Starting /dee2/code/volunteer_pipeline.sh ERR3450084 current disk space = 1542836428800 free memory = 1488499144 ERR3450084 SRAfilesize bd7bb26b3ecd95e6809c63a2aec4f065 ERR3450084.sra ERR3450084.sra file validated ERR3450084 is paired end ERR3450084 is conventional basespace ERR3450084 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450084_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99475 37.0 37.0 37.0 37.0 37.0 2 36.2545 37.0 37.0 37.0 37.0 37.0 3 36.3115 37.0 37.0 37.0 37.0 37.0 4 36.399 37.0 37.0 37.0 37.0 37.0 5 36.4375 37.0 37.0 37.0 37.0 37.0 6 36.5255 37.0 37.0 37.0 37.0 37.0 7 36.3925 37.0 37.0 37.0 37.0 37.0 8 36.413 37.0 37.0 37.0 37.0 37.0 9 36.4315 37.0 37.0 37.0 37.0 37.0 10-11 36.51525 37.0 37.0 37.0 37.0 37.0 12-13 36.468 37.0 37.0 37.0 37.0 37.0 14-15 36.426249999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.397000000000006 37.0 37.0 37.0 37.0 37.0 18-19 36.5505 37.0 37.0 37.0 37.0 37.0 20-21 36.429249999999996 37.0 37.0 37.0 37.0 37.0 22-23 36.42125 37.0 37.0 37.0 37.0 37.0 24-25 36.27975 37.0 37.0 37.0 37.0 37.0 26-27 36.37625 37.0 37.0 37.0 37.0 37.0 28-29 36.349999999999994 37.0 37.0 37.0 37.0 37.0 30-31 36.2615 37.0 37.0 37.0 37.0 37.0 32-33 36.336 37.0 37.0 37.0 37.0 37.0 34-35 36.321 37.0 37.0 37.0 37.0 37.0 36-37 36.271 37.0 37.0 37.0 37.0 37.0 38-39 36.272000000000006 37.0 37.0 37.0 37.0 37.0 40-41 36.18325 37.0 37.0 37.0 37.0 37.0 42-43 36.23025 37.0 37.0 37.0 37.0 37.0 44-45 36.2025 37.0 37.0 37.0 37.0 37.0 46-47 36.216499999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.12925 37.0 37.0 37.0 37.0 37.0 50-51 36.14125 37.0 37.0 37.0 37.0 37.0 52-53 36.1575 37.0 37.0 37.0 37.0 37.0 54-55 36.131 37.0 37.0 37.0 37.0 37.0 56-57 36.06925 37.0 37.0 37.0 37.0 37.0 58-59 36.028 37.0 37.0 37.0 37.0 37.0 60-61 36.10724999999999 37.0 37.0 37.0 37.0 37.0 62-63 35.9905 37.0 37.0 37.0 37.0 37.0 64-65 36.07 37.0 37.0 37.0 37.0 37.0 66-67 35.992000000000004 37.0 37.0 37.0 37.0 37.0 68-69 36.0045 37.0 37.0 37.0 37.0 37.0 70-71 35.98075 37.0 37.0 37.0 37.0 37.0 72-73 36.0045 37.0 37.0 37.0 37.0 37.0 74-75 36.06 37.0 37.0 37.0 37.0 37.0 76-77 35.9805 37.0 37.0 37.0 37.0 37.0 78-79 35.94975 37.0 37.0 37.0 37.0 37.0 80-81 35.988749999999996 37.0 37.0 37.0 37.0 37.0 82-83 35.869749999999996 37.0 37.0 37.0 37.0 37.0 84-85 35.911 37.0 37.0 37.0 37.0 37.0 86-87 35.9135 37.0 37.0 37.0 37.0 37.0 88-89 35.96175 37.0 37.0 37.0 37.0 37.0 90-91 35.88725 37.0 37.0 37.0 37.0 37.0 92-93 35.89725 37.0 37.0 37.0 37.0 37.0 94-95 35.77075 37.0 37.0 37.0 37.0 37.0 96-97 35.805 37.0 37.0 37.0 37.0 37.0 98-99 35.8715 37.0 37.0 37.0 37.0 37.0 100-101 35.752 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 7.0 25 10.0 26 11.0 27 24.0 28 35.0 29 36.0 30 47.0 31 57.0 32 68.0 33 63.0 34 104.0 35 209.0 36 1731.0 37 1592.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.322174679083815 9.841429650138435 10.823055625471936 39.01334004530582 2 22.3 13.25 29.625 34.825 3 20.200000000000003 17.724999999999998 25.624999999999996 36.449999999999996 4 28.175 21.725 19.0 31.1 5 26.700000000000003 27.700000000000003 21.9 23.7 6 24.4 30.2 23.400000000000002 22.0 7 20.375 21.85 37.824999999999996 19.950000000000003 8 21.6 22.5 29.225 26.674999999999997 9 22.2 22.7 30.875000000000004 24.224999999999998 10-11 24.0 29.1375 22.8125 24.05 12-13 23.474999999999998 23.0625 26.1125 27.35 14-15 23.200000000000003 24.55 25.55 26.700000000000003 16-17 24.25 25.162499999999998 25.4 25.1875 18-19 22.9375 25.924999999999997 25.162499999999998 25.974999999999998 20-21 24.3875 24.6875 24.7375 26.187500000000004 22-23 23.325000000000003 25.112499999999997 24.975 26.5875 24-25 24.5125 24.0625 23.974999999999998 27.450000000000003 26-27 24.0 25.137500000000003 24.6875 26.174999999999997 28-29 24.637500000000003 24.1125 24.637500000000003 26.6125 30-31 23.724999999999998 24.575 24.7875 26.9125 32-33 24.425 24.3625 24.224999999999998 26.987499999999997 34-35 25.0125 25.1875 23.65 26.150000000000002 36-37 23.7125 24.1375 25.0 27.150000000000002 38-39 25.112499999999997 23.2625 24.85 26.775 40-41 24.462500000000002 24.587500000000002 23.150000000000002 27.800000000000004 42-43 24.3125 24.5625 24.1625 26.9625 44-45 25.137500000000003 23.962500000000002 24.4125 26.487500000000004 46-47 24.4 23.9875 23.9125 27.700000000000003 48-49 24.8125 23.45 24.05 27.6875 50-51 24.775 24.1125 23.75 27.3625 52-53 24.875 25.3 22.7 27.125 54-55 25.575 24.1875 24.1875 26.05 56-57 23.4125 24.2375 25.900000000000002 26.450000000000003 58-59 24.325 23.625 23.95 28.1 60-61 24.6 23.2125 24.5625 27.625 62-63 25.124999999999996 24.4375 23.825 26.6125 64-65 24.6625 23.7875 25.224999999999998 26.325 66-67 25.2125 24.587500000000002 24.8125 25.387500000000003 68-69 24.675 23.35 24.4125 27.5625 70-71 24.8625 24.875 23.549999999999997 26.7125 72-73 25.75 24.45 23.200000000000003 26.6 74-75 24.6625 24.587500000000002 24.212500000000002 26.5375 76-77 25.95 24.6125 22.662499999999998 26.775 78-79 25.687500000000004 24.05 24.0625 26.200000000000003 80-81 24.962500000000002 24.4125 22.5875 28.037499999999998 82-83 25.15 24.3875 23.1 27.3625 84-85 25.525 23.875 23.4875 27.1125 86-87 24.85 24.8125 23.474999999999998 26.8625 88-89 25.724999999999998 25.1875 23.05 26.0375 90-91 25.4875 24.55 22.5 27.462500000000002 92-93 25.5125 24.2625 24.25 25.974999999999998 94-95 24.75 25.575 23.65 26.025 96-97 25.650000000000002 24.349999999999998 22.9625 27.037499999999998 98-99 25.087500000000002 25.7625 23.3375 25.8125 100-101 24.3625 24.7 23.6125 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.5 2 1.0 3 1.0 4 1.5 5 1.5 6 1.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.5 12 1.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 2.5 25 2.0 26 1.5 27 1.5 28 0.5 29 2.5 30 4.5 31 3.0 32 3.5 33 8.5 34 14.5 35 17.0 36 21.5 37 36.5 38 45.5 39 62.0 40 79.5 41 95.0 42 126.5 43 147.5 44 161.0 45 178.0 46 188.0 47 179.5 48 168.0 49 166.5 50 173.5 51 158.5 52 145.5 53 150.0 54 149.5 55 151.0 56 148.5 57 125.0 58 100.5 59 92.5 60 79.5 61 72.0 62 66.5 63 64.0 64 65.5 65 54.0 66 53.5 67 67.5 68 59.0 69 44.5 70 39.5 71 33.5 72 31.0 73 27.0 74 20.0 75 18.5 76 22.0 77 18.0 78 8.0 79 4.5 80 4.5 81 2.5 82 1.5 83 1.5 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.925 #Duplication Level Percentage of deduplicated Percentage of total 1 87.54727960430608 75.225 2 10.357870235670644 17.8 3 1.3674716322374163 3.5249999999999995 4 0.3782368344486471 1.3 5 0.08728542333430317 0.375 6 0.05819028222286878 0.3 7 0.08728542333430317 0.525 8 0.02909514111143439 0.2 9 0.05819028222286878 0.44999999999999996 >10 0.02909514111143439 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 12 0.3 No Hit CCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTG 9 0.22499999999999998 No Hit GCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACG 9 0.22499999999999998 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 8 0.2 No Hit CTTGTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTC 7 0.17500000000000002 No Hit GCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCC 7 0.17500000000000002 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 7 0.17500000000000002 No Hit CTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGA 6 0.15 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 38bp) GTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTC 5 0.125 No Hit CTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCATCGAAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.1125 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.3125 0.0 0.0 0.0 0.0 54-55 0.3375 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.475 0.0 0.0 0.0 0.0 60-61 0.7 0.0 0.0 0.0 0.0 62-63 0.8875 0.0 0.0 0.0 0.0 64-65 1.1124999999999998 0.0 0.0 0.0 0.0 66-67 1.3250000000000002 0.0 0.0 0.0 0.0 68-69 1.45 0.0 0.0 0.0 0.0 70-71 1.675 0.0 0.0 0.0 0.0 72-73 1.8625 0.0 0.0 0.0 0.0 74-75 2.2125 0.0 0.0 0.0 0.0 76-77 2.6625 0.0 0.0 0.0 0.0 78-79 2.9 0.0 0.0 0.0 0.0 80-81 3.2249999999999996 0.0 0.0 0.0 0.0 82-83 3.5125 0.0 0.0 0.0 0.0 84-85 3.925 0.0 0.0 0.0 0.0 86-87 4.4625 0.0 0.0 0.0 0.0 88-89 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450084 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450084_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1295 37.0 37.0 37.0 37.0 37.0 2 35.9485 37.0 37.0 37.0 37.0 37.0 3 36.205 37.0 37.0 37.0 37.0 37.0 4 36.265 37.0 37.0 37.0 37.0 37.0 5 36.362 37.0 37.0 37.0 37.0 37.0 6 36.441 37.0 37.0 37.0 37.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.3595 37.0 37.0 37.0 37.0 37.0 9 36.3745 37.0 37.0 37.0 37.0 37.0 10-11 36.257000000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.337 37.0 37.0 37.0 37.0 37.0 14-15 36.198750000000004 37.0 37.0 37.0 37.0 37.0 16-17 36.25625 37.0 37.0 37.0 37.0 37.0 18-19 36.235749999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.32299999999999 37.0 37.0 37.0 37.0 37.0 22-23 36.28 37.0 37.0 37.0 37.0 37.0 24-25 36.183 37.0 37.0 37.0 37.0 37.0 26-27 36.168000000000006 37.0 37.0 37.0 37.0 37.0 28-29 36.176249999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.154250000000005 37.0 37.0 37.0 37.0 37.0 32-33 36.14375 37.0 37.0 37.0 37.0 37.0 34-35 36.15675 37.0 37.0 37.0 37.0 37.0 36-37 36.138999999999996 37.0 37.0 37.0 37.0 37.0 38-39 36.167 37.0 37.0 37.0 37.0 37.0 40-41 36.129000000000005 37.0 37.0 37.0 37.0 37.0 42-43 36.10175 37.0 37.0 37.0 37.0 37.0 44-45 36.123999999999995 37.0 37.0 37.0 37.0 37.0 46-47 36.04875 37.0 37.0 37.0 37.0 37.0 48-49 36.05475 37.0 37.0 37.0 37.0 37.0 50-51 36.09225 37.0 37.0 37.0 37.0 37.0 52-53 36.14475 37.0 37.0 37.0 37.0 37.0 54-55 36.09975 37.0 37.0 37.0 37.0 37.0 56-57 36.113749999999996 37.0 37.0 37.0 37.0 37.0 58-59 36.08975 37.0 37.0 37.0 37.0 37.0 60-61 36.0555 37.0 37.0 37.0 37.0 37.0 62-63 36.179 37.0 37.0 37.0 37.0 37.0 64-65 36.105000000000004 37.0 37.0 37.0 37.0 37.0 66-67 36.09425 37.0 37.0 37.0 37.0 37.0 68-69 36.06875 37.0 37.0 37.0 37.0 37.0 70-71 36.03225 37.0 37.0 37.0 37.0 37.0 72-73 36.0685 37.0 37.0 37.0 37.0 37.0 74-75 35.987 37.0 37.0 37.0 37.0 37.0 76-77 36.012 37.0 37.0 37.0 37.0 37.0 78-79 36.03875 37.0 37.0 37.0 37.0 37.0 80-81 35.939 37.0 37.0 37.0 37.0 37.0 82-83 35.9805 37.0 37.0 37.0 37.0 37.0 84-85 35.8735 37.0 37.0 37.0 37.0 37.0 86-87 35.908249999999995 37.0 37.0 37.0 37.0 37.0 88-89 35.97325 37.0 37.0 37.0 37.0 37.0 90-91 35.98125 37.0 37.0 37.0 37.0 37.0 92-93 35.938 37.0 37.0 37.0 37.0 37.0 94-95 35.8945 37.0 37.0 37.0 37.0 37.0 96-97 35.9045 37.0 37.0 37.0 37.0 37.0 98-99 35.84075 37.0 37.0 37.0 37.0 37.0 100-101 35.8425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 3.0 16 6.0 17 0.0 18 1.0 19 10.0 20 8.0 21 8.0 22 10.0 23 5.0 24 12.0 25 13.0 26 9.0 27 14.0 28 19.0 29 24.0 30 34.0 31 24.0 32 59.0 33 52.0 34 85.0 35 174.0 36 2010.0 37 1418.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.25 16.525000000000002 11.975 29.25 2 27.525 23.575 26.224999999999998 22.675 3 25.025 24.375 27.150000000000002 23.45 4 31.25 28.549999999999997 17.05 23.150000000000002 5 28.999999999999996 27.800000000000004 19.375 23.825 6 24.224999999999998 33.4 20.275000000000002 22.1 7 26.525 19.625 29.549999999999997 24.3 8 26.325 20.525 24.275 28.875 9 26.174999999999997 21.75 26.025 26.05 10-11 29.2 27.224999999999998 19.55 24.025 12-13 28.4375 22.0875 22.625 26.85 14-15 27.325 25.837500000000002 22.7 24.1375 16-17 27.8375 24.337500000000002 22.787499999999998 25.0375 18-19 28.4 25.05 21.925 24.625 20-21 28.025 25.45 22.15 24.375 22-23 28.0625 24.85 22.4375 24.65 24-25 28.175 24.85 22.525000000000002 24.45 26-27 27.6625 24.8 22.8875 24.65 28-29 28.3375 23.8375 22.7625 25.0625 30-31 26.924999999999997 24.712500000000002 23.0375 25.324999999999996 32-33 26.650000000000002 24.8625 22.575 25.912499999999998 34-35 27.275 24.1125 23.724999999999998 24.887500000000003 36-37 27.725 24.462500000000002 23.175 24.637500000000003 38-39 26.424999999999997 23.7875 23.325000000000003 26.4625 40-41 27.0 24.712500000000002 22.662499999999998 25.624999999999996 42-43 27.474999999999998 23.4125 23.6625 25.45 44-45 26.075 24.825 24.1625 24.9375 46-47 27.0125 23.724999999999998 23.575 25.687500000000004 48-49 26.4625 24.224999999999998 23.4375 25.874999999999996 50-51 26.1625 24.5375 23.0625 26.237500000000004 52-53 27.900000000000002 23.275000000000002 22.475 26.35 54-55 26.775 24.675 22.875 25.674999999999997 56-57 27.0125 24.474999999999998 23.7125 24.8 58-59 28.7375 24.6125 22.825 23.825 60-61 26.987499999999997 24.725 22.3375 25.95 62-63 26.5625 25.575 23.7125 24.15 64-65 28.749999999999996 24.6125 22.4875 24.15 66-67 26.8125 24.7 22.9625 25.525 68-69 27.85 24.5125 22.3125 25.324999999999996 70-71 27.575 24.825 22.3375 25.2625 72-73 26.637499999999996 25.087500000000002 22.900000000000002 25.374999999999996 74-75 27.881970492623154 24.60615153788447 22.518129532383096 24.99374843710928 76-77 27.3875 24.474999999999998 23.175 24.962500000000002 78-79 27.187499999999996 23.4375 23.95 25.424999999999997 80-81 27.6 24.8 22.95 24.65 82-83 28.249999999999996 24.125 23.7125 23.9125 84-85 27.737499999999997 24.15 23.05 25.0625 86-87 27.400000000000002 25.912499999999998 22.55 24.1375 88-89 28.287499999999998 24.5 23.3 23.9125 90-91 28.0875 25.087500000000002 22.825 24.0 92-93 28.050000000000004 25.5625 22.6875 23.7 94-95 28.8625 24.8125 21.95 24.375 96-97 29.175 24.1375 22.900000000000002 23.7875 98-99 29.1625 24.425 22.725 23.6875 100-101 27.712500000000002 25.2 22.625 24.462500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 2.0 8 2.5 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 2.0 16 3.5 17 3.5 18 2.0 19 2.0 20 3.0 21 2.0 22 2.0 23 1.0 24 0.0 25 0.5 26 2.5 27 2.0 28 0.5 29 1.0 30 2.0 31 4.0 32 6.0 33 5.0 34 7.5 35 18.0 36 23.5 37 29.0 38 40.5 39 62.0 40 81.5 41 95.0 42 112.5 43 126.0 44 149.0 45 162.5 46 166.0 47 173.0 48 166.5 49 165.5 50 163.5 51 165.0 52 159.5 53 146.5 54 153.5 55 133.5 56 108.0 57 106.0 58 102.5 59 86.0 60 90.5 61 100.5 62 83.0 63 73.5 64 70.0 65 77.0 66 74.0 67 61.5 68 59.0 69 53.5 70 46.0 71 41.0 72 38.5 73 39.0 74 33.0 75 22.0 76 17.5 77 12.5 78 10.0 79 7.5 80 5.0 81 3.5 82 2.0 83 2.0 84 1.5 85 1.5 86 1.0 87 0.5 88 1.0 89 1.0 90 0.0 91 0.5 92 1.5 93 1.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.5 99 0.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.025 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.375 #Duplication Level Percentage of deduplicated Percentage of total 1 87.14905933429812 75.275 2 10.882778581765558 18.8 3 1.447178002894356 3.75 4 0.3473227206946454 1.2 5 0.08683068017366136 0.375 6 0.0 0.0 7 0.05788712011577424 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.02894356005788712 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit GGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCAC 5 0.125 No Hit CTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTT 5 0.125 No Hit GTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1125 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.425 0.0 0.0 0.0 0.0 60-61 0.675 0.0 0.0 0.0 0.0 62-63 0.875 0.0 0.0 0.0 0.0 64-65 1.1124999999999998 0.0 0.0 0.0 0.0 66-67 1.2999999999999998 0.0 0.0 0.0 0.0 68-69 1.425 0.0 0.0 0.0 0.0 70-71 1.65 0.0 0.0 0.0 0.0 72-73 1.85 0.0 0.0 0.0 0.0 74-75 2.1875 0.0 0.0 0.0 0.0 76-77 2.6375 0.0 0.0 0.0 0.0 78-79 2.875 0.0 0.0 0.0 0.0 80-81 3.25 0.0 0.0 0.0 0.0 82-83 3.5375 0.0 0.0 0.0 0.0 84-85 3.9625 0.0 0.0 0.0 0.0 86-87 4.5125 0.0 0.0 0.0 0.0 88-89 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226981 spots for ERR3450084.sra Written 2226981 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra Read 2226980 spots for ERR3450084.sra Written 2226980 spots for ERR3450084.sra SRR ids: ['ERR3450084.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_39om50i1 ERR3450084.sra spots: 44539601 blocks: [[1, 2226980], [2226981, 4453960], [4453961, 6680940], [6680941, 8907920], [8907921, 11134900], [11134901, 13361880], [13361881, 15588860], [15588861, 17815840], [17815841, 20042820], [20042821, 22269800], [22269801, 24496780], [24496781, 26723760], [26723761, 28950740], [28950741, 31177720], [31177721, 33404700], [33404701, 35631680], [35631681, 37858660], [37858661, 40085640], [40085641, 42312620], [42312621, 44539601]] ERR3450084 file size 10721738 ERR3450084 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450084 ERR3450084_1.fastq ERR3450084_2.fastq Input file: ERR3450084_1.fastq Paired file: ERR3450084_2.fastq trimmed: ERR3450084-trimmed-pair1.fastq, ERR3450084-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:59:34 2024 >> started Sat Dec 7 15:03:54 2024 >> done (259.953s) 44539601 read pairs processed; of these: 334 ( 0.00%) short read pairs filtered out after trimming by size control 51390 ( 0.12%) empty read pairs filtered out after trimming by size control 44487877 (99.88%) read pairs available; of these: 4077473 ( 9.17%) trimmed read pairs available after processing 40410404 (90.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 48 0.00% 19 120 0.00% 20 422 0.00% 21 1096 0.00% 22 1111 0.00% 23 549 0.00% 24 451 0.00% 25 635 0.00% 26 822 0.00% 27 1281 0.00% 28 1747 0.00% 29 2218 0.00% 30 2756 0.01% 31 3479 0.01% 32 3570 0.01% 33 3369 0.01% 34 3560 0.01% 35 3404 0.01% 36 3696 0.01% 37 4316 0.01% 38 5081 0.01% 39 5824 0.01% 40 6811 0.02% 41 8104 0.02% 42 9397 0.02% 43 9676 0.02% 44 8761 0.02% 45 8958 0.02% 46 9273 0.02% 47 10242 0.02% 48 11186 0.03% 49 12581 0.03% 50 14463 0.03% 51 15449 0.03% 52 17053 0.04% 53 17902 0.04% 54 19220 0.04% 55 19807 0.04% 56 20544 0.05% 57 21584 0.05% 58 23864 0.05% 59 25896 0.06% 60 28111 0.06% 61 30794 0.07% 62 33831 0.08% 63 36546 0.08% 64 38116 0.09% 65 39791 0.09% 66 41781 0.09% 67 43822 0.10% 68 46247 0.10% 69 47694 0.11% 70 52032 0.12% 71 55723 0.13% 72 59702 0.13% 73 63369 0.14% 74 66181 0.15% 75 68701 0.15% 76 71208 0.16% 77 73303 0.16% 78 76516 0.17% 79 80769 0.18% 80 83087 0.19% 81 87609 0.20% 82 92081 0.21% 83 96284 0.22% 84 100304 0.23% 85 105388 0.24% 86 107603 0.24% 87 111993 0.25% 88 116372 0.26% 89 120714 0.27% 90 124093 0.28% 91 130523 0.29% 92 137853 0.31% 93 141158 0.32% 94 145516 0.33% 95 151336 0.34% 96 154149 0.35% 97 159049 0.36% 98 160901 0.36% 99 164767 0.37% 100 192130 0.43% 101 40410404 90.83% 44487877 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=51.68 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=4.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=27 prefix-density=0.18 prefix-fanout=2.2 sequence=AGCCAGAGGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=187.61 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=23.0 sequence=CGGCGGCGGCGA ERR3450084 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:08:42 Started mapping on | Dec 07 15:08:42 Finished on | Dec 07 15:38:50 Mapping speed, Million of reads per hour | 88.58 Number of input reads | 44487877 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 33508942 Uniquely mapped reads % | 75.32% Average mapped length | 198.23 Number of splices: Total | 21235088 Number of splices: Annotated (sjdb) | 20146949 Number of splices: GT/AG | 20955073 Number of splices: GC/AG | 242801 Number of splices: AT/AC | 13423 Number of splices: Non-canonical | 23791 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2546821 % of reads mapped to multiple loci | 5.72% Number of reads mapped to too many loci | 1407540 % of reads mapped to too many loci | 3.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 12.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8432114 8432114 8432114 N_multimapping 2546821 2546821 2546821 N_noFeature 1078054 32309057 1778376 N_ambiguous 614909 4814 122981 UnstrandedReadsAssigned:31815979 PositiveStrandReadsAssigned:1195071 NegativeStrandReadsAssigned:31607585 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450084 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450084-trimmed-pair1.fastq ERR3450084-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,487,877 reads, 33,644,928 reads pseudoaligned [quant] estimated average fragment length: 184.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 ERR3450084.ke.tsv 35125 ERR3450084.se.tsv 88098 total ==> ERR3450084.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.257 0 0 PNS24247 1044 860.022 59.4942 3.03344 PNS24249 1928 1744.02 376.944 9.47752 PNS24246 1044 860.022 59.4942 3.03344 PNS24248 1044 860.022 59.4942 3.03344 PNS24244 1471 1287.02 152.573 5.19831 PNS24243 293 128.81 0 0 KQK14069 1603 1419.02 4828.74 149.216 KQK14071 474 293.349 174.899 26.1441 ==> ERR3450084.se.tsv <== BRADI_1g14170v3 5144 BRADI_1g53295v3 31 BRADI_1g59795v3 364 BRADI_1g07683v3 0 BRADI_1g00485v3 90 BRADI_1g20270v3 3984 BRADI_1g74790v3 316 BRADI_1g09890v3 17 BRADI_1g77505v3 445 BRADI_1g48960v3 0 ERR3450084 completed mapping pipeline successfully