0 37.0 37.0 37.0 37.0 44-45 36.13475 37.0 37.0 37.0 37.0 37.0 46-47 36.1395 37.0 37.0 37.0 37.0 37.0 48-49 36.098749999999995 37.0 37.0 37.0 37.0 37.0 50-51 36.11475 37.0 37.0 37.0 37.0 37.0 52-53 36.065375 37.0 37.0 37.0 37.0 37.0 54-55 36.067750000000004 37.0 37.0 37.0 37.0 37.0 56-57 36.1285 37.0 37.0 37.0 37.0 37.0 58-59 36.119 37.0 37.0 37.0 37.0 37.0 60-61 36.089749999999995 37.0 37.0 37.0 37.0 37.0 62-63 36.073 37.0 37.0 37.0 37.0 37.0 64-65 36.0305 37.0 37.0 37.0 37.0 37.0 66-67 36.042500000000004 37.0 37.0 37.0 37.0 37.0 68-69 36.020250000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.9865 37.0 37.0 37.0 37.0 37.0 72-73 35.99725 37.0 37.0 37.0 37.0 37.0 74-75 36.0005 37.0 37.0 37.0 37.0 37.0 76-77 36.00075 37.0 37.0 37.0 37.0 37.0 78-79 35.979749999999996 37.0 37.0 37.0 37.0 37.0 80-81 35.91 37.0 37.0 37.0 37.0 37.0 82-83 35.90975 37.0 37.0 37.0 37.0 37.0 84-85 35.86225 37.0 37.0 37.0 37.0 37.0 86-87 35.84325 37.0 37.0 37.0 37.0 37.0 88-89 35.7515 37.0 37.0 37.0 37.0 37.0 90-91 35.78975 37.0 37.0 37.0 37.0 37.0 92-93 35.826750000000004 37.0 37.0 37.0 37.0 37.0 94-95 35.72825 37.0 37.0 37.0 37.0 37.0 96-97 35.74825 37.0 37.0 37.0 37.0 37.0 98-99 35.667 37.0 37.0 37.0 37.0 37.0 100-101 35.63825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 4.0 23 5.0 24 4.0 25 4.0 26 8.0 27 18.0 28 27.0 29 43.0 30 46.0 31 54.0 32 68.0 33 77.0 34 116.0 35 218.0 36 1894.0 37 1411.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.01828199348861 10.618582519408966 10.393188079138492 39.969947407963936 2 22.725 14.625 28.375 34.275 3 21.325 18.2 24.725 35.75 4 26.3 23.599999999999998 18.375 31.724999999999998 5 28.325 26.125 21.675 23.875 6 23.125 32.0 23.325000000000003 21.55 7 20.3 23.925 36.475 19.3 8 21.275 22.400000000000002 30.25 26.075 9 22.675 21.975 30.7 24.65 10-11 23.95 29.0875 22.475 24.4875 12-13 24.6 23.325000000000003 25.224999999999998 26.85 14-15 24.1125 24.55 25.3 26.0375 16-17 22.95 24.575 26.1 26.375 18-19 24.224999999999998 25.374999999999996 25.337500000000002 25.0625 20-21 23.962500000000002 24.975 24.85 26.2125 22-23 24.3125 25.1875 24.887500000000003 25.6125 24-25 23.9125 24.875 24.025 27.187499999999996 26-27 23.5125 24.9 24.637500000000003 26.950000000000003 28-29 24.5125 24.637500000000003 24.349999999999998 26.5 30-31 24.1375 24.6125 24.337500000000002 26.9125 32-33 23.6875 24.2625 25.45 26.6 34-35 24.875 23.5625 24.625 26.937499999999996 36-37 25.387500000000003 23.962500000000002 24.349999999999998 26.3 38-39 23.9125 24.962500000000002 25.124999999999996 26.0 40-41 23.3625 25.5625 24.975 26.1 42-43 24.128016002000248 24.34054256782098 24.1780222527816 27.353419177397175 44-45 23.525 25.0125 25.124999999999996 26.337500000000002 46-47 24.825 24.837500000000002 24.05 26.2875 48-49 24.587500000000002 24.375 24.2375 26.8 50-51 22.95 24.7875 25.3125 26.950000000000003 52-53 25.103137892236532 24.82810351293912 23.465433179147393 26.60332541567696 54-55 24.8 24.5375 23.75 26.9125 56-57 24.875 24.075 25.0375 26.0125 58-59 24.637500000000003 24.7375 24.125 26.5 60-61 23.7625 25.112499999999997 23.962500000000002 27.1625 62-63 24.4125 24.3625 25.424999999999997 25.8 64-65 24.4125 24.175 25.025 26.387500000000003 66-67 24.887500000000003 24.3 24.6125 26.200000000000003 68-69 24.337500000000002 25.324999999999996 23.325000000000003 27.0125 70-71 24.3 25.0125 24.625 26.0625 72-73 25.7875 24.5625 22.9625 26.687499999999996 74-75 25.0 24.099999999999998 24.075 26.825 76-77 25.275 24.5375 24.15 26.0375 78-79 25.587500000000002 24.5625 23.799999999999997 26.05 80-81 24.7875 24.5375 23.799999999999997 26.875 82-83 25.4 24.7 23.4375 26.4625 84-85 25.275 24.975 23.0375 26.7125 86-87 24.8 24.2875 23.4875 27.425 88-89 24.525 24.9375 24.25 26.2875 90-91 26.424999999999997 24.8625 23.0 25.7125 92-93 24.712500000000002 24.075 24.85 26.3625 94-95 25.974999999999998 24.712500000000002 23.400000000000002 25.912499999999998 96-97 25.0375 24.575 23.825 26.5625 98-99 25.124999999999996 24.462500000000002 23.400000000000002 27.0125 100-101 25.55 24.55 23.35 26.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.5 2 1.5 3 1.5 4 1.0 5 0.0 6 1.0 7 2.5 8 3.0 9 2.5 10 1.5 11 1.5 12 1.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 2.0 25 2.0 26 2.0 27 2.0 28 1.0 29 1.5 30 5.0 31 6.5 32 6.0 33 9.5 34 18.0 35 26.0 36 32.0 37 43.0 38 54.5 39 77.0 40 92.5 41 108.0 42 142.0 43 167.5 44 172.0 45 170.0 46 171.5 47 181.0 48 181.0 49 166.0 50 162.0 51 144.0 52 138.5 53 144.0 54 135.0 55 125.5 56 118.5 57 109.5 58 83.5 59 69.0 60 73.0 61 78.5 62 78.5 63 72.5 64 64.0 65 52.5 66 49.5 67 58.0 68 50.0 69 43.0 70 48.0 71 38.5 72 27.5 73 26.5 74 25.5 75 22.5 76 22.5 77 22.0 78 15.0 79 7.0 80 8.0 81 6.0 82 2.5 83 2.0 84 1.0 85 0.5 86 1.5 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.425 #Duplication Level Percentage of deduplicated Percentage of total 1 86.83829910326874 75.05 2 11.339311541799248 19.6 3 1.4463407578825571 3.75 4 0.2892681515765114 1.0 5 0.02892681515765114 0.125 6 0.02892681515765114 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02892681515765114 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 13 0.325 No Hit CTTGTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTC 6 0.15 No Hit GTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.07500000000000001 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.16249999999999998 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.2875 0.0 0.0 0.0 0.0 44-45 0.3125 0.0 0.0 0.0 0.0 46-47 0.3625 0.0 0.0 0.0 0.0 48-49 0.5125 0.0 0.0 0.0 0.0 50-51 0.575 0.0 0.0 0.0 0.0 52-53 0.5874999999999999 0.0 0.0 0.0 0.0 54-55 0.7 0.0 0.0 0.0 0.0 56-57 0.85 0.0 0.0 0.0 0.0 58-59 1.0 0.0 0.0 0.0 0.0 60-61 1.175 0.0 0.0 0.0 0.0 62-63 1.5875 0.0 0.0 0.0 0.0 64-65 1.7875 0.0 0.0 0.0 0.0 66-67 1.9375 0.0 0.0 0.0 0.0 68-69 2.1625 0.0 0.0 0.0 0.0 70-71 2.3499999999999996 0.0 0.0 0.0 0.0 72-73 2.6875 0.0 0.0 0.0 0.0 74-75 3.0625 0.0 0.0 0.0 0.0 76-77 3.3875 0.0 0.0 0.0 0.0 78-79 3.7875 0.0 0.0 0.0 0.0 80-81 4.1 0.0 0.0 0.0 0.0 82-83 4.425000000000001 0.0 0.0 0.0 0.0 84-85 4.9625 0.0 0.0 0.0 0.0 86-87 5.375 0.0 0.0 0.0 0.0 88-89 5.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450076 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450076_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8025 37.0 37.0 37.0 37.0 37.0 2 36.0225 37.0 37.0 37.0 37.0 37.0 3 36.0905 37.0 37.0 37.0 37.0 37.0 4 36.0785 37.0 37.0 37.0 37.0 37.0 5 36.144 37.0 37.0 37.0 37.0 37.0 6 36.187 37.0 37.0 37.0 37.0 37.0 7 36.0795 37.0 37.0 37.0 37.0 37.0 8 36.1785 37.0 37.0 37.0 37.0 37.0 9 36.077 37.0 37.0 37.0 37.0 37.0 10-11 36.0975 37.0 37.0 37.0 37.0 37.0 12-13 36.16975 37.0 37.0 37.0 37.0 37.0 14-15 36.09775 37.0 37.0 37.0 37.0 37.0 16-17 36.125249999999994 37.0 37.0 37.0 37.0 37.0 18-19 36.163 37.0 37.0 37.0 37.0 37.0 20-21 36.149 37.0 37.0 37.0 37.0 37.0 22-23 36.084 37.0 37.0 37.0 37.0 37.0 24-25 36.08325 37.0 37.0 37.0 37.0 37.0 26-27 36.014250000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.95425 37.0 37.0 37.0 37.0 37.0 30-31 36.0315 37.0 37.0 37.0 37.0 37.0 32-33 36.04975 37.0 37.0 37.0 37.0 37.0 34-35 35.91275 37.0 37.0 37.0 37.0 37.0 36-37 35.965 37.0 37.0 37.0 37.0 37.0 38-39 35.9345 37.0 37.0 37.0 37.0 37.0 40-41 35.9025 37.0 37.0 37.0 37.0 37.0 42-43 35.945 37.0 37.0 37.0 37.0 37.0 44-45 35.909499999999994 37.0 37.0 37.0 37.0 37.0 46-47 35.789500000000004 37.0 37.0 37.0 37.0 37.0 48-49 35.8755 37.0 37.0 37.0 37.0 37.0 50-51 35.906 37.0 37.0 37.0 37.0 37.0 52-53 35.90825 37.0 37.0 37.0 37.0 37.0 54-55 35.90975 37.0 37.0 37.0 37.0 37.0 56-57 35.904250000000005 37.0 37.0 37.0 37.0 37.0 58-59 35.921 37.0 37.0 37.0 37.0 37.0 60-61 35.82625 37.0 37.0 37.0 37.0 37.0 62-63 35.9025 37.0 37.0 37.0 37.0 37.0 64-65 35.864000000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.8965 37.0 37.0 37.0 37.0 37.0 68-69 35.872 37.0 37.0 37.0 37.0 37.0 70-71 35.85525 37.0 37.0 37.0 37.0 37.0 72-73 35.8195 37.0 37.0 37.0 37.0 37.0 74-75 35.833 37.0 37.0 37.0 37.0 37.0 76-77 35.761250000000004 37.0 37.0 37.0 37.0 37.0 78-79 35.67775 37.0 37.0 37.0 37.0 37.0 80-81 35.74525 37.0 37.0 37.0 37.0 37.0 82-83 35.7875 37.0 37.0 37.0 37.0 37.0 84-85 35.72125 37.0 37.0 37.0 37.0 37.0 86-87 35.77475 37.0 37.0 37.0 37.0 37.0 88-89 35.6275 37.0 37.0 37.0 37.0 37.0 90-91 35.715500000000006 37.0 37.0 37.0 37.0 37.0 92-93 35.63975 37.0 37.0 37.0 37.0 37.0 94-95 35.59425 37.0 37.0 37.0 37.0 37.0 96-97 35.55575 37.0 37.0 37.0 37.0 37.0 98-99 35.420249999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.521 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 3.0 16 1.0 17 4.0 18 5.0 19 8.0 20 9.0 21 7.0 22 13.0 23 14.0 24 10.0 25 12.0 26 12.0 27 18.0 28 23.0 29 25.0 30 42.0 31 34.0 32 44.0 33 89.0 34 116.0 35 266.0 36 2153.0 37 1089.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 15.45 13.625000000000002 30.825000000000003 2 26.8 22.35 25.5 25.35 3 25.55 21.85 28.325 24.275 4 31.374999999999996 25.25 17.974999999999998 25.4 5 29.4 30.2 18.15 22.25 6 24.6 32.625 19.775000000000002 23.0 7 25.4 18.775 31.7 24.125 8 24.5 21.375 23.225 30.9 9 25.0 21.05 26.875 27.075 10-11 27.700000000000003 27.175 19.675 25.45 12-13 28.6625 20.925 23.9 26.5125 14-15 26.0125 25.3125 24.2375 24.4375 16-17 27.6375 24.675 22.287499999999998 25.4 18-19 27.675 25.5125 22.9875 23.825 20-21 27.55 25.1 22.912499999999998 24.4375 22-23 27.6125 24.825 22.3875 25.174999999999997 24-25 27.375 25.4 22.025 25.2 26-27 27.0125 25.45 22.25 25.2875 28-29 26.974999999999998 25.474999999999998 22.912499999999998 24.637500000000003 30-31 28.012500000000003 25.2625 22.3 24.425 32-33 26.400000000000002 25.525 22.9625 25.112499999999997 34-35 27.9125 25.525 22.3375 24.224999999999998 36-37 27.1375 24.2875 22.375 26.200000000000003 38-39 26.3 25.4 23.45 24.85 40-41 27.85 24.6 22.5875 24.962500000000002 42-43 26.6125 24.675 22.900000000000002 25.8125 44-45 27.6 25.5125 23.3375 23.549999999999997 46-47 27.224999999999998 24.5125 22.725 25.5375 48-49 26.7125 24.875 22.75 25.662499999999998 50-51 26.375 25.6 23.5125 24.5125 52-53 27.287499999999998 24.1125 23.325000000000003 25.275 54-55 27.737499999999997 24.2875 23.2625 24.712500000000002 56-57 27.437499999999996 25.0 23.474999999999998 24.087500000000002 58-59 26.487500000000004 25.4375 23.1125 24.962500000000002 60-61 27.1625 24.712500000000002 22.8125 25.3125 62-63 27.287499999999998 24.2375 24.087500000000002 24.3875 64-65 28.512500000000003 23.95 23.4875 24.05 66-67 27.450000000000003 24.0625 23.599999999999998 24.887500000000003 68-69 26.950000000000003 25.624999999999996 22.85 24.575 70-71 28.175 24.462500000000002 23.3125 24.05 72-73 27.474999999999998 24.224999999999998 23.4125 24.887500000000003 74-75 27.187499999999996 25.05 23.1125 24.65 76-77 29.4 24.05 22.8625 23.6875 78-79 27.575 24.05 23.5625 24.8125 80-81 27.6625 25.275 22.4875 24.575 82-83 28.1125 24.5125 22.8625 24.5125 84-85 27.950000000000003 24.75 23.275000000000002 24.025 86-87 27.825 24.5125 23.6875 23.974999999999998 88-89 28.499999999999996 24.6625 22.412499999999998 24.425 90-91 28.8625 24.4375 23.3375 23.3625 92-93 28.275 26.3125 22.725 22.6875 94-95 29.512500000000003 24.349999999999998 23.1875 22.95 96-97 29.125 25.05 22.975 22.85 98-99 29.525000000000002 24.349999999999998 22.8625 23.2625 100-101 29.3375 25.412499999999998 22.075 23.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.5 8 1.5 9 0.0 10 1.0 11 1.0 12 1.0 13 2.5 14 3.0 15 3.0 16 1.5 17 0.5 18 0.5 19 1.0 20 2.5 21 2.5 22 2.0 23 1.0 24 2.0 25 2.0 26 0.0 27 2.0 28 3.5 29 4.5 30 4.5 31 5.5 32 9.5 33 9.5 34 9.5 35 22.5 36 38.0 37 41.0 38 52.5 39 77.5 40 91.0 41 105.0 42 125.5 43 146.5 44 164.0 45 156.5 46 146.0 47 167.0 48 178.5 49 160.5 50 141.0 51 134.0 52 135.0 53 137.5 54 125.0 55 106.0 56 110.5 57 110.5 58 94.0 59 80.0 60 84.0 61 89.5 62 89.0 63 87.0 64 79.0 65 70.0 66 62.0 67 63.0 68 63.0 69 57.5 70 46.5 71 42.5 72 40.0 73 31.0 74 33.5 75 31.0 76 21.5 77 16.5 78 16.5 79 13.0 80 4.5 81 2.0 82 3.5 83 2.0 84 1.5 85 2.5 86 1.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.5 92 2.0 93 2.5 94 1.0 95 0.5 96 3.5 97 3.0 98 1.0 99 3.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.125 #Duplication Level Percentage of deduplicated Percentage of total 1 87.25968436154949 76.02499999999999 2 11.190817790530847 19.5 3 1.205164992826399 3.15 4 0.2869440459110474 1.0 5 0.028694404591104734 0.125 6 0.0 0.0 7 0.0 0.0 8 0.028694404591104734 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 8 0.2 No Hit GTTGTAAGGAGGGACTTATGTCACCACAAACAGAAACTAAAGCAAGTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.07500000000000001 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.16249999999999998 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.2625 0.0 0.0 0.0 0.0 44-45 0.2875 0.0 0.0 0.0 0.0 46-47 0.3375 0.0 0.0 0.0 0.0 48-49 0.475 0.0 0.0 0.0 0.0 50-51 0.5375000000000001 0.0 0.0 0.0 0.0 52-53 0.5625 0.0 0.0 0.0 0.0 54-55 0.675 0.0 0.0 0.0 0.0 56-57 0.825 0.0 0.0 0.0 0.0 58-59 0.9750000000000001 0.0 0.0 0.0 0.0 60-61 1.15 0.0 0.0 0.0 0.0 62-63 1.5625 0.0 0.0 0.0 0.0 64-65 1.7625 0.0 0.0 0.0 0.0 66-67 1.9125 0.0 0.0 0.0 0.0 68-69 2.1375 0.0 0.0 0.0 0.0 70-71 2.325 0.0 0.0 0.0 0.0 72-73 2.6625 0.0 0.0 0.0 0.0 74-75 3.0374999999999996 0.0 0.0 0.0 0.0 76-77 3.3875 0.0 0.0 0.0 0.0 78-79 3.8125 0.0 0.0 0.0 0.0 80-81 4.125 0.0 0.0 0.0 0.0 82-83 4.449999999999999 0.0 0.0 0.0 0.0 84-85 5.05 0.0 0.0 0.0 0.0 86-87 5.475 0.0 0.0 0.0 0.0 88-89 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691670 spots for ERR3450076.sra Written 691670 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra Read 691651 spots for ERR3450076.sra Written 691651 spots for ERR3450076.sra SRR ids: ['ERR3450076.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__v6j4bdo ERR3450076.sra spots: 13833039 blocks: [[1, 691651], [691652, 1383302], [1383303, 2074953], [2074954, 2766604], [2766605, 3458255], [3458256, 4149906], [4149907, 4841557], [4841558, 5533208], [5533209, 6224859], [6224860, 6916510], [6916511, 7608161], [7608162, 8299812], [8299813, 8991463], [8991464, 9683114], [9683115, 10374765], [10374766, 11066416], [11066417, 11758067], [11758068, 12449718], [12449719, 13141369], [13141370, 13833039]] ERR3450076 file size 3314979 ERR3450076 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450076 ERR3450076_1.fastq ERR3450076_2.fastq Input file: ERR3450076_1.fastq Paired file: ERR3450076_2.fastq trimmed: ERR3450076-trimmed-pair1.fastq, ERR3450076-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:46:55 2024 >> started Sat Dec 7 14:47:07 2024 >> done (11.866s) 13833039 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 36482 ( 0.26%) empty read pairs filtered out after trimming by size control 13796435 (99.74%) read pairs available; of these: 1529968 (11.09%) trimmed read pairs available after processing 12266467 (88.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 44 0.00% 20 142 0.00% 21 392 0.00% 22 525 0.00% 23 241 0.00% 24 234 0.00% 25 349 0.00% 26 513 0.00% 27 695 0.01% 28 932 0.01% 29 1168 0.01% 30 1587 0.01% 31 1819 0.01% 32 1949 0.01% 33 1666 0.01% 34 1793 0.01% 35 1759 0.01% 36 1958 0.01% 37 2213 0.02% 38 2548 0.02% 39 2810 0.02% 40 3559 0.03% 41 4012 0.03% 42 4492 0.03% 43 4709 0.03% 44 4352 0.03% 45 4387 0.03% 46 4634 0.03% 47 5053 0.04% 48 5470 0.04% 49 6141 0.04% 50 6889 0.05% 51 7523 0.05% 52 8225 0.06% 53 8371 0.06% 54 8703 0.06% 55 9044 0.07% 56 9436 0.07% 57 10093 0.07% 58 11002 0.08% 59 11540 0.08% 60 12484 0.09% 61 13872 0.10% 62 14410 0.10% 63 15372 0.11% 64 16515 0.12% 65 16659 0.12% 66 17114 0.12% 67 17984 0.13% 68 19122 0.14% 69 19671 0.14% 70 20992 0.15% 71 21769 0.16% 72 23630 0.17% 73 24594 0.18% 74 25835 0.19% 75 26658 0.19% 76 27395 0.20% 77 28469 0.21% 78 29247 0.21% 79 30497 0.22% 80 31799 0.23% 81 32962 0.24% 82 34550 0.25% 83 35781 0.26% 84 37115 0.27% 85 38789 0.28% 86 39478 0.29% 87 40500 0.29% 88 41940 0.30% 89 42990 0.31% 90 44193 0.32% 91 46087 0.33% 92 47281 0.34% 93 49338 0.36% 94 50435 0.37% 95 51775 0.38% 96 52541 0.38% 97 53959 0.39% 98 54903 0.40% 99 55472 0.40% 100 62787 0.46% 101 12266467 88.91% 13796435 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=25 prefix-density=0.27 prefix-fanout=2.1 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=167.10 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=21.4 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=24 prefix-density=0.17 prefix-fanout=2.4 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=221.68 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=22.4 sequence=CGGCGGCGGCGC ERR3450076 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:47:44 Started mapping on | Dec 07 14:47:45 Finished on | Dec 07 14:48:46 Mapping speed, Million of reads per hour | 814.22 Number of input reads | 13796435 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 11161495 Uniquely mapped reads % | 80.90% Average mapped length | 197.09 Number of splices: Total | 6872131 Number of splices: Annotated (sjdb) | 6501474 Number of splices: GT/AG | 6779639 Number of splices: GC/AG | 79301 Number of splices: AT/AC | 4332 Number of splices: Non-canonical | 8859 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674293 % of reads mapped to multiple loci | 4.89% Number of reads mapped to too many loci | 293526 % of reads mapped to too many loci | 2.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 8.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1960647 1960647 1960647 N_multimapping 674293 674293 674293 N_noFeature 373081 10773185 596626 N_ambiguous 202079 1651 39037 UnstrandedReadsAssigned:10586335 PositiveStrandReadsAssigned:386659 NegativeStrandReadsAssigned:10525832 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450076 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450076-trimmed-pair1.fastq ERR3450076-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,796,435 reads, 11,091,439 reads pseudoaligned [quant] estimated average fragment length: 184.095 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 ERR3450076.ke.tsv 35125 ERR3450076.se.tsv 88098 total ==> ERR3450076.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.167 0 0 PNS24247 1044 860.905 20.822 3.34923 PNS24249 1928 1744.91 137.472 10.9099 PNS24246 1044 860.905 20.822 3.34923 PNS24248 1044 860.905 20.822 3.34923 PNS24244 1471 1287.91 27.0621 2.90976 PNS24243 293 131.679 0 0 KQK14069 1603 1419.91 3569.74 348.142 KQK14071 474 294.821 133.03 62.484 ==> ERR3450076.se.tsv <== BRADI_1g14170v3 3774 BRADI_1g53295v3 24 BRADI_1g59795v3 137 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1835 BRADI_1g74790v3 104 BRADI_1g09890v3 11 BRADI_1g77505v3 156 BRADI_1g48960v3 0 ERR3450076 completed mapping pipeline successfully