Starting /dee2/code/volunteer_pipeline.sh ERR3450077 current disk space = 1542922395648 free memory = 1600139600 ERR3450077 SRAfilesize 2ccbb176ee65694f8aff64952a0d4bcd ERR3450077.sra ERR3450077.sra file validated ERR3450077 is paired end ERR3450077 is conventional basespace ERR3450077 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450077_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.201 37.0 37.0 37.0 37.0 37.0 2 36.207 37.0 37.0 37.0 37.0 37.0 3 36.357 37.0 37.0 37.0 37.0 37.0 4 36.4195 37.0 37.0 37.0 37.0 37.0 5 36.446 37.0 37.0 37.0 37.0 37.0 6 36.454 37.0 37.0 37.0 37.0 37.0 7 36.406 37.0 37.0 37.0 37.0 37.0 8 36.4775 37.0 37.0 37.0 37.0 37.0 9 36.4795 37.0 37.0 37.0 37.0 37.0 10-11 36.4935 37.0 37.0 37.0 37.0 37.0 12-13 36.409499999999994 37.0 37.0 37.0 37.0 37.0 14-15 36.4515 37.0 37.0 37.0 37.0 37.0 16-17 36.43425 37.0 37.0 37.0 37.0 37.0 18-19 36.48375 37.0 37.0 37.0 37.0 37.0 20-21 36.49925 37.0 37.0 37.0 37.0 37.0 22-23 36.434 37.0 37.0 37.0 37.0 37.0 24-25 36.3765 37.0 37.0 37.0 37.0 37.0 26-27 36.364000000000004 37.0 37.0 37.0 37.0 37.0 28-29 36.39575000000001 37.0 37.0 37.0 37.0 37.0 30-31 36.345749999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.287499999999994 37.0 37.0 37.0 37.0 37.0 34-35 36.2385 37.0 37.0 37.0 37.0 37.0 36-37 36.242000000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.32325 37.0 37.0 37.0 37.0 37.0 40-41 36.1875 37.0 37.0 37.0 37.0 37.0 42-43 36.219 37.0 37.0 37.0 37.0 37.0 44-45 36.19525 37.0 37.0 37.0 37.0 37.0 46-47 36.1815 37.0 37.0 37.0 37.0 37.0 48-49 36.14325 37.0 37.0 37.0 37.0 37.0 50-51 36.15275 37.0 37.0 37.0 37.0 37.0 52-53 36.09925 37.0 37.0 37.0 37.0 37.0 54-55 36.153 37.0 37.0 37.0 37.0 37.0 56-57 36.04875 37.0 37.0 37.0 37.0 37.0 58-59 36.12025 37.0 37.0 37.0 37.0 37.0 60-61 36.072 37.0 37.0 37.0 37.0 37.0 62-63 35.9955 37.0 37.0 37.0 37.0 37.0 64-65 36.02775 37.0 37.0 37.0 37.0 37.0 66-67 35.97475 37.0 37.0 37.0 37.0 37.0 68-69 35.95625 37.0 37.0 37.0 37.0 37.0 70-71 35.980500000000006 37.0 37.0 37.0 37.0 37.0 72-73 35.939 37.0 37.0 37.0 37.0 37.0 74-75 35.98125 37.0 37.0 37.0 37.0 37.0 76-77 35.964 37.0 37.0 37.0 37.0 37.0 78-79 35.9375 37.0 37.0 37.0 37.0 37.0 80-81 35.90475000000001 37.0 37.0 37.0 37.0 37.0 82-83 35.864000000000004 37.0 37.0 37.0 37.0 37.0 84-85 35.81575 37.0 37.0 37.0 37.0 37.0 86-87 35.83525 37.0 37.0 37.0 37.0 37.0 88-89 35.91 37.0 37.0 37.0 37.0 37.0 90-91 35.804 37.0 37.0 37.0 37.0 37.0 92-93 35.831 37.0 37.0 37.0 37.0 37.0 94-95 35.71875 37.0 37.0 37.0 37.0 37.0 96-97 35.76375 37.0 37.0 37.0 37.0 37.0 98-99 35.671499999999995 37.0 37.0 37.0 37.0 37.0 100-101 35.696749999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 1.0 23 3.0 24 5.0 25 7.0 26 16.0 27 23.0 28 33.0 29 41.0 30 51.0 31 39.0 32 76.0 33 89.0 34 92.0 35 228.0 36 1729.0 37 1563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.66382338183643 9.909683893627697 10.812844957350727 39.61364776718515 2 22.475 12.925 28.199999999999996 36.4 3 21.75 17.1 24.45 36.7 4 29.275000000000002 21.4 18.175 31.15 5 28.075 26.3 21.3 24.325 6 22.775000000000002 30.65 25.35 21.224999999999998 7 20.825 21.9 36.55 20.724999999999998 8 21.224999999999998 20.825 28.925 29.025000000000002 9 22.075 22.075 30.975 24.875 10-11 24.224999999999998 28.287499999999998 23.1625 24.325 12-13 24.099999999999998 23.0875 26.2625 26.55 14-15 23.3375 23.849999999999998 25.5 27.3125 16-17 24.462500000000002 23.599999999999998 25.637500000000003 26.3 18-19 23.45 24.975 25.0625 26.5125 20-21 23.674999999999997 24.125 26.0 26.200000000000003 22-23 23.5625 23.974999999999998 25.8 26.6625 24-25 23.3125 23.474999999999998 25.662499999999998 27.55 26-27 24.9 24.587500000000002 23.5 27.0125 28-29 24.05 24.2875 24.5125 27.150000000000002 30-31 23.799999999999997 24.0375 24.9875 27.175 32-33 25.15 24.7 23.775 26.375 34-35 25.662499999999998 23.599999999999998 24.2875 26.450000000000003 36-37 24.75 24.175 23.325000000000003 27.750000000000004 38-39 24.75 24.2 24.025 27.025 40-41 25.074999999999996 23.375 24.5125 27.037499999999998 42-43 25.8125 23.2625 23.4875 27.437499999999996 44-45 24.7 24.65 24.25 26.400000000000002 46-47 24.224999999999998 24.099999999999998 24.3 27.375 48-49 24.9 23.6875 24.825 26.5875 50-51 24.725 23.7 24.3 27.275 52-53 24.462500000000002 23.45 23.3625 28.725 54-55 24.1125 23.7 24.087500000000002 28.1 56-57 24.224999999999998 24.087500000000002 24.8 26.887499999999996 58-59 24.9125 24.425 24.725 25.937500000000004 60-61 24.15 23.6375 24.8 27.4125 62-63 25.1 23.875 24.224999999999998 26.8 64-65 25.05 24.5625 24.6 25.7875 66-67 24.4125 24.175 24.675 26.737499999999997 68-69 24.75 24.0375 24.3625 26.85 70-71 25.55 24.075 24.5625 25.8125 72-73 25.474999999999998 24.175 23.375 26.974999999999998 74-75 25.0625 24.55 23.2875 27.1 76-77 26.5875 23.225 23.275000000000002 26.9125 78-79 24.3875 23.6875 23.2875 28.6375 80-81 24.75 23.925 23.7375 27.5875 82-83 25.8 23.65 23.5875 26.9625 84-85 25.974999999999998 23.7 22.537499999999998 27.787499999999998 86-87 26.224999999999998 24.337500000000002 22.825 26.6125 88-89 24.825 24.775 23.775 26.625 90-91 26.125 24.425 22.3 27.150000000000002 92-93 24.5625 24.7875 24.0625 26.5875 94-95 25.8125 23.7625 23.2375 27.187499999999996 96-97 25.95 24.925 22.6 26.525 98-99 25.575 24.3 23.3375 26.787499999999998 100-101 25.2875 24.224999999999998 23.5375 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.5 4 1.0 5 1.0 6 2.0 7 1.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.5 17 2.0 18 1.5 19 1.0 20 2.5 21 2.0 22 1.5 23 1.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.0 29 3.0 30 2.5 31 3.0 32 6.5 33 7.5 34 9.5 35 18.0 36 29.0 37 37.5 38 56.0 39 67.5 40 73.0 41 85.5 42 114.5 43 137.5 44 149.0 45 157.5 46 179.5 47 197.5 48 174.5 49 171.0 50 173.5 51 160.0 52 149.0 53 143.5 54 138.5 55 128.0 56 133.0 57 138.5 58 113.0 59 92.5 60 79.5 61 74.5 62 71.5 63 59.5 64 59.5 65 60.5 66 58.5 67 56.0 68 59.0 69 57.0 70 53.0 71 48.5 72 38.0 73 29.0 74 17.0 75 15.0 76 19.0 77 16.5 78 15.0 79 10.0 80 5.5 81 4.0 82 3.0 83 2.5 84 0.5 85 1.5 86 1.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.75 #Duplication Level Percentage of deduplicated Percentage of total 1 86.15160349854227 73.875 2 11.778425655976676 20.200000000000003 3 1.5451895043731778 3.975 4 0.43731778425655976 1.5 5 0.029154518950437316 0.125 6 0.029154518950437316 0.15 7 0.029154518950437316 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCAT 7 0.17500000000000002 No Hit GTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTT 6 0.15 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.07500000000000001 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.2375 0.0 0.0 0.0 0.0 48-49 0.4375 0.0 0.0 0.0 0.0 50-51 0.48750000000000004 0.0 0.0 0.0 0.0 52-53 0.5375000000000001 0.0 0.0 0.0 0.0 54-55 0.5625 0.0 0.0 0.0 0.0 56-57 0.625 0.0 0.0 0.0 0.0 58-59 0.875 0.0 0.0 0.0 0.0 60-61 1.0375 0.0 0.0 0.0 0.0 62-63 1.2 0.0 0.0 0.0 0.0 64-65 1.4125 0.0 0.0 0.0 0.0 66-67 1.6 0.0 0.0 0.0 0.0 68-69 1.95 0.0 0.0 0.0 0.0 70-71 2.1125 0.0 0.0 0.0 0.0 72-73 2.35 0.0 0.0 0.0 0.0 74-75 2.8625 0.0 0.0 0.0 0.0 76-77 3.2625 0.0 0.0 0.0 0.0 78-79 3.7 0.0 0.0 0.0 0.0 80-81 4.225 0.0 0.0 0.0 0.0 82-83 4.625 0.0 0.0 0.0 0.0 84-85 5.074999999999999 0.0 0.0 0.0 0.0 86-87 5.6625 0.0 0.0 0.0 0.0 88-89 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450077 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450077_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.746 37.0 37.0 37.0 37.0 37.0 2 35.6395 37.0 37.0 37.0 37.0 37.0 3 35.757 37.0 37.0 37.0 37.0 37.0 4 35.975 37.0 37.0 37.0 37.0 37.0 5 35.9585 37.0 37.0 37.0 37.0 37.0 6 35.9435 37.0 37.0 37.0 37.0 37.0 7 35.9905 37.0 37.0 37.0 37.0 37.0 8 35.9105 37.0 37.0 37.0 37.0 37.0 9 36.1005 37.0 37.0 37.0 37.0 37.0 10-11 36.095749999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.068 37.0 37.0 37.0 37.0 37.0 14-15 36.0175 37.0 37.0 37.0 37.0 37.0 16-17 36.0385 37.0 37.0 37.0 37.0 37.0 18-19 36.0445 37.0 37.0 37.0 37.0 37.0 20-21 36.10725 37.0 37.0 37.0 37.0 37.0 22-23 36.0235 37.0 37.0 37.0 37.0 37.0 24-25 36.045249999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.9825 37.0 37.0 37.0 37.0 37.0 28-29 36.02675 37.0 37.0 37.0 37.0 37.0 30-31 35.88125 37.0 37.0 37.0 37.0 37.0 32-33 35.9215 37.0 37.0 37.0 37.0 37.0 34-35 35.88375 37.0 37.0 37.0 37.0 37.0 36-37 35.8805 37.0 37.0 37.0 37.0 37.0 38-39 35.846500000000006 37.0 37.0 37.0 37.0 37.0 40-41 35.872249999999994 37.0 37.0 37.0 37.0 37.0 42-43 35.8765 37.0 37.0 37.0 37.0 37.0 44-45 35.89375 37.0 37.0 37.0 37.0 37.0 46-47 35.815250000000006 37.0 37.0 37.0 37.0 37.0 48-49 35.866749999999996 37.0 37.0 37.0 37.0 37.0 50-51 35.775 37.0 37.0 37.0 37.0 37.0 52-53 35.813500000000005 37.0 37.0 37.0 37.0 37.0 54-55 35.88725 37.0 37.0 37.0 37.0 37.0 56-57 35.945499999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.82625 37.0 37.0 37.0 37.0 37.0 60-61 35.8035 37.0 37.0 37.0 37.0 37.0 62-63 35.941500000000005 37.0 37.0 37.0 37.0 37.0 64-65 35.8095 37.0 37.0 37.0 37.0 37.0 66-67 35.91075 37.0 37.0 37.0 37.0 37.0 68-69 35.85125 37.0 37.0 37.0 37.0 37.0 70-71 35.86775 37.0 37.0 37.0 37.0 37.0 72-73 35.757999999999996 37.0 37.0 37.0 37.0 37.0 74-75 35.6605 37.0 37.0 37.0 37.0 37.0 76-77 35.68625 37.0 37.0 37.0 37.0 37.0 78-79 35.66125 37.0 37.0 37.0 37.0 37.0 80-81 35.6035 37.0 37.0 37.0 37.0 37.0 82-83 35.6065 37.0 37.0 37.0 37.0 37.0 84-85 35.72325 37.0 37.0 37.0 37.0 37.0 86-87 35.678 37.0 37.0 37.0 37.0 37.0 88-89 35.62675 37.0 37.0 37.0 37.0 37.0 90-91 35.64575000000001 37.0 37.0 37.0 37.0 37.0 92-93 35.489999999999995 37.0 37.0 37.0 37.0 37.0 94-95 35.528999999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.515 37.0 37.0 37.0 37.0 37.0 98-99 35.40475 37.0 37.0 37.0 37.0 37.0 100-101 35.48275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 3.0 17 3.0 18 3.0 19 2.0 20 3.0 21 9.0 22 18.0 23 14.0 24 15.0 25 12.0 26 18.0 27 25.0 28 27.0 29 42.0 30 52.0 31 43.0 32 57.0 33 79.0 34 126.0 35 270.0 36 2171.0 37 1007.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.949999999999996 15.75 12.15 30.15 2 26.25 22.35 27.0 24.4 3 24.425 25.35 25.924999999999997 24.3 4 30.775000000000002 27.05 17.675 24.5 5 28.999999999999996 30.025000000000002 19.375 21.6 6 24.15 32.2 20.7 22.95 7 24.8 19.725 30.725 24.75 8 27.474999999999998 21.025 23.45 28.050000000000004 9 26.424999999999997 21.05 24.9 27.625 10-11 28.0875 26.737499999999997 19.7375 25.4375 12-13 29.125 22.225 22.912499999999998 25.7375 14-15 26.787499999999998 25.662499999999998 22.925 24.625 16-17 27.0625 25.5125 21.825 25.6 18-19 28.199999999999996 24.5625 22.45 24.7875 20-21 27.35 24.962500000000002 22.6125 25.074999999999996 22-23 28.175 24.1375 22.35 25.337500000000002 24-25 27.0 24.2625 22.275 26.4625 26-27 26.525 25.387500000000003 22.2625 25.825 28-29 28.4125 24.762500000000003 22.237499999999997 24.587500000000002 30-31 28.0625 25.15 22.0125 24.775 32-33 25.5 24.6875 22.9625 26.85 34-35 27.3875 24.0 23.0375 25.575 36-37 26.625 24.6875 22.4875 26.200000000000003 38-39 26.200000000000003 24.712500000000002 22.4875 26.6 40-41 26.9125 24.85 22.15 26.087500000000002 42-43 27.787499999999998 24.15 21.925 26.137500000000003 44-45 26.125 24.587500000000002 23.7 25.587500000000002 46-47 28.1375 25.7 22.4375 23.724999999999998 48-49 26.337500000000002 24.7375 22.625 26.3 50-51 26.875 25.724999999999998 22.35 25.05 52-53 27.425 24.05 22.7 25.825 54-55 27.1375 24.1125 23.150000000000002 25.6 56-57 27.700000000000003 25.15 22.85 24.3 58-59 26.987499999999997 24.675 22.912499999999998 25.424999999999997 60-61 27.3 23.799999999999997 22.6375 26.2625 62-63 26.825 24.6 23.9 24.675 64-65 28.1875 24.8625 21.762500000000003 25.1875 66-67 27.712500000000002 25.0 22.1 25.1875 68-69 28.6125 24.825 22.875 23.6875 70-71 29.1125 24.425 21.6875 24.775 72-73 27.6125 24.637500000000003 23.075000000000003 24.675 74-75 27.075 25.25 23.3 24.375 76-77 27.987499999999997 24.349999999999998 22.325 25.337500000000002 78-79 28.050000000000004 23.325000000000003 22.75 25.874999999999996 80-81 27.0875 25.924999999999997 22.525000000000002 24.462500000000002 82-83 29.049999999999997 24.725 22.3125 23.9125 84-85 28.775000000000002 24.2375 22.2125 24.775 86-87 27.400000000000002 24.6875 23.9375 23.974999999999998 88-89 28.812500000000004 23.9 23.0875 24.2 90-91 29.075 24.55 22.9625 23.4125 92-93 29.012500000000003 24.4125 22.975 23.599999999999998 94-95 28.537499999999998 25.6125 21.712500000000002 24.1375 96-97 29.175 24.7875 22.162499999999998 23.875 98-99 29.599999999999998 25.5125 21.825 23.0625 100-101 29.875 24.65 22.3625 23.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.0 12 1.5 13 3.0 14 3.0 15 2.5 16 1.0 17 1.5 18 1.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.5 25 1.5 26 1.5 27 3.0 28 5.5 29 4.5 30 2.5 31 3.0 32 2.0 33 6.0 34 10.5 35 16.5 36 23.0 37 28.5 38 43.0 39 63.5 40 75.5 41 87.5 42 118.5 43 144.0 44 159.0 45 159.0 46 152.0 47 169.0 48 179.0 49 163.0 50 155.5 51 153.0 52 152.5 53 136.0 54 128.5 55 137.0 56 118.5 57 105.0 58 97.5 59 88.0 60 81.5 61 77.5 62 80.0 63 71.0 64 69.5 65 80.5 66 76.0 67 64.5 68 71.0 69 72.5 70 59.0 71 50.0 72 36.0 73 28.0 74 26.5 75 26.5 76 23.5 77 16.0 78 16.0 79 14.5 80 6.5 81 6.0 82 4.0 83 2.5 84 3.0 85 1.0 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.5 92 1.5 93 1.0 94 0.5 95 0.5 96 0.5 97 1.0 98 1.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.775 #Duplication Level Percentage of deduplicated Percentage of total 1 87.00662633246903 75.5 2 11.293575338519158 19.6 3 1.3252664938058196 3.45 4 0.2881014116969173 1.0 5 0.02881014116969173 0.125 6 0.02881014116969173 0.15 7 0.02881014116969173 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.07500000000000001 0.0 0.0 0.0 0.0 40-41 0.1375 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.30000000000000004 0.0 0.0 0.0 0.0 48-49 0.5125 0.0 0.0 0.0 0.0 50-51 0.5625 0.0 0.0 0.0 0.0 52-53 0.6125 0.0 0.0 0.0 0.0 54-55 0.6375 0.0 0.0 0.0 0.0 56-57 0.7 0.0 0.0 0.0 0.0 58-59 0.9624999999999999 0.0 0.0 0.0 0.0 60-61 1.1375000000000002 0.0 0.0 0.0 0.0 62-63 1.3 0.0 0.0 0.0 0.0 64-65 1.525 0.0 0.0 0.0 0.0 66-67 1.725 0.0 0.0 0.0 0.0 68-69 2.0625 0.0 0.0 0.0 0.0 70-71 2.2375 0.0 0.0 0.0 0.0 72-73 2.475 0.0 0.0 0.0 0.0 74-75 2.9875 0.0 0.0 0.0 0.0 76-77 3.4124999999999996 0.0 0.0 0.0 0.0 78-79 3.85 0.0 0.0 0.0 0.0 80-81 4.375 0.0 0.0 0.0 0.0 82-83 4.775 0.0 0.0 0.0 0.0 84-85 5.225 0.0 0.0 0.0 0.0 86-87 5.8125 0.0 0.0 0.0 0.0 88-89 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465617 spots for ERR3450077.sra Written 1465617 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra Read 1465615 spots for ERR3450077.sra Written 1465615 spots for ERR3450077.sra SRR ids: ['ERR3450077.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c1msedta ERR3450077.sra spots: 29312302 blocks: [[1, 1465615], [1465616, 2931230], [2931231, 4396845], [4396846, 5862460], [5862461, 7328075], [7328076, 8793690], [8793691, 10259305], [10259306, 11724920], [11724921, 13190535], [13190536, 14656150], [14656151, 16121765], [16121766, 17587380], [17587381, 19052995], [19052996, 20518610], [20518611, 21984225], [21984226, 23449840], [23449841, 24915455], [24915456, 26381070], [26381071, 27846685], [27846686, 29312302]] ERR3450077 file size 7048747 ERR3450077 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450077 ERR3450077_1.fastq ERR3450077_2.fastq Input file: ERR3450077_1.fastq Paired file: ERR3450077_2.fastq trimmed: ERR3450077-trimmed-pair1.fastq, ERR3450077-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:47:59 2024 >> started Sat Dec 7 14:48:40 2024 >> done (40.581s) 29312302 read pairs processed; of these: 221 ( 0.00%) short read pairs filtered out after trimming by size control 52846 ( 0.18%) empty read pairs filtered out after trimming by size control 29259235 (99.82%) read pairs available; of these: 3020054 (10.32%) trimmed read pairs available after processing 26239181 (89.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 52 0.00% 20 201 0.00% 21 510 0.00% 22 736 0.00% 23 394 0.00% 24 349 0.00% 25 442 0.00% 26 681 0.00% 27 945 0.00% 28 1313 0.00% 29 1752 0.01% 30 2147 0.01% 31 2462 0.01% 32 2626 0.01% 33 2600 0.01% 34 2609 0.01% 35 2656 0.01% 36 2961 0.01% 37 3331 0.01% 38 3898 0.01% 39 4382 0.01% 40 5248 0.02% 41 6314 0.02% 42 7214 0.02% 43 7419 0.03% 44 6858 0.02% 45 6910 0.02% 46 7369 0.03% 47 8229 0.03% 48 8962 0.03% 49 9761 0.03% 50 11187 0.04% 51 12378 0.04% 52 13414 0.05% 53 14185 0.05% 54 15181 0.05% 55 15672 0.05% 56 16287 0.06% 57 17287 0.06% 58 19037 0.07% 59 20819 0.07% 60 22053 0.08% 61 24601 0.08% 62 26719 0.09% 63 28490 0.10% 64 29605 0.10% 65 31070 0.11% 66 32197 0.11% 67 33768 0.12% 68 35765 0.12% 69 37109 0.13% 70 40035 0.14% 71 42142 0.14% 72 45782 0.16% 73 47671 0.16% 74 50444 0.17% 75 52247 0.18% 76 54132 0.19% 77 55868 0.19% 78 57287 0.20% 79 60911 0.21% 80 62449 0.21% 81 65881 0.23% 82 69265 0.24% 83 71990 0.25% 84 74796 0.26% 85 78271 0.27% 86 79969 0.27% 87 81923 0.28% 88 85509 0.29% 89 88117 0.30% 90 91073 0.31% 91 94367 0.32% 92 99550 0.34% 93 100739 0.34% 94 105124 0.36% 95 107759 0.37% 96 110257 0.38% 97 113127 0.39% 98 114554 0.39% 99 116686 0.40% 100 133943 0.46% 101 26239181 89.68% 29259235 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=150.36 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=19.9 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=18 prefix-density=0.19 prefix-fanout=2.5 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=190.62 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=21.7 sequence=CGGCGGCGGCGA ERR3450077 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:49:50 Started mapping on | Dec 07 14:49:50 Finished on | Dec 07 14:53:26 Mapping speed, Million of reads per hour | 487.65 Number of input reads | 29259235 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 22796279 Uniquely mapped reads % | 77.91% Average mapped length | 197.63 Number of splices: Total | 14390473 Number of splices: Annotated (sjdb) | 13641717 Number of splices: GT/AG | 14203363 Number of splices: GC/AG | 162667 Number of splices: AT/AC | 8469 Number of splices: Non-canonical | 15974 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1498219 % of reads mapped to multiple loci | 5.12% Number of reads mapped to too many loci | 816055 % of reads mapped to too many loci | 2.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 11.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4964737 4964737 4964737 N_multimapping 1498219 1498219 1498219 N_noFeature 730181 21935437 1256052 N_ambiguous 408801 3538 77481 UnstrandedReadsAssigned:21657297 PositiveStrandReadsAssigned:857304 NegativeStrandReadsAssigned:21462746 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450077 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450077-trimmed-pair1.fastq ERR3450077-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,259,235 reads, 22,710,728 reads pseudoaligned [quant] estimated average fragment length: 184.376 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,279 rounds 52973 ERR3450077.ke.tsv 35125 ERR3450077.se.tsv 88098 total ==> ERR3450077.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.795 0 0 PNS24247 1044 860.624 48.6959 3.79957 PNS24249 1928 1744.62 236.997 9.12213 PNS24246 1044 860.624 48.6959 3.79957 PNS24248 1044 860.624 48.6959 3.79957 PNS24244 1471 1287.62 77.9153 4.06339 PNS24243 293 130.905 0 0 KQK14069 1603 1419.62 3960.97 187.363 KQK14071 474 294.458 165.334 37.7044 ==> ERR3450077.se.tsv <== BRADI_1g14170v3 4185 BRADI_1g53295v3 42 BRADI_1g59795v3 238 BRADI_1g07683v3 4 BRADI_1g00485v3 55 BRADI_1g20270v3 2471 BRADI_1g74790v3 257 BRADI_1g09890v3 9 BRADI_1g77505v3 301 BRADI_1g48960v3 0 ERR3450077 completed mapping pipeline successfully