Starting /dee2/code/volunteer_pipeline.sh ERR3450085 current disk space = 1542873395200 free memory = 1600546404 ERR3450085 SRAfilesize f910b8a464590ce3e2bc062bc3d088a7 ERR3450085.sra ERR3450085.sra file validated ERR3450085 is paired end ERR3450085 is conventional basespace ERR3450085 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10875 37.0 37.0 37.0 37.0 37.0 2 36.3925 37.0 37.0 37.0 37.0 37.0 3 36.471 37.0 37.0 37.0 37.0 37.0 4 36.513 37.0 37.0 37.0 37.0 37.0 5 36.5005 37.0 37.0 37.0 37.0 37.0 6 36.5765 37.0 37.0 37.0 37.0 37.0 7 36.4905 37.0 37.0 37.0 37.0 37.0 8 36.4805 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-11 36.492 37.0 37.0 37.0 37.0 37.0 12-13 36.56175 37.0 37.0 37.0 37.0 37.0 14-15 36.55875 37.0 37.0 37.0 37.0 37.0 16-17 36.48650000000001 37.0 37.0 37.0 37.0 37.0 18-19 36.48125 37.0 37.0 37.0 37.0 37.0 20-21 36.4825 37.0 37.0 37.0 37.0 37.0 22-23 36.502250000000004 37.0 37.0 37.0 37.0 37.0 24-25 36.447500000000005 37.0 37.0 37.0 37.0 37.0 26-27 36.45125 37.0 37.0 37.0 37.0 37.0 28-29 36.51675 37.0 37.0 37.0 37.0 37.0 30-31 36.40975 37.0 37.0 37.0 37.0 37.0 32-33 36.403999999999996 37.0 37.0 37.0 37.0 37.0 34-35 36.414249999999996 37.0 37.0 37.0 37.0 37.0 36-37 36.355500000000006 37.0 37.0 37.0 37.0 37.0 38-39 36.35525 37.0 37.0 37.0 37.0 37.0 40-41 36.24725 37.0 37.0 37.0 37.0 37.0 42-43 36.252250000000004 37.0 37.0 37.0 37.0 37.0 44-45 36.24625 37.0 37.0 37.0 37.0 37.0 46-47 36.210750000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.1935 37.0 37.0 37.0 37.0 37.0 50-51 36.118 37.0 37.0 37.0 37.0 37.0 52-53 36.21275 37.0 37.0 37.0 37.0 37.0 54-55 36.1445 37.0 37.0 37.0 37.0 37.0 56-57 35.955 37.0 37.0 37.0 37.0 37.0 58-59 36.075 37.0 37.0 37.0 37.0 37.0 60-61 36.00175 37.0 37.0 37.0 37.0 37.0 62-63 36.04025 37.0 37.0 37.0 37.0 37.0 64-65 36.042249999999996 37.0 37.0 37.0 37.0 37.0 66-67 35.9995 37.0 37.0 37.0 37.0 37.0 68-69 35.975 37.0 37.0 37.0 37.0 37.0 70-71 35.929249999999996 37.0 37.0 37.0 37.0 37.0 72-73 35.9755 37.0 37.0 37.0 37.0 37.0 74-75 36.144000000000005 37.0 37.0 37.0 37.0 37.0 76-77 36.02125 37.0 37.0 37.0 37.0 37.0 78-79 36.05525 37.0 37.0 37.0 37.0 37.0 80-81 36.029250000000005 37.0 37.0 37.0 37.0 37.0 82-83 36.1075 37.0 37.0 37.0 37.0 37.0 84-85 36.067499999999995 37.0 37.0 37.0 37.0 37.0 86-87 35.97775 37.0 37.0 37.0 37.0 37.0 88-89 35.964 37.0 37.0 37.0 37.0 37.0 90-91 35.929249999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.86775 37.0 37.0 37.0 37.0 37.0 94-95 35.857749999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.90925 37.0 37.0 37.0 37.0 37.0 98-99 35.85975 37.0 37.0 37.0 37.0 37.0 100-101 35.752750000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 3.0 25 10.0 26 7.0 27 22.0 28 21.0 29 28.0 30 45.0 31 67.0 32 70.0 33 74.0 34 112.0 35 201.0 36 1755.0 37 1580.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.606022584692596 10.01254705144291 9.786700125470514 38.59473023839398 2 23.200000000000003 12.525 27.450000000000003 36.825 3 21.875 17.525 25.900000000000002 34.699999999999996 4 29.45 21.55 17.025000000000002 31.974999999999998 5 28.075 27.675 21.175 23.075000000000003 6 23.849999999999998 30.9 23.375 21.875 7 20.125 22.375 36.5 21.0 8 22.6 21.85 29.325000000000003 26.224999999999998 9 23.974999999999998 21.325 31.2 23.5 10-11 24.6625 28.125 22.0875 25.124999999999996 12-13 25.124999999999996 22.4875 25.674999999999997 26.7125 14-15 23.474999999999998 23.6125 26.237500000000004 26.674999999999997 16-17 24.6125 23.275000000000002 24.7 27.4125 18-19 24.75 25.0125 25.112499999999997 25.124999999999996 20-21 24.9 24.05 24.675 26.375 22-23 24.7 24.05 24.575 26.674999999999997 24-25 24.875 23.599999999999998 24.1875 27.3375 26-27 24.575 23.4625 24.3125 27.650000000000002 28-29 25.650000000000002 23.275000000000002 23.7125 27.3625 30-31 25.25 23.9 23.825 27.025 32-33 24.3875 24.05 24.375 27.187499999999996 34-35 25.3 23.7 23.8125 27.187499999999996 36-37 24.1375 24.349999999999998 23.8625 27.650000000000002 38-39 23.974999999999998 23.2875 25.5625 27.175 40-41 26.087500000000002 23.5875 23.7625 26.5625 42-43 25.55 24.15 23.5875 26.7125 44-45 24.275 23.1 24.887500000000003 27.737499999999997 46-47 26.25 23.75 23.75 26.25 48-49 24.25 23.4875 24.224999999999998 28.037499999999998 50-51 25.362499999999997 22.9625 24.0375 27.6375 52-53 25.9875 22.912499999999998 23.4375 27.6625 54-55 25.0125 23.6375 24.462500000000002 26.887499999999996 56-57 25.0625 23.6875 24.55 26.700000000000003 58-59 25.837500000000002 23.474999999999998 24.087500000000002 26.6 60-61 25.1875 23.025000000000002 24.725 27.0625 62-63 25.650000000000002 23.6375 24.5 26.2125 64-65 25.575 23.6875 24.3875 26.35 66-67 26.25 23.45 23.45 26.85 68-69 25.4625 23.925 23.724999999999998 26.887499999999996 70-71 26.137500000000003 23.5375 23.674999999999997 26.650000000000002 72-73 27.275 23.525 22.525000000000002 26.674999999999997 74-75 25.837500000000002 23.9375 22.95 27.275 76-77 26.8375 24.637500000000003 22.3625 26.1625 78-79 25.637500000000003 24.1375 22.925 27.3 80-81 26.424999999999997 23.6625 22.725 27.187499999999996 82-83 25.85 25.025 22.775000000000002 26.35 84-85 26.150000000000002 23.45 22.7625 27.6375 86-87 26.05 24.3625 23.2125 26.375 88-89 25.25 24.8125 22.412499999999998 27.525 90-91 26.337500000000002 23.9 22.975 26.787499999999998 92-93 26.650000000000002 24.0125 23.0375 26.3 94-95 27.037499999999998 23.775 22.9625 26.224999999999998 96-97 25.924999999999997 23.775 22.662499999999998 27.6375 98-99 25.6125 24.15 23.150000000000002 27.0875 100-101 25.8625 24.875 23.200000000000003 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.5 2 0.5 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.5 9 1.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 1.5 27 3.0 28 3.5 29 2.5 30 4.0 31 6.0 32 5.0 33 8.0 34 10.5 35 13.5 36 21.5 37 33.5 38 35.0 39 45.5 40 75.0 41 94.5 42 127.0 43 147.0 44 138.5 45 152.0 46 169.5 47 167.0 48 165.0 49 174.0 50 163.0 51 152.0 52 152.0 53 148.5 54 137.0 55 135.0 56 132.5 57 117.5 58 109.0 59 101.0 60 90.5 61 73.0 62 75.0 63 84.0 64 74.0 65 72.0 66 71.5 67 71.0 68 70.0 69 51.0 70 52.5 71 52.0 72 39.5 73 29.5 74 29.0 75 28.5 76 17.5 77 14.5 78 10.5 79 7.0 80 6.5 81 3.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.325 #Duplication Level Percentage of deduplicated Percentage of total 1 88.3194961351274 77.125 2 9.934154022330375 17.349999999999998 3 1.3741769252791298 3.5999999999999996 4 0.2004008016032064 0.7000000000000001 5 0.057257371886630395 0.25 6 0.028628685943315198 0.15 7 0.028628685943315198 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.057257371886630395 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 13 0.325 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 13 0.325 TruSeq Adapter, Index 13 (97% over 38bp) GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCAT 7 0.17500000000000002 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit GGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGC 5 0.125 No Hit GCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.325 0.0 0.0 0.0 0.0 50-51 0.375 0.0 0.0 0.0 0.0 52-53 0.5125 0.0 0.0 0.0 0.0 54-55 0.6125 0.0 0.0 0.0 0.0 56-57 0.8 0.0 0.0 0.0 0.0 58-59 1.0625 0.0 0.0 0.0 0.0 60-61 1.325 0.0 0.0 0.0 0.0 62-63 1.4875 0.0 0.0 0.0 0.0 64-65 1.6125 0.0 0.0 0.0 0.0 66-67 1.875 0.0 0.0 0.0 0.0 68-69 2.0875000000000004 0.0 0.0 0.0 0.0 70-71 2.4375 0.0 0.0 0.0 0.0 72-73 2.8875 0.0 0.0 0.0 0.0 74-75 3.35 0.0 0.0 0.0 0.0 76-77 3.7625 0.0 0.0 0.0 0.0 78-79 4.175 0.0 0.0 0.0 0.0 80-81 4.5375 0.0 0.0 0.0 0.0 82-83 4.975 0.0 0.0 0.0 0.0 84-85 5.475 0.0 0.0 0.0 0.0 86-87 5.949999999999999 0.0 0.0 0.0 0.0 88-89 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450085 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.975 37.0 37.0 37.0 37.0 37.0 2 35.93 37.0 37.0 37.0 37.0 37.0 3 35.9125 37.0 37.0 37.0 37.0 37.0 4 35.9165 37.0 37.0 37.0 37.0 37.0 5 36.095 37.0 37.0 37.0 37.0 37.0 6 36.105 37.0 37.0 37.0 37.0 37.0 7 36.1405 37.0 37.0 37.0 37.0 37.0 8 36.0805 37.0 37.0 37.0 37.0 37.0 9 36.134 37.0 37.0 37.0 37.0 37.0 10-11 36.08225 37.0 37.0 37.0 37.0 37.0 12-13 36.064 37.0 37.0 37.0 37.0 37.0 14-15 36.021 37.0 37.0 37.0 37.0 37.0 16-17 36.050749999999994 37.0 37.0 37.0 37.0 37.0 18-19 36.07875 37.0 37.0 37.0 37.0 37.0 20-21 36.01675 37.0 37.0 37.0 37.0 37.0 22-23 36.0435 37.0 37.0 37.0 37.0 37.0 24-25 36.025 37.0 37.0 37.0 37.0 37.0 26-27 35.974500000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.953 37.0 37.0 37.0 37.0 37.0 30-31 35.8845 37.0 37.0 37.0 37.0 37.0 32-33 35.894499999999994 37.0 37.0 37.0 37.0 37.0 34-35 35.903000000000006 37.0 37.0 37.0 37.0 37.0 36-37 35.827 37.0 37.0 37.0 37.0 37.0 38-39 35.89675 37.0 37.0 37.0 37.0 37.0 40-41 35.7635 37.0 37.0 37.0 37.0 37.0 42-43 35.84525 37.0 37.0 37.0 37.0 37.0 44-45 35.853750000000005 37.0 37.0 37.0 37.0 37.0 46-47 35.78025 37.0 37.0 37.0 37.0 37.0 48-49 35.792500000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.81125 37.0 37.0 37.0 37.0 37.0 52-53 35.89025 37.0 37.0 37.0 37.0 37.0 54-55 35.8 37.0 37.0 37.0 37.0 37.0 56-57 35.810249999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.8555 37.0 37.0 37.0 37.0 37.0 60-61 35.769000000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.85725 37.0 37.0 37.0 37.0 37.0 64-65 35.9075 37.0 37.0 37.0 37.0 37.0 66-67 35.86175 37.0 37.0 37.0 37.0 37.0 68-69 35.73125 37.0 37.0 37.0 37.0 37.0 70-71 35.807500000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.769 37.0 37.0 37.0 37.0 37.0 74-75 35.652249999999995 37.0 37.0 37.0 37.0 37.0 76-77 35.699 37.0 37.0 37.0 37.0 37.0 78-79 35.6685 37.0 37.0 37.0 37.0 37.0 80-81 35.7285 37.0 37.0 37.0 37.0 37.0 82-83 35.663 37.0 37.0 37.0 37.0 37.0 84-85 35.686 37.0 37.0 37.0 37.0 37.0 86-87 35.629999999999995 37.0 37.0 37.0 37.0 37.0 88-89 35.661500000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.683 37.0 37.0 37.0 37.0 37.0 92-93 35.55875 37.0 37.0 37.0 37.0 37.0 94-95 35.65725 37.0 37.0 37.0 37.0 37.0 96-97 35.535 37.0 37.0 37.0 37.0 37.0 98-99 35.589 37.0 37.0 37.0 37.0 37.0 100-101 35.542500000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 7.0 16 2.0 17 4.0 18 0.0 19 10.0 20 8.0 21 11.0 22 24.0 23 9.0 24 18.0 25 10.0 26 14.0 27 22.0 28 26.0 29 25.0 30 29.0 31 43.0 32 46.0 33 77.0 34 123.0 35 222.0 36 2060.0 37 1203.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.65 15.975 12.8 29.575000000000003 2 27.3 22.85 25.7 24.15 3 26.325 23.75 26.575 23.35 4 30.375000000000004 26.174999999999997 18.075 25.374999999999996 5 30.349999999999998 29.25 18.125 22.275 6 25.55 32.9 19.025 22.525000000000002 7 26.1 18.175 30.599999999999998 25.124999999999996 8 26.325 21.5 22.0 30.175 9 26.700000000000003 22.7 23.974999999999998 26.625 10-11 27.6625 26.8625 19.0625 26.4125 12-13 29.7375 22.25 20.9375 27.075 14-15 28.7375 24.0625 21.912499999999998 25.2875 16-17 29.4375 23.3625 21.6875 25.5125 18-19 28.425 24.5625 21.762500000000003 25.25 20-21 28.175 24.099999999999998 21.925 25.8 22-23 28.262500000000003 23.8625 22.25 25.624999999999996 24-25 28.050000000000004 23.5625 22.825 25.5625 26-27 27.6625 24.7375 22.8625 24.7375 28-29 28.8375 22.912499999999998 21.65 26.6 30-31 27.775 24.099999999999998 22.2125 25.912499999999998 32-33 27.075 24.5375 22.25 26.137500000000003 34-35 26.737499999999997 24.85 22.7125 25.7 36-37 27.400000000000002 24.075 23.0375 25.4875 38-39 27.825 23.825 23.0375 25.3125 40-41 28.125 23.9 21.525 26.450000000000003 42-43 27.6375 24.15 22.875 25.337500000000002 44-45 27.125 25.2125 21.8875 25.775 46-47 27.9125 24.462500000000002 22.287499999999998 25.337500000000002 48-49 27.712500000000002 24.3625 22.8625 25.0625 50-51 27.6875 25.874999999999996 21.4 25.0375 52-53 28.1 23.7125 22.4625 25.724999999999998 54-55 27.6 24.2875 22.225 25.887500000000003 56-57 28.1875 24.5375 22.25 25.025 58-59 29.549999999999997 23.724999999999998 22.1375 24.587500000000002 60-61 27.6875 24.65 22.125 25.5375 62-63 28.499999999999996 24.4375 22.225 24.837500000000002 64-65 28.875 24.1375 21.75 25.2375 66-67 27.737499999999997 24.587500000000002 22.2125 25.4625 68-69 28.012500000000003 24.9375 21.3625 25.687500000000004 70-71 28.9 24.3 21.925 24.875 72-73 28.15 24.6625 21.837500000000002 25.35 74-75 28.9875 24.837500000000002 21.637500000000003 24.5375 76-77 29.1375 25.0375 20.6375 25.1875 78-79 28.449999999999996 24.15 21.85 25.55 80-81 28.1875 24.1875 22.95 24.675 82-83 28.299999999999997 24.2875 21.8125 25.6 84-85 28.0875 24.0625 22.325 25.525 86-87 28.962500000000002 24.4125 22.0625 24.5625 88-89 29.762499999999996 23.5125 21.912499999999998 24.8125 90-91 28.1375 24.962500000000002 22.287499999999998 24.6125 92-93 28.6375 24.887500000000003 22.162499999999998 24.3125 94-95 28.725 25.624999999999996 21.85 23.799999999999997 96-97 29.425 23.6625 22.75 24.1625 98-99 29.7125 25.362499999999997 21.85 23.075000000000003 100-101 29.562500000000004 25.2125 22.3125 22.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.5 11 2.0 12 2.5 13 1.5 14 1.5 15 3.0 16 2.0 17 1.5 18 3.0 19 2.0 20 1.5 21 3.0 22 3.0 23 2.5 24 2.5 25 2.5 26 4.0 27 4.0 28 3.0 29 3.0 30 3.5 31 2.5 32 4.5 33 9.5 34 7.0 35 6.5 36 17.5 37 31.5 38 35.0 39 47.0 40 62.0 41 74.5 42 113.5 43 121.5 44 117.0 45 134.0 46 159.0 47 172.5 48 174.5 49 165.5 50 147.0 51 161.5 52 148.0 53 132.0 54 137.0 55 133.5 56 132.5 57 131.0 58 119.5 59 105.5 60 96.5 61 93.5 62 90.5 63 72.0 64 67.5 65 70.0 66 65.0 67 64.5 68 68.0 69 74.0 70 60.5 71 52.5 72 48.0 73 29.0 74 27.5 75 26.5 76 23.0 77 21.5 78 13.5 79 9.0 80 9.5 81 5.5 82 2.5 83 2.5 84 2.5 85 2.0 86 1.0 87 1.5 88 2.0 89 1.5 90 1.0 91 1.0 92 2.5 93 2.0 94 1.0 95 3.0 96 4.0 97 3.5 98 4.0 99 5.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.7 #Duplication Level Percentage of deduplicated Percentage of total 1 89.14881623449831 79.07499999999999 2 9.385569334836527 16.650000000000002 3 1.2683201803833146 3.375 4 0.16910935738444194 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02818489289740699 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.325 0.0 0.0 0.0 0.0 50-51 0.375 0.0 0.0 0.0 0.0 52-53 0.5375000000000001 0.0 0.0 0.0 0.0 54-55 0.6375 0.0 0.0 0.0 0.0 56-57 0.825 0.0 0.0 0.0 0.0 58-59 1.0875 0.0 0.0 0.0 0.0 60-61 1.35 0.0 0.0 0.0 0.0 62-63 1.5125 0.0 0.0 0.0 0.0 64-65 1.6375 0.0 0.0 0.0 0.0 66-67 1.9125 0.0 0.0 0.0 0.0 68-69 2.1624999999999996 0.0 0.0 0.0 0.0 70-71 2.5125 0.0 0.0 0.0 0.0 72-73 2.9625 0.0 0.0 0.0 0.0 74-75 3.425 0.0 0.0 0.0 0.0 76-77 3.7875 0.0 0.0 0.0 0.0 78-79 4.1625 0.0 0.0 0.0 0.0 80-81 4.5125 0.0 0.0 0.0 0.0 82-83 4.95 0.0 0.0 0.0 0.0 84-85 5.45 0.0 0.0 0.0 0.0 86-87 5.9375 0.0 0.0 0.0 0.0 88-89 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205986 spots for ERR3450085.sra Written 2205986 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra Read 2205968 spots for ERR3450085.sra Written 2205968 spots for ERR3450085.sra SRR ids: ['ERR3450085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sv_oep1n ERR3450085.sra spots: 44119378 blocks: [[1, 2205968], [2205969, 4411936], [4411937, 6617904], [6617905, 8823872], [8823873, 11029840], [11029841, 13235808], [13235809, 15441776], [15441777, 17647744], [17647745, 19853712], [19853713, 22059680], [22059681, 24265648], [24265649, 26471616], [26471617, 28677584], [28677585, 30883552], [30883553, 33089520], [33089521, 35295488], [35295489, 37501456], [37501457, 39707424], [39707425, 41913392], [41913393, 44119378]] ERR3450085 file size 10620376 ERR3450085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450085 ERR3450085_1.fastq ERR3450085_2.fastq Input file: ERR3450085_1.fastq Paired file: ERR3450085_2.fastq trimmed: ERR3450085-trimmed-pair1.fastq, ERR3450085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:01:17 2024 >> started Sat Dec 7 15:01:54 2024 >> done (37.189s) 44119378 read pairs processed; of these: 419 ( 0.00%) short read pairs filtered out after trimming by size control 277237 ( 0.63%) empty read pairs filtered out after trimming by size control 43841722 (99.37%) read pairs available; of these: 5741186 (13.10%) trimmed read pairs available after processing 38100536 (86.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 93 0.00% 19 184 0.00% 20 544 0.00% 21 1302 0.00% 22 1626 0.00% 23 777 0.00% 24 818 0.00% 25 991 0.00% 26 1450 0.00% 27 2046 0.00% 28 2948 0.01% 29 3732 0.01% 30 4679 0.01% 31 5679 0.01% 32 5999 0.01% 33 5762 0.01% 34 6096 0.01% 35 6209 0.01% 36 6496 0.01% 37 7095 0.02% 38 8516 0.02% 39 9737 0.02% 40 11327 0.03% 41 13462 0.03% 42 14979 0.03% 43 16034 0.04% 44 14327 0.03% 45 14833 0.03% 46 15462 0.04% 47 16861 0.04% 48 18650 0.04% 49 20515 0.05% 50 22616 0.05% 51 25540 0.06% 52 27639 0.06% 53 29781 0.07% 54 31002 0.07% 55 32706 0.07% 56 34322 0.08% 57 35503 0.08% 58 38526 0.09% 59 41965 0.10% 60 45686 0.10% 61 49816 0.11% 62 53810 0.12% 63 58049 0.13% 64 60602 0.14% 65 62860 0.14% 66 64562 0.15% 67 68786 0.16% 68 71791 0.16% 69 73717 0.17% 70 79416 0.18% 71 84400 0.19% 72 90623 0.21% 73 94391 0.22% 74 99057 0.23% 75 101795 0.23% 76 105041 0.24% 77 109070 0.25% 78 112465 0.26% 79 118760 0.27% 80 122148 0.28% 81 127716 0.29% 82 132753 0.30% 83 137758 0.31% 84 142667 0.33% 85 147033 0.34% 86 150476 0.34% 87 154692 0.35% 88 159151 0.36% 89 162976 0.37% 90 168153 0.38% 91 174329 0.40% 92 180568 0.41% 93 185599 0.42% 94 191596 0.44% 95 195219 0.45% 96 197001 0.45% 97 202384 0.46% 98 206429 0.47% 99 207442 0.47% 100 231570 0.53% 101 38100536 86.90% 43841722 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=22 prefix-density=0.24 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=87.82 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=9.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=24 prefix-density=0.21 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=217.26 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=23.9 sequence=CGGCGGCGGCGA ERR3450085 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:02:24 Started mapping on | Dec 07 15:02:25 Finished on | Dec 07 15:05:11 Mapping speed, Million of reads per hour | 950.78 Number of input reads | 43841722 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 35683670 Uniquely mapped reads % | 81.39% Average mapped length | 196.43 Number of splices: Total | 22286017 Number of splices: Annotated (sjdb) | 21105921 Number of splices: GT/AG | 21989907 Number of splices: GC/AG | 258119 Number of splices: AT/AC | 11992 Number of splices: Non-canonical | 25999 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3015045 % of reads mapped to multiple loci | 6.88% Number of reads mapped to too many loci | 803303 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 6.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5143007 5143007 5143007 N_multimapping 3015045 3015045 3015045 N_noFeature 1097604 34259741 1970015 N_ambiguous 689590 5522 147362 UnstrandedReadsAssigned:33896476 PositiveStrandReadsAssigned:1418407 NegativeStrandReadsAssigned:33566293 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450085-trimmed-pair1.fastq ERR3450085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,841,722 reads, 36,003,577 reads pseudoaligned [quant] estimated average fragment length: 175.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,297 rounds 52973 ERR3450085.ke.tsv 35125 ERR3450085.se.tsv 88098 total ==> ERR3450085.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 761.485 65.1786 3.52533 PNS24247 1044 869.391 70.8344 3.35572 PNS24249 1928 1753.39 434.071 10.1962 PNS24246 1044 869.391 70.8344 3.35572 PNS24248 1044 869.391 70.8344 3.35572 PNS24244 1471 1296.39 29.2478 0.929211 PNS24243 293 136.609 5 1.50747 KQK14069 1603 1428.39 13250.3 382.062 KQK14071 474 302.731 519.611 70.6933 ==> ERR3450085.se.tsv <== BRADI_1g14170v3 13872 BRADI_1g53295v3 63 BRADI_1g59795v3 362 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 4256 BRADI_1g74790v3 379 BRADI_1g09890v3 19 BRADI_1g77505v3 511 BRADI_1g48960v3 0 ERR3450085 completed mapping pipeline successfully