Starting /dee2/code/volunteer_pipeline.sh ERR3450079 current disk space = 1542881456128 free memory = 1599166752 ERR3450079 SRAfilesize 907a4dc4ce4e0d685d4dbd2a5d3464f5 ERR3450079.sra ERR3450079.sra file validated ERR3450079 is paired end ERR3450079 is conventional basespace ERR3450079 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450079_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0275 37.0 37.0 37.0 37.0 37.0 2 36.1255 37.0 37.0 37.0 37.0 37.0 3 36.3435 37.0 37.0 37.0 37.0 37.0 4 36.4165 37.0 37.0 37.0 37.0 37.0 5 36.526 37.0 37.0 37.0 37.0 37.0 6 36.5405 37.0 37.0 37.0 37.0 37.0 7 36.4625 37.0 37.0 37.0 37.0 37.0 8 36.3925 37.0 37.0 37.0 37.0 37.0 9 36.4245 37.0 37.0 37.0 37.0 37.0 10-11 36.515249999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.497749999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.388000000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.42075 37.0 37.0 37.0 37.0 37.0 18-19 36.442 37.0 37.0 37.0 37.0 37.0 20-21 36.39075 37.0 37.0 37.0 37.0 37.0 22-23 36.464749999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.36275 37.0 37.0 37.0 37.0 37.0 26-27 36.348749999999995 37.0 37.0 37.0 37.0 37.0 28-29 36.301500000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.31675 37.0 37.0 37.0 37.0 37.0 32-33 36.37075 37.0 37.0 37.0 37.0 37.0 34-35 36.338499999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.328500000000005 37.0 37.0 37.0 37.0 37.0 38-39 36.306 37.0 37.0 37.0 37.0 37.0 40-41 36.26175 37.0 37.0 37.0 37.0 37.0 42-43 36.324749999999995 37.0 37.0 37.0 37.0 37.0 44-45 36.24275 37.0 37.0 37.0 37.0 37.0 46-47 36.2455 37.0 37.0 37.0 37.0 37.0 48-49 36.1485 37.0 37.0 37.0 37.0 37.0 50-51 36.192750000000004 37.0 37.0 37.0 37.0 37.0 52-53 36.205749999999995 37.0 37.0 37.0 37.0 37.0 54-55 36.1905 37.0 37.0 37.0 37.0 37.0 56-57 36.04975 37.0 37.0 37.0 37.0 37.0 58-59 36.147999999999996 37.0 37.0 37.0 37.0 37.0 60-61 36.17275 37.0 37.0 37.0 37.0 37.0 62-63 36.120000000000005 37.0 37.0 37.0 37.0 37.0 64-65 36.126000000000005 37.0 37.0 37.0 37.0 37.0 66-67 36.1225 37.0 37.0 37.0 37.0 37.0 68-69 36.0595 37.0 37.0 37.0 37.0 37.0 70-71 36.03125 37.0 37.0 37.0 37.0 37.0 72-73 36.05175 37.0 37.0 37.0 37.0 37.0 74-75 36.044250000000005 37.0 37.0 37.0 37.0 37.0 76-77 36.0325 37.0 37.0 37.0 37.0 37.0 78-79 35.995000000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.988 37.0 37.0 37.0 37.0 37.0 82-83 35.93925 37.0 37.0 37.0 37.0 37.0 84-85 35.94499999999999 37.0 37.0 37.0 37.0 37.0 86-87 35.9865 37.0 37.0 37.0 37.0 37.0 88-89 36.00075 37.0 37.0 37.0 37.0 37.0 90-91 35.92075 37.0 37.0 37.0 37.0 37.0 92-93 35.96625 37.0 37.0 37.0 37.0 37.0 94-95 35.84 37.0 37.0 37.0 37.0 37.0 96-97 35.88675 37.0 37.0 37.0 37.0 37.0 98-99 35.963499999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.881249999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 2.0 24 5.0 25 10.0 26 11.0 27 16.0 28 24.0 29 45.0 30 44.0 31 44.0 32 78.0 33 67.0 34 114.0 35 211.0 36 1719.0 37 1607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.43674698795181 9.387550200803213 10.993975903614457 39.18172690763052 2 23.175 12.6 30.075000000000003 34.150000000000006 3 22.25 17.025000000000002 23.724999999999998 37.0 4 26.974999999999998 22.95 18.375 31.7 5 27.05 27.275 22.5 23.175 6 23.200000000000003 31.374999999999996 24.0 21.425 7 19.650000000000002 23.275000000000002 37.574999999999996 19.5 8 22.2 22.2 28.749999999999996 26.85 9 22.15 20.825 32.85 24.175 10-11 24.4125 29.25 22.35 23.9875 12-13 23.5625 22.6 26.2125 27.625 14-15 22.825 25.1875 26.724999999999998 25.2625 16-17 24.6875 24.075 25.55 25.687500000000004 18-19 24.4 25.4375 25.25 24.9125 20-21 24.45 24.6 25.0375 25.912499999999998 22-23 22.55 25.662499999999998 24.6875 27.1 24-25 24.099999999999998 25.124999999999996 24.2625 26.5125 26-27 24.0375 24.4875 24.8 26.674999999999997 28-29 24.55 23.9 24.775 26.775 30-31 23.6125 24.0625 25.4875 26.8375 32-33 23.974999999999998 24.349999999999998 25.724999999999998 25.95 34-35 25.9875 23.474999999999998 24.95 25.587500000000002 36-37 24.075 24.2 24.875 26.85 38-39 24.099999999999998 23.6375 25.2375 27.025 40-41 23.962500000000002 24.3875 24.0125 27.6375 42-43 25.687500000000004 24.2375 24.3125 25.7625 44-45 25.4375 23.025000000000002 24.825 26.7125 46-47 24.9 24.0125 24.762500000000003 26.325 48-49 23.4875 24.65 24.075 27.787499999999998 50-51 22.912499999999998 25.0375 24.55 27.500000000000004 52-53 25.162499999999998 24.099999999999998 23.7625 26.974999999999998 54-55 23.6875 24.975 24.712500000000002 26.625 56-57 24.975 23.325000000000003 24.5125 27.187499999999996 58-59 23.9 24.224999999999998 24.9875 26.887499999999996 60-61 25.1875 24.474999999999998 23.65 26.687499999999996 62-63 26.1 23.0375 23.6375 27.224999999999998 64-65 24.5 23.6875 25.0375 26.775 66-67 23.799999999999997 24.224999999999998 24.3875 27.5875 68-69 25.025 23.9875 24.2875 26.700000000000003 70-71 24.637500000000003 24.0 23.674999999999997 27.6875 72-73 25.05 24.637500000000003 24.0125 26.3 74-75 25.75 24.275 23.3625 26.6125 76-77 24.6875 23.9875 24.55 26.775 78-79 26.1 23.962500000000002 23.9875 25.95 80-81 26.150000000000002 25.05 21.8 27.0 82-83 26.35 23.4625 24.1125 26.075 84-85 26.150000000000002 23.599999999999998 23.3375 26.9125 86-87 26.05 23.799999999999997 24.175 25.974999999999998 88-89 25.1 24.0 23.825 27.075 90-91 25.0 22.775000000000002 24.4125 27.8125 92-93 25.05 23.75 23.474999999999998 27.725 94-95 25.374999999999996 24.125 23.9125 26.5875 96-97 24.975 23.5375 24.55 26.937499999999996 98-99 25.2375 23.9 23.275000000000002 27.5875 100-101 24.8625 24.9375 23.5875 26.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.5 2 1.0 3 0.5 4 0.0 5 1.5 6 3.5 7 3.0 8 1.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 0.5 23 0.0 24 0.5 25 1.0 26 2.0 27 1.5 28 0.0 29 1.5 30 5.5 31 9.5 32 9.5 33 11.0 34 15.0 35 20.5 36 26.0 37 35.5 38 46.0 39 65.5 40 97.0 41 110.0 42 123.5 43 156.5 44 169.0 45 171.0 46 184.0 47 188.0 48 177.0 49 170.5 50 171.0 51 154.0 52 135.5 53 136.5 54 124.5 55 123.5 56 118.0 57 94.0 58 98.0 59 97.5 60 79.0 61 73.5 62 72.5 63 65.5 64 62.0 65 58.5 66 51.5 67 52.0 68 59.0 69 59.5 70 52.0 71 42.0 72 38.0 73 34.0 74 29.5 75 27.0 76 20.5 77 11.0 78 11.0 79 9.5 80 5.0 81 4.5 82 3.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.175 #Duplication Level Percentage of deduplicated Percentage of total 1 87.89790650989389 76.625 2 10.352738743905936 18.05 3 1.204473759678807 3.15 4 0.3728133065672498 1.3 5 0.14338973329509608 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028677946659019213 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit GGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGC 5 0.125 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 5 0.125 No Hit GCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTA 5 0.125 No Hit CAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCT 5 0.125 No Hit GCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.275 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.475 0.0 0.0 0.0 0.0 62-63 0.525 0.0 0.0 0.0 0.0 64-65 0.5874999999999999 0.0 0.0 0.0 0.0 66-67 0.6375 0.0 0.0 0.0 0.0 68-69 0.7125 0.0 0.0 0.0 0.0 70-71 0.8125 0.0 0.0 0.0 0.0 72-73 0.875 0.0 0.0 0.0 0.0 74-75 1.0125 0.0 0.0 0.0 0.0 76-77 1.15 0.0 0.0 0.0 0.0 78-79 1.3625 0.0 0.0 0.0 0.0 80-81 1.65 0.0 0.0 0.0 0.0 82-83 1.9625 0.0 0.0 0.0 0.0 84-85 2.2375 0.0 0.0 0.0 0.0 86-87 2.6 0.0 0.0 0.0 0.0 88-89 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450079 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450079_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.133 37.0 37.0 37.0 37.0 37.0 2 36.0695 37.0 37.0 37.0 37.0 37.0 3 36.159 37.0 37.0 37.0 37.0 37.0 4 36.1035 37.0 37.0 37.0 37.0 37.0 5 36.2675 37.0 37.0 37.0 37.0 37.0 6 36.2315 37.0 37.0 37.0 37.0 37.0 7 36.2435 37.0 37.0 37.0 37.0 37.0 8 36.225 37.0 37.0 37.0 37.0 37.0 9 36.2595 37.0 37.0 37.0 37.0 37.0 10-11 36.22775 37.0 37.0 37.0 37.0 37.0 12-13 36.181 37.0 37.0 37.0 37.0 37.0 14-15 36.26275 37.0 37.0 37.0 37.0 37.0 16-17 36.210499999999996 37.0 37.0 37.0 37.0 37.0 18-19 36.1805 37.0 37.0 37.0 37.0 37.0 20-21 36.1365 37.0 37.0 37.0 37.0 37.0 22-23 36.126000000000005 37.0 37.0 37.0 37.0 37.0 24-25 36.13375 37.0 37.0 37.0 37.0 37.0 26-27 36.113249999999994 37.0 37.0 37.0 37.0 37.0 28-29 36.19175 37.0 37.0 37.0 37.0 37.0 30-31 36.1305 37.0 37.0 37.0 37.0 37.0 32-33 36.080749999999995 37.0 37.0 37.0 37.0 37.0 34-35 36.062 37.0 37.0 37.0 37.0 37.0 36-37 36.09525 37.0 37.0 37.0 37.0 37.0 38-39 36.136250000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.016999999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.0565 37.0 37.0 37.0 37.0 37.0 44-45 36.02275 37.0 37.0 37.0 37.0 37.0 46-47 36.028999999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.042 37.0 37.0 37.0 37.0 37.0 50-51 36.039 37.0 37.0 37.0 37.0 37.0 52-53 36.103 37.0 37.0 37.0 37.0 37.0 54-55 36.05475 37.0 37.0 37.0 37.0 37.0 56-57 36.16674999999999 37.0 37.0 37.0 37.0 37.0 58-59 36.0075 37.0 37.0 37.0 37.0 37.0 60-61 35.98375 37.0 37.0 37.0 37.0 37.0 62-63 36.015249999999995 37.0 37.0 37.0 37.0 37.0 64-65 36.0135 37.0 37.0 37.0 37.0 37.0 66-67 35.92575 37.0 37.0 37.0 37.0 37.0 68-69 35.982749999999996 37.0 37.0 37.0 37.0 37.0 70-71 35.94799999999999 37.0 37.0 37.0 37.0 37.0 72-73 35.96425 37.0 37.0 37.0 37.0 37.0 74-75 35.89675 37.0 37.0 37.0 37.0 37.0 76-77 35.94 37.0 37.0 37.0 37.0 37.0 78-79 35.86525 37.0 37.0 37.0 37.0 37.0 80-81 35.879999999999995 37.0 37.0 37.0 37.0 37.0 82-83 35.855000000000004 37.0 37.0 37.0 37.0 37.0 84-85 35.872749999999996 37.0 37.0 37.0 37.0 37.0 86-87 35.9165 37.0 37.0 37.0 37.0 37.0 88-89 35.897999999999996 37.0 37.0 37.0 37.0 37.0 90-91 35.827 37.0 37.0 37.0 37.0 37.0 92-93 35.83475 37.0 37.0 37.0 37.0 37.0 94-95 35.81699999999999 37.0 37.0 37.0 37.0 37.0 96-97 35.7685 37.0 37.0 37.0 37.0 37.0 98-99 35.73525 37.0 37.0 37.0 37.0 37.0 100-101 35.769999999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 5.0 16 5.0 17 6.0 18 6.0 19 4.0 20 2.0 21 11.0 22 14.0 23 10.0 24 12.0 25 14.0 26 11.0 27 18.0 28 17.0 29 21.0 30 21.0 31 39.0 32 59.0 33 56.0 34 81.0 35 197.0 36 1975.0 37 1413.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 16.525000000000002 12.6 30.25 2 25.85 23.65 25.35 25.15 3 25.650000000000002 23.674999999999997 25.674999999999997 25.0 4 30.875000000000004 27.575 17.525 24.025 5 29.425 30.375000000000004 18.3 21.9 6 24.4 31.275 20.724999999999998 23.599999999999998 7 24.775 19.325 31.8 24.099999999999998 8 24.9 21.825 23.549999999999997 29.725 9 26.525 21.0 24.775 27.700000000000003 10-11 28.5875 26.737499999999997 19.6 25.074999999999996 12-13 28.375 21.45 22.85 27.325 14-15 26.724999999999998 24.587500000000002 23.35 25.337500000000002 16-17 27.762500000000003 24.4375 23.2375 24.5625 18-19 27.275 23.8875 23.525 25.3125 20-21 26.337500000000002 24.462500000000002 23.6375 25.5625 22-23 27.775 24.2 23.05 24.975 24-25 27.05 24.65 22.6875 25.6125 26-27 27.8875 24.2 22.2125 25.7 28-29 26.6125 26.55 22.287499999999998 24.55 30-31 27.125 23.925 22.8875 26.0625 32-33 26.9125 25.025 23.125 24.9375 34-35 27.075 24.3 23.1375 25.4875 36-37 27.025 24.962500000000002 22.75 25.2625 38-39 26.6 25.5 22.925 24.975 40-41 27.8375 24.5375 22.6375 24.9875 42-43 26.650000000000002 23.8875 23.3625 26.1 44-45 26.787499999999998 23.925 23.974999999999998 25.3125 46-47 27.0625 24.0 22.45 26.487500000000004 48-49 27.4125 25.337500000000002 22.2625 24.9875 50-51 26.4625 25.4625 22.6125 25.4625 52-53 27.5125 24.3875 23.1 25.0 54-55 27.35 24.525 23.150000000000002 24.975 56-57 28.4125 24.212500000000002 22.5 24.875 58-59 27.437499999999996 24.425 23.1875 24.95 60-61 27.425 25.0375 22.725 24.8125 62-63 27.3375 24.175 23.8375 24.65 64-65 27.224999999999998 24.6125 22.9625 25.2 66-67 26.387500000000003 25.5375 23.5625 24.5125 68-69 27.237499999999997 25.0625 22.4375 25.2625 70-71 27.237499999999997 23.4375 23.6375 25.687500000000004 72-73 27.0125 25.2625 22.95 24.775 74-75 27.35 24.8125 22.75 25.087500000000002 76-77 27.825 24.1625 23.1625 24.85 78-79 26.325 24.212500000000002 22.900000000000002 26.5625 80-81 26.7625 25.650000000000002 22.825 24.762500000000003 82-83 27.462500000000002 24.474999999999998 23.5625 24.5 84-85 27.650000000000002 23.799999999999997 23.625 24.925 86-87 27.1375 25.575 22.875 24.4125 88-89 27.85 24.425 23.2125 24.5125 90-91 27.625 25.7375 22.6 24.0375 92-93 27.0875 26.2875 22.15 24.474999999999998 94-95 28.237499999999997 24.725 23.0625 23.974999999999998 96-97 28.125 24.925 22.6375 24.3125 98-99 27.500000000000004 24.25 24.212500000000002 24.0375 100-101 28.5875 24.887500000000003 22.225 24.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.5 3 1.0 4 1.5 5 1.5 6 1.5 7 2.5 8 1.5 9 1.5 10 2.0 11 0.5 12 0.0 13 1.0 14 2.0 15 2.0 16 3.0 17 3.0 18 3.5 19 3.5 20 2.0 21 1.5 22 1.5 23 1.5 24 1.5 25 2.5 26 2.0 27 1.0 28 2.5 29 2.5 30 2.5 31 4.0 32 4.5 33 5.0 34 8.0 35 15.0 36 24.5 37 36.0 38 55.0 39 85.0 40 99.5 41 93.5 42 109.5 43 133.5 44 155.0 45 162.5 46 177.0 47 182.0 48 159.0 49 163.0 50 155.0 51 133.5 52 135.5 53 136.5 54 125.5 55 110.0 56 97.5 57 90.5 58 99.5 59 99.0 60 85.0 61 80.5 62 76.5 63 69.0 64 66.0 65 69.0 66 69.0 67 77.0 68 77.0 69 64.0 70 53.5 71 49.0 72 44.0 73 38.5 74 33.5 75 31.0 76 26.5 77 19.0 78 14.0 79 11.0 80 8.0 81 5.5 82 5.0 83 3.0 84 1.5 85 1.5 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.5 92 2.0 93 1.5 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.1 #Duplication Level Percentage of deduplicated Percentage of total 1 88.59250851305335 78.05 2 9.875141884222474 17.4 3 1.191827468785471 3.15 4 0.19863791146424517 0.7000000000000001 5 0.0851305334846765 0.375 6 0.028376844494892167 0.15 7 0.028376844494892167 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGT 5 0.125 No Hit GGGACTTATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAG 5 0.125 No Hit GATGTCTTCCGCCTTTTTCATGCCGCAGAGGAATGAATCGATCACGGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.475 0.0 0.0 0.0 0.0 62-63 0.525 0.0 0.0 0.0 0.0 64-65 0.6 0.0 0.0 0.0 0.0 66-67 0.6625000000000001 0.0 0.0 0.0 0.0 68-69 0.7625 0.0 0.0 0.0 0.0 70-71 0.8625 0.0 0.0 0.0 0.0 72-73 0.925 0.0 0.0 0.0 0.0 74-75 1.0625 0.0 0.0 0.0 0.0 76-77 1.2125 0.0 0.0 0.0 0.0 78-79 1.4375 0.0 0.0 0.0 0.0 80-81 1.725 0.0 0.0 0.0 0.0 82-83 2.0375 0.0 0.0 0.0 0.0 84-85 2.3125 0.0 0.0 0.0 0.0 86-87 2.675 0.0 0.0 0.0 0.0 88-89 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGGGG 15 6.142176E-4 95.0 8 CCCGGGG 20 0.0019257745 71.25 7 CCCCGGG 20 0.0019257745 71.25 6 CCCCCCG 20 0.0019257745 71.25 4 CCCCCGG 25 0.0046641747 57.0 5 TCATGGA 15 0.009957196 47.5 80-81 >>END_MODULE Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra Read 2071035 spots for ERR3450079.sra Written 2071035 spots for ERR3450079.sra SRR ids: ['ERR3450079.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kcnnarc9 ERR3450079.sra spots: 41420700 blocks: [[1, 2071035], [2071036, 4142070], [4142071, 6213105], [6213106, 8284140], [8284141, 10355175], [10355176, 12426210], [12426211, 14497245], [14497246, 16568280], [16568281, 18639315], [18639316, 20710350], [20710351, 22781385], [22781386, 24852420], [24852421, 26923455], [26923456, 28994490], [28994491, 31065525], [31065526, 33136560], [33136561, 35207595], [35207596, 37278630], [37278631, 39349665], [39349666, 41420700]] ERR3450079 file size 9969425 ERR3450079 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450079 ERR3450079_1.fastq ERR3450079_2.fastq Input file: ERR3450079_1.fastq Paired file: ERR3450079_2.fastq trimmed: ERR3450079-trimmed-pair1.fastq, ERR3450079-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:50:02 2024 >> started Sat Dec 7 14:50:41 2024 >> done (39.823s) 41420700 read pairs processed; of these: 276 ( 0.00%) short read pairs filtered out after trimming by size control 36427 ( 0.09%) empty read pairs filtered out after trimming by size control 41383997 (99.91%) read pairs available; of these: 2533115 ( 6.12%) trimmed read pairs available after processing 38850882 (93.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 36 0.00% 20 88 0.00% 21 232 0.00% 22 334 0.00% 23 162 0.00% 24 171 0.00% 25 237 0.00% 26 312 0.00% 27 486 0.00% 28 638 0.00% 29 822 0.00% 30 1033 0.00% 31 1254 0.00% 32 1190 0.00% 33 1266 0.00% 34 1269 0.00% 35 1334 0.00% 36 1479 0.00% 37 1665 0.00% 38 1911 0.00% 39 2318 0.01% 40 2692 0.01% 41 3138 0.01% 42 3602 0.01% 43 3937 0.01% 44 3537 0.01% 45 3690 0.01% 46 3959 0.01% 47 4299 0.01% 48 4880 0.01% 49 5556 0.01% 50 6098 0.01% 51 7153 0.02% 52 7787 0.02% 53 8125 0.02% 54 8862 0.02% 55 9532 0.02% 56 10129 0.02% 57 10839 0.03% 58 12036 0.03% 59 12908 0.03% 60 14158 0.03% 61 15873 0.04% 62 17333 0.04% 63 18895 0.05% 64 20149 0.05% 65 21016 0.05% 66 22277 0.05% 67 23489 0.06% 68 25444 0.06% 69 26775 0.06% 70 28822 0.07% 71 30867 0.07% 72 33652 0.08% 73 36195 0.09% 74 38043 0.09% 75 40126 0.10% 76 41994 0.10% 77 43808 0.11% 78 46473 0.11% 79 49323 0.12% 80 51776 0.13% 81 54100 0.13% 82 57747 0.14% 83 60152 0.15% 84 63194 0.15% 85 66923 0.16% 86 68441 0.17% 87 72593 0.18% 88 75234 0.18% 89 78500 0.19% 90 81760 0.20% 91 86580 0.21% 92 90328 0.22% 93 93967 0.23% 94 98523 0.24% 95 101729 0.25% 96 104458 0.25% 97 108425 0.26% 98 111332 0.27% 99 114253 0.28% 100 147369 0.36% 101 38850882 93.88% 41383997 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.15 prefix-fanout=2.0 sequence=CCCACTTGGAGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=242.75 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=21.7 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.85 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=3.8 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=342.21 fanout-score-rank=1 prefix-density=1.25 prefix-fanout=21.2 sequence=CGCCGCCGCCAT ERR3450079 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:51:20 Started mapping on | Dec 07 14:51:20 Finished on | Dec 07 14:54:13 Mapping speed, Million of reads per hour | 861.17 Number of input reads | 41383997 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 33683656 Uniquely mapped reads % | 81.39% Average mapped length | 199.44 Number of splices: Total | 21758216 Number of splices: Annotated (sjdb) | 20620430 Number of splices: GT/AG | 21472063 Number of splices: GC/AG | 246467 Number of splices: AT/AC | 14652 Number of splices: Non-canonical | 25034 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1465739 % of reads mapped to multiple loci | 3.54% Number of reads mapped to too many loci | 861084 % of reads mapped to too many loci | 2.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 9.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6234602 6234602 6234602 N_multimapping 1465739 1465739 1465739 N_noFeature 1002395 32510461 1680081 N_ambiguous 599916 5095 109306 UnstrandedReadsAssigned:32081345 PositiveStrandReadsAssigned:1168100 NegativeStrandReadsAssigned:31894269 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450079 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450079-trimmed-pair1.fastq ERR3450079-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,383,997 reads, 33,346,973 reads pseudoaligned [quant] estimated average fragment length: 196.78 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52973 ERR3450079.ke.tsv 35125 ERR3450079.se.tsv 88098 total ==> ERR3450079.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.463 0 0 PNS24247 1044 848.22 82.6306 4.46715 PNS24249 1928 1732.22 422.311 11.1796 PNS24246 1044 848.22 82.6306 4.46715 PNS24248 1044 848.22 82.6306 4.46715 PNS24244 1471 1275.22 102.797 3.69653 PNS24243 293 120.822 0 0 KQK14069 1603 1407.22 8842.89 288.158 KQK14071 474 282.752 385.183 62.4683 ==> ERR3450079.se.tsv <== BRADI_1g14170v3 9504 BRADI_1g53295v3 83 BRADI_1g59795v3 456 BRADI_1g07683v3 0 BRADI_1g00485v3 92 BRADI_1g20270v3 5196 BRADI_1g74790v3 272 BRADI_1g09890v3 32 BRADI_1g77505v3 497 BRADI_1g48960v3 0 ERR3450079 completed mapping pipeline successfully