Starting /dee2/code/volunteer_pipeline.sh ERR3450082 current disk space = 1542845173760 free memory = 1596914600 ERR3450082 SRAfilesize df91a0be6bd17224d542e686e15d97fb ERR3450082.sra ERR3450082.sra file validated ERR3450082 is paired end ERR3450082 is conventional basespace ERR3450082 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31925 37.0 37.0 37.0 37.0 37.0 2 36.2985 37.0 37.0 37.0 37.0 37.0 3 36.4555 37.0 37.0 37.0 37.0 37.0 4 36.4375 37.0 37.0 37.0 37.0 37.0 5 36.446 37.0 37.0 37.0 37.0 37.0 6 36.5295 37.0 37.0 37.0 37.0 37.0 7 36.424 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.48 37.0 37.0 37.0 37.0 37.0 10-11 36.4775 37.0 37.0 37.0 37.0 37.0 12-13 36.46575 37.0 37.0 37.0 37.0 37.0 14-15 36.424 37.0 37.0 37.0 37.0 37.0 16-17 36.4315 37.0 37.0 37.0 37.0 37.0 18-19 36.429249999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.37925 37.0 37.0 37.0 37.0 37.0 22-23 36.426 37.0 37.0 37.0 37.0 37.0 24-25 36.43875 37.0 37.0 37.0 37.0 37.0 26-27 36.39425 37.0 37.0 37.0 37.0 37.0 28-29 36.3505 37.0 37.0 37.0 37.0 37.0 30-31 36.381 37.0 37.0 37.0 37.0 37.0 32-33 36.282 37.0 37.0 37.0 37.0 37.0 34-35 36.321 37.0 37.0 37.0 37.0 37.0 36-37 36.259249999999994 37.0 37.0 37.0 37.0 37.0 38-39 36.29175 37.0 37.0 37.0 37.0 37.0 40-41 36.275999999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.26775 37.0 37.0 37.0 37.0 37.0 44-45 36.2575 37.0 37.0 37.0 37.0 37.0 46-47 36.14775 37.0 37.0 37.0 37.0 37.0 48-49 36.07925 37.0 37.0 37.0 37.0 37.0 50-51 36.03975 37.0 37.0 37.0 37.0 37.0 52-53 36.0245 37.0 37.0 37.0 37.0 37.0 54-55 36.05825 37.0 37.0 37.0 37.0 37.0 56-57 35.994749999999996 37.0 37.0 37.0 37.0 37.0 58-59 36.045 37.0 37.0 37.0 37.0 37.0 60-61 36.00125 37.0 37.0 37.0 37.0 37.0 62-63 36.008 37.0 37.0 37.0 37.0 37.0 64-65 35.91775 37.0 37.0 37.0 37.0 37.0 66-67 35.89425 37.0 37.0 37.0 37.0 37.0 68-69 35.89125 37.0 37.0 37.0 37.0 37.0 70-71 35.97425 37.0 37.0 37.0 37.0 37.0 72-73 36.06725 37.0 37.0 37.0 37.0 37.0 74-75 36.098 37.0 37.0 37.0 37.0 37.0 76-77 36.06525 37.0 37.0 37.0 37.0 37.0 78-79 35.988749999999996 37.0 37.0 37.0 37.0 37.0 80-81 35.94875 37.0 37.0 37.0 37.0 37.0 82-83 35.92700000000001 37.0 37.0 37.0 37.0 37.0 84-85 35.86775 37.0 37.0 37.0 37.0 37.0 86-87 35.901 37.0 37.0 37.0 37.0 37.0 88-89 35.82625 37.0 37.0 37.0 37.0 37.0 90-91 35.8535 37.0 37.0 37.0 37.0 37.0 92-93 35.7405 37.0 37.0 37.0 37.0 37.0 94-95 35.77525 37.0 37.0 37.0 37.0 37.0 96-97 35.8795 37.0 37.0 37.0 37.0 37.0 98-99 35.67175 37.0 37.0 37.0 37.0 37.0 100-101 35.6015 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 14.0 25 11.0 26 9.0 27 22.0 28 34.0 29 27.0 30 44.0 31 73.0 32 64.0 33 80.0 34 116.0 35 190.0 36 1729.0 37 1585.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.78716470293307 9.125094008523439 10.554023564803208 39.53371772374029 2 22.650000000000002 14.374999999999998 28.575 34.4 3 22.325 16.825000000000003 25.1 35.75 4 27.275 22.1 18.625 32.0 5 27.375 26.950000000000003 21.9 23.775 6 23.375 31.25 23.325000000000003 22.05 7 19.650000000000002 23.474999999999998 38.2 18.675 8 21.475 22.1 29.65 26.775 9 22.675 21.224999999999998 30.8 25.3 10-11 23.8125 28.487499999999997 22.9625 24.7375 12-13 22.85 22.45 25.7625 28.9375 14-15 23.9875 24.275 25.85 25.887500000000003 16-17 24.0 24.9125 25.387500000000003 25.7 18-19 24.6125 24.575 25.637500000000003 25.174999999999997 20-21 25.4875 24.637500000000003 24.4 25.474999999999998 22-23 24.275 25.474999999999998 24.1375 26.1125 24-25 24.7375 24.525 23.974999999999998 26.7625 26-27 24.9375 24.5 24.25 26.3125 28-29 25.074999999999996 24.425 24.224999999999998 26.275 30-31 23.974999999999998 24.725 24.4125 26.887499999999996 32-33 24.337500000000002 25.45 23.075000000000003 27.1375 34-35 24.1625 24.4375 24.1375 27.2625 36-37 24.675 24.212500000000002 23.974999999999998 27.1375 38-39 23.325000000000003 24.2 25.624999999999996 26.85 40-41 24.875 24.212500000000002 24.2875 26.625 42-43 24.3625 24.4375 25.85 25.35 44-45 24.95 23.5375 25.025 26.487500000000004 46-47 24.9375 23.8375 23.35 27.875 48-49 24.587500000000002 23.9125 24.3 27.200000000000003 50-51 24.4875 24.625 24.5 26.387500000000003 52-53 25.0625 23.875 23.974999999999998 27.0875 54-55 25.5375 23.6375 24.1625 26.6625 56-57 24.325 24.1125 25.6 25.9625 58-59 24.575 24.3125 24.762500000000003 26.35 60-61 25.4 24.087500000000002 24.0625 26.450000000000003 62-63 25.7875 23.3875 24.725 26.1 64-65 25.724999999999998 23.325000000000003 24.087500000000002 26.8625 66-67 23.5 24.9875 24.8 26.7125 68-69 25.3 24.087500000000002 24.075 26.5375 70-71 25.35 24.087500000000002 23.7875 26.775 72-73 25.624999999999996 24.1375 23.775 26.4625 74-75 25.874999999999996 23.325000000000003 23.6625 27.1375 76-77 25.4375 24.7375 23.125 26.700000000000003 78-79 25.3125 24.887500000000003 23.7125 26.087500000000002 80-81 25.912499999999998 24.15 24.212500000000002 25.724999999999998 82-83 25.7875 24.474999999999998 23.0125 26.724999999999998 84-85 26.25 23.5375 22.5875 27.625 86-87 25.4 25.337500000000002 22.725 26.5375 88-89 25.112499999999997 23.45 23.9375 27.500000000000004 90-91 25.6 24.587500000000002 22.6125 27.200000000000003 92-93 25.474999999999998 24.3 25.074999999999996 25.15 94-95 26.375 23.674999999999997 22.650000000000002 27.3 96-97 25.7125 25.0375 22.85 26.400000000000002 98-99 25.6125 25.1 23.425 25.8625 100-101 25.8125 25.7875 21.912499999999998 26.487500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 6.0 2 1.5 3 1.0 4 2.0 5 1.5 6 2.0 7 2.0 8 0.5 9 0.5 10 0.5 11 0.5 12 1.5 13 1.5 14 0.5 15 0.0 16 0.5 17 1.5 18 2.0 19 1.0 20 1.0 21 3.5 22 3.0 23 1.5 24 2.0 25 1.0 26 0.5 27 1.0 28 2.0 29 4.0 30 4.0 31 5.5 32 8.0 33 7.5 34 12.5 35 16.0 36 26.0 37 45.0 38 54.5 39 59.0 40 75.5 41 104.0 42 120.0 43 133.0 44 152.0 45 164.5 46 176.0 47 173.0 48 164.5 49 177.5 50 178.0 51 163.0 52 145.5 53 130.0 54 137.0 55 145.0 56 131.5 57 110.0 58 113.5 59 102.0 60 88.0 61 87.5 62 76.0 63 70.0 64 59.5 65 53.0 66 53.5 67 57.5 68 55.0 69 45.5 70 48.0 71 44.0 72 31.5 73 26.5 74 20.0 75 22.5 76 24.0 77 15.0 78 8.5 79 7.5 80 7.0 81 5.5 82 3.5 83 2.5 84 2.5 85 1.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.92087190206031 71.1 2 12.123021797551507 20.3 3 2.3290534487906838 5.8500000000000005 4 0.2388772767990445 0.8 5 0.2388772767990445 1.0 6 0.08957897879964169 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.059719319199761124 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 10 0.25 TruSeq Adapter, Index 7 (97% over 36bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit GCAGGCTGAGGTCTCGTTCGTTAACGGAATTAACCAGACAAATCGCTCCA 6 0.15 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit CCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGC 6 0.15 No Hit CGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTTT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) CACGGCAGGTTGGACGGGTTCCGGTCAGAAACCACCTTGATCACCTTCCC 5 0.125 No Hit GTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTA 5 0.125 No Hit GCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCG 5 0.125 No Hit ACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTC 5 0.125 No Hit GTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGC 5 0.125 No Hit ACAATACAATCTAAATCAGCAAATCACTGGAACCCGTGGCTTTGGCGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.21250000000000002 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.3125 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.45 0.0 0.0 0.0 0.0 48-49 0.5375000000000001 0.0 0.0 0.0 0.0 50-51 0.625 0.0 0.0 0.0 0.0 52-53 0.7875 0.0 0.0 0.0 0.0 54-55 0.9125000000000001 0.0 0.0 0.0 0.0 56-57 1.1 0.0 0.0 0.0 0.0 58-59 1.4 0.0 0.0 0.0 0.0 60-61 1.5 0.0 0.0 0.0 0.0 62-63 1.7 0.0 0.0 0.0 0.0 64-65 1.875 0.0 0.0 0.0 0.0 66-67 2.3 0.0 0.0 0.0 0.0 68-69 2.675 0.0 0.0 0.0 0.0 70-71 3.0125 0.0 0.0 0.0 0.0 72-73 3.2875 0.0 0.0 0.0 0.0 74-75 3.6625 0.0 0.0 0.0 0.0 76-77 3.95 0.0 0.0 0.0 0.0 78-79 4.375 0.0 0.0 0.0 0.0 80-81 4.95 0.0 0.0 0.0 0.0 82-83 5.45 0.0 0.0 0.0 0.0 84-85 6.1125 0.0 0.0 0.0 0.0 86-87 6.5625 0.0 0.0 0.0 0.0 88-89 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450082 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.954 37.0 37.0 37.0 37.0 37.0 2 35.8455 37.0 37.0 37.0 37.0 37.0 3 35.9085 37.0 37.0 37.0 37.0 37.0 4 35.984 37.0 37.0 37.0 37.0 37.0 5 36.0155 37.0 37.0 37.0 37.0 37.0 6 36.0245 37.0 37.0 37.0 37.0 37.0 7 36.135 37.0 37.0 37.0 37.0 37.0 8 36.1445 37.0 37.0 37.0 37.0 37.0 9 36.0695 37.0 37.0 37.0 37.0 37.0 10-11 36.061 37.0 37.0 37.0 37.0 37.0 12-13 36.01875 37.0 37.0 37.0 37.0 37.0 14-15 36.02775 37.0 37.0 37.0 37.0 37.0 16-17 36.05775 37.0 37.0 37.0 37.0 37.0 18-19 36.0025 37.0 37.0 37.0 37.0 37.0 20-21 36.04 37.0 37.0 37.0 37.0 37.0 22-23 35.97325 37.0 37.0 37.0 37.0 37.0 24-25 35.9525 37.0 37.0 37.0 37.0 37.0 26-27 35.894499999999994 37.0 37.0 37.0 37.0 37.0 28-29 35.9365 37.0 37.0 37.0 37.0 37.0 30-31 35.869749999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.8435 37.0 37.0 37.0 37.0 37.0 34-35 35.938 37.0 37.0 37.0 37.0 37.0 36-37 35.850750000000005 37.0 37.0 37.0 37.0 37.0 38-39 35.84425 37.0 37.0 37.0 37.0 37.0 40-41 35.775999999999996 37.0 37.0 37.0 37.0 37.0 42-43 35.90875 37.0 37.0 37.0 37.0 37.0 44-45 35.90325 37.0 37.0 37.0 37.0 37.0 46-47 35.816 37.0 37.0 37.0 37.0 37.0 48-49 35.766999999999996 37.0 37.0 37.0 37.0 37.0 50-51 35.76675 37.0 37.0 37.0 37.0 37.0 52-53 35.7975 37.0 37.0 37.0 37.0 37.0 54-55 35.78075 37.0 37.0 37.0 37.0 37.0 56-57 35.818749999999994 37.0 37.0 37.0 37.0 37.0 58-59 35.775999999999996 37.0 37.0 37.0 37.0 37.0 60-61 35.68175 37.0 37.0 37.0 37.0 37.0 62-63 35.8275 37.0 37.0 37.0 37.0 37.0 64-65 35.7705 37.0 37.0 37.0 37.0 37.0 66-67 35.772 37.0 37.0 37.0 37.0 37.0 68-69 35.681749999999994 37.0 37.0 37.0 37.0 37.0 70-71 35.75125 37.0 37.0 37.0 37.0 37.0 72-73 35.65325 37.0 37.0 37.0 37.0 37.0 74-75 35.61875 37.0 37.0 37.0 37.0 37.0 76-77 35.5315 37.0 37.0 37.0 37.0 37.0 78-79 35.641 37.0 37.0 37.0 37.0 37.0 80-81 35.58425 37.0 37.0 37.0 37.0 37.0 82-83 35.49825 37.0 37.0 37.0 37.0 37.0 84-85 35.564750000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.586 37.0 37.0 37.0 37.0 37.0 88-89 35.525999999999996 37.0 37.0 37.0 37.0 37.0 90-91 35.605000000000004 37.0 37.0 37.0 37.0 37.0 92-93 35.520250000000004 37.0 37.0 37.0 37.0 37.0 94-95 35.4555 37.0 37.0 37.0 37.0 37.0 96-97 35.55275 37.0 37.0 37.0 37.0 37.0 98-99 35.378249999999994 37.0 37.0 37.0 37.0 37.0 100-101 35.452 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 6.0 16 8.0 17 2.0 18 2.0 19 6.0 20 15.0 21 12.0 22 18.0 23 15.0 24 14.0 25 13.0 26 20.0 27 18.0 28 21.0 29 19.0 30 40.0 31 54.0 32 51.0 33 75.0 34 114.0 35 253.0 36 2073.0 37 1147.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 16.475 11.05 30.675 2 25.874999999999996 22.75 26.75 24.625 3 25.5 24.275 26.700000000000003 23.525 4 30.45 26.974999999999998 17.5 25.074999999999996 5 29.275000000000002 29.099999999999998 18.425 23.200000000000003 6 24.15 33.175 19.675 23.0 7 25.5 19.825 30.525000000000002 24.15 8 25.174999999999997 20.9 24.65 29.275000000000002 9 26.85 22.45 24.975 25.724999999999998 10-11 27.487499999999997 28.462500000000002 19.1 24.95 12-13 29.4875 20.7375 22.425 27.35 14-15 27.125 24.474999999999998 23.6625 24.7375 16-17 27.737499999999997 24.55 22.2 25.5125 18-19 27.537499999999998 24.3125 23.175 24.975 20-21 26.337500000000002 25.525 22.875 25.2625 22-23 27.925 24.587500000000002 22.3625 25.124999999999996 24-25 26.5625 25.087500000000002 22.575 25.775 26-27 27.150000000000002 24.1125 23.275000000000002 25.4625 28-29 27.650000000000002 24.962500000000002 22.025 25.362499999999997 30-31 26.825 24.175 23.4375 25.5625 32-33 27.0875 23.5 24.349999999999998 25.0625 34-35 28.349999999999998 24.962500000000002 22.2625 24.425 36-37 28.625 24.9 22.1875 24.2875 38-39 27.224999999999998 24.7875 22.55 25.4375 40-41 27.975 26.05 22.162499999999998 23.8125 42-43 26.237500000000004 25.624999999999996 22.237499999999997 25.900000000000002 44-45 27.075 24.337500000000002 22.3 26.2875 46-47 28.000000000000004 24.1125 22.900000000000002 24.9875 48-49 25.95 24.7375 23.7625 25.55 50-51 27.0125 25.5625 22.4375 24.9875 52-53 26.9625 24.6625 23.1875 25.1875 54-55 27.037499999999998 23.95 24.4375 24.575 56-57 26.6125 24.712500000000002 22.975 25.7 58-59 28.275 24.3 22.375 25.05 60-61 28.249999999999996 23.974999999999998 22.825 24.95 62-63 28.4 23.9125 23.3125 24.375 64-65 29.299999999999997 23.799999999999997 22.0 24.9 66-67 28.575 24.212500000000002 22.8875 24.325 68-69 27.975 24.637500000000003 23.3625 24.025 70-71 28.825 24.224999999999998 22.650000000000002 24.3 72-73 27.3125 24.675 23.1 24.9125 74-75 29.612500000000004 25.0625 21.9375 23.3875 76-77 28.4 24.3625 22.9625 24.275 78-79 27.325 24.65 23.5375 24.4875 80-81 29.1625 24.5 22.0875 24.25 82-83 28.175 24.474999999999998 22.7625 24.587500000000002 84-85 28.799999999999997 23.5375 23.175 24.4875 86-87 27.825 24.75 23.5125 23.9125 88-89 29.3375 24.337500000000002 21.762500000000003 24.5625 90-91 28.275 25.025 22.725 23.974999999999998 92-93 29.125 25.575 21.8625 23.4375 94-95 28.95 25.0125 22.725 23.3125 96-97 28.237499999999997 25.112499999999997 22.8 23.849999999999998 98-99 27.737499999999997 25.0 23.3625 23.9 100-101 30.775000000000002 24.075 21.7875 23.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.5 3 2.0 4 0.5 5 1.5 6 2.5 7 1.0 8 0.5 9 1.5 10 1.5 11 1.5 12 3.0 13 3.0 14 2.0 15 1.5 16 2.5 17 4.0 18 3.5 19 2.0 20 1.5 21 1.0 22 1.0 23 3.0 24 3.0 25 1.0 26 4.0 27 5.5 28 3.0 29 3.0 30 3.0 31 4.0 32 5.5 33 6.0 34 4.5 35 12.0 36 24.5 37 32.5 38 36.5 39 54.0 40 76.0 41 82.5 42 107.0 43 123.0 44 130.0 45 156.5 46 170.5 47 170.5 48 178.0 49 179.5 50 164.5 51 154.0 52 150.0 53 151.5 54 147.5 55 138.5 56 124.0 57 113.0 58 108.0 59 96.0 60 85.0 61 87.0 62 88.0 63 73.0 64 68.5 65 70.5 66 64.5 67 59.0 68 56.5 69 53.5 70 41.0 71 47.0 72 48.5 73 32.0 74 25.5 75 22.5 76 21.0 77 15.5 78 10.0 79 9.5 80 8.5 81 4.0 82 5.0 83 3.5 84 1.0 85 1.5 86 1.5 87 1.0 88 0.5 89 1.0 90 2.0 91 1.5 92 0.5 93 1.0 94 2.5 95 3.5 96 3.0 97 2.0 98 2.0 99 3.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.425 #Duplication Level Percentage of deduplicated Percentage of total 1 86.01112086625695 73.475 2 11.793971319871233 20.150000000000002 3 1.726660813579163 4.425 4 0.292654375182909 1.0 5 0.08779631255487269 0.375 6 0.0 0.0 7 0.058530875036581796 0.35000000000000003 8 0.0 0.0 9 0.029265437518290898 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAAC 5 0.125 No Hit GGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCAC 5 0.125 No Hit GCAACTTCCTCCGCTGCTGGCACGGGCGCGGCGACAGCTCGCCGCTGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.1875 0.0 0.0 0.0 0.0 38-39 0.2375 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.3375 0.0 0.0 0.0 0.0 44-45 0.35 0.0 0.0 0.0 0.0 46-47 0.475 0.0 0.0 0.0 0.0 48-49 0.5625 0.0 0.0 0.0 0.0 50-51 0.65 0.0 0.0 0.0 0.0 52-53 0.8125 0.0 0.0 0.0 0.0 54-55 0.9375 0.0 0.0 0.0 0.0 56-57 1.125 0.0 0.0 0.0 0.0 58-59 1.425 0.0 0.0 0.0 0.0 60-61 1.525 0.0 0.0 0.0 0.0 62-63 1.725 0.0 0.0 0.0 0.0 64-65 1.9 0.0 0.0 0.0 0.0 66-67 2.325 0.0 0.0 0.0 0.0 68-69 2.7375 0.0 0.0 0.0 0.0 70-71 3.1125 0.0 0.0 0.0 0.0 72-73 3.3875 0.0 0.0 0.0 0.0 74-75 3.7375 0.0 0.0 0.0 0.0 76-77 4.025 0.0 0.0 0.0 0.0 78-79 4.4625 0.0 0.0 0.0 0.0 80-81 5.025 0.0 0.0 0.0 0.0 82-83 5.55 0.0 0.0 0.0 0.0 84-85 6.2375 0.0 0.0 0.0 0.0 86-87 6.725 0.0 0.0 0.0 0.0 88-89 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCCCG 15 0.009957196 47.5 72-73 >>END_MODULE Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283353 spots for ERR3450082.sra Written 1283353 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra Read 1283336 spots for ERR3450082.sra Written 1283336 spots for ERR3450082.sra SRR ids: ['ERR3450082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4au_j876 ERR3450082.sra spots: 25666737 blocks: [[1, 1283336], [1283337, 2566672], [2566673, 3850008], [3850009, 5133344], [5133345, 6416680], [6416681, 7700016], [7700017, 8983352], [8983353, 10266688], [10266689, 11550024], [11550025, 12833360], [12833361, 14116696], [14116697, 15400032], [15400033, 16683368], [16683369, 17966704], [17966705, 19250040], [19250041, 20533376], [20533377, 21816712], [21816713, 23100048], [23100049, 24383384], [24383385, 25666737]] ERR3450082 file size 6169397 ERR3450082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450082 ERR3450082_1.fastq ERR3450082_2.fastq Input file: ERR3450082_1.fastq Paired file: ERR3450082_2.fastq trimmed: ERR3450082-trimmed-pair1.fastq, ERR3450082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:52:41 2024 >> started Sat Dec 7 14:53:02 2024 >> done (21.302s) 25666737 read pairs processed; of these: 602 ( 0.00%) short read pairs filtered out after trimming by size control 164098 ( 0.64%) empty read pairs filtered out after trimming by size control 25502037 (99.36%) read pairs available; of these: 3283166 (12.87%) trimmed read pairs available after processing 22218871 (87.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 89 0.00% 19 130 0.00% 20 464 0.00% 21 990 0.00% 22 1402 0.01% 23 650 0.00% 24 671 0.00% 25 962 0.00% 26 1355 0.01% 27 1939 0.01% 28 2593 0.01% 29 3236 0.01% 30 3880 0.02% 31 4833 0.02% 32 4851 0.02% 33 4601 0.02% 34 5024 0.02% 35 4804 0.02% 36 5204 0.02% 37 5722 0.02% 38 6848 0.03% 39 7872 0.03% 40 8883 0.03% 41 10483 0.04% 42 11543 0.05% 43 12334 0.05% 44 11082 0.04% 45 10915 0.04% 46 11766 0.05% 47 12716 0.05% 48 13628 0.05% 49 14978 0.06% 50 16452 0.06% 51 18015 0.07% 52 19651 0.08% 53 20391 0.08% 54 21740 0.09% 55 21821 0.09% 56 22769 0.09% 57 23580 0.09% 58 25699 0.10% 59 26997 0.11% 60 29353 0.12% 61 31888 0.13% 62 34145 0.13% 63 36406 0.14% 64 37414 0.15% 65 38405 0.15% 66 39359 0.15% 67 41477 0.16% 68 42620 0.17% 69 44382 0.17% 70 47052 0.18% 71 49007 0.19% 72 53075 0.21% 73 55072 0.22% 74 56813 0.22% 75 58630 0.23% 76 60055 0.24% 77 61118 0.24% 78 62875 0.25% 79 66509 0.26% 80 67392 0.26% 81 70078 0.27% 82 72706 0.29% 83 75749 0.30% 84 77758 0.30% 85 80791 0.32% 86 81840 0.32% 87 84154 0.33% 88 86175 0.34% 89 88030 0.35% 90 90213 0.35% 91 93867 0.37% 92 97589 0.38% 93 99613 0.39% 94 102527 0.40% 95 104071 0.41% 96 105590 0.41% 97 108029 0.42% 98 109123 0.43% 99 110743 0.43% 100 127910 0.50% 101 22218871 87.13% 25502037 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.0 sequence=CCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=51.91 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=4.7 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.0 sequence=AGCCAGAGGAAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=135.04 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=13.6 sequence=CGCCGCCGCCGC ERR3450082 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:53:35 Started mapping on | Dec 07 14:53:35 Finished on | Dec 07 14:55:31 Mapping speed, Million of reads per hour | 791.44 Number of input reads | 25502037 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 19037721 Uniquely mapped reads % | 74.65% Average mapped length | 196.22 Number of splices: Total | 11733838 Number of splices: Annotated (sjdb) | 11136532 Number of splices: GT/AG | 11579638 Number of splices: GC/AG | 133870 Number of splices: AT/AC | 6215 Number of splices: Non-canonical | 14115 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2034187 % of reads mapped to multiple loci | 7.98% Number of reads mapped to too many loci | 752194 % of reads mapped to too many loci | 2.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 10.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4430129 4430129 4430129 N_multimapping 2034187 2034187 2034187 N_noFeature 697189 18297164 1140422 N_ambiguous 375466 2973 83586 UnstrandedReadsAssigned:17965066 PositiveStrandReadsAssigned:737584 NegativeStrandReadsAssigned:17813713 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450082-trimmed-pair1.fastq ERR3450082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,502,037 reads, 19,352,288 reads pseudoaligned [quant] estimated average fragment length: 179.283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 ERR3450082.ke.tsv 35125 ERR3450082.se.tsv 88098 total ==> ERR3450082.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.951 12.4948 1.25608 PNS24247 1044 865.717 38.7287 3.40868 PNS24249 1928 1749.72 212.911 9.2717 PNS24246 1044 865.717 38.7287 3.40868 PNS24248 1044 865.717 38.7287 3.40868 PNS24244 1471 1292.72 21.4082 1.26185 PNS24243 293 134.028 1 0.568504 KQK14069 1603 1424.72 4882.04 261.097 KQK14071 474 299.128 232.825 59.3066 ==> ERR3450082.se.tsv <== BRADI_1g14170v3 5326 BRADI_1g53295v3 19 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 2221 BRADI_1g74790v3 187 BRADI_1g09890v3 15 BRADI_1g77505v3 300 BRADI_1g48960v3 0 ERR3450082 completed mapping pipeline successfully