Starting /dee2/code/volunteer_pipeline.sh ERR3450089 current disk space = 1542676094976 free memory = 1596886940 ERR3450089 SRAfilesize d828db9dc78bd55dbda799c3c3c7e7d4 ERR3450089.sra ERR3450089.sra file validated ERR3450089 is paired end ERR3450089 is conventional basespace ERR3450089 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21225 37.0 37.0 37.0 37.0 37.0 2 36.422 37.0 37.0 37.0 37.0 37.0 3 36.415 37.0 37.0 37.0 37.0 37.0 4 36.4805 37.0 37.0 37.0 37.0 37.0 5 36.5375 37.0 37.0 37.0 37.0 37.0 6 36.5425 37.0 37.0 37.0 37.0 37.0 7 36.4255 37.0 37.0 37.0 37.0 37.0 8 36.505 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-11 36.524 37.0 37.0 37.0 37.0 37.0 12-13 36.49575 37.0 37.0 37.0 37.0 37.0 14-15 36.50775 37.0 37.0 37.0 37.0 37.0 16-17 36.50575 37.0 37.0 37.0 37.0 37.0 18-19 36.518 37.0 37.0 37.0 37.0 37.0 20-21 36.49275 37.0 37.0 37.0 37.0 37.0 22-23 36.42575 37.0 37.0 37.0 37.0 37.0 24-25 36.43825 37.0 37.0 37.0 37.0 37.0 26-27 36.4065 37.0 37.0 37.0 37.0 37.0 28-29 36.3715 37.0 37.0 37.0 37.0 37.0 30-31 36.388999999999996 37.0 37.0 37.0 37.0 37.0 32-33 36.316 37.0 37.0 37.0 37.0 37.0 34-35 36.29025 37.0 37.0 37.0 37.0 37.0 36-37 36.303250000000006 37.0 37.0 37.0 37.0 37.0 38-39 36.37975 37.0 37.0 37.0 37.0 37.0 40-41 36.2735 37.0 37.0 37.0 37.0 37.0 42-43 36.1935 37.0 37.0 37.0 37.0 37.0 44-45 36.247749999999996 37.0 37.0 37.0 37.0 37.0 46-47 36.167500000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.207750000000004 37.0 37.0 37.0 37.0 37.0 50-51 36.159 37.0 37.0 37.0 37.0 37.0 52-53 36.13875 37.0 37.0 37.0 37.0 37.0 54-55 36.12925 37.0 37.0 37.0 37.0 37.0 56-57 36.162 37.0 37.0 37.0 37.0 37.0 58-59 36.168 37.0 37.0 37.0 37.0 37.0 60-61 36.057500000000005 37.0 37.0 37.0 37.0 37.0 62-63 36.0475 37.0 37.0 37.0 37.0 37.0 64-65 36.08 37.0 37.0 37.0 37.0 37.0 66-67 36.091 37.0 37.0 37.0 37.0 37.0 68-69 36.00075 37.0 37.0 37.0 37.0 37.0 70-71 35.93175 37.0 37.0 37.0 37.0 37.0 72-73 35.794250000000005 37.0 37.0 37.0 37.0 37.0 74-75 36.04900000000001 37.0 37.0 37.0 37.0 37.0 76-77 36.13675 37.0 37.0 37.0 37.0 37.0 78-79 36.1315 37.0 37.0 37.0 37.0 37.0 80-81 36.11 37.0 37.0 37.0 37.0 37.0 82-83 36.141999999999996 37.0 37.0 37.0 37.0 37.0 84-85 36.12575 37.0 37.0 37.0 37.0 37.0 86-87 36.00025 37.0 37.0 37.0 37.0 37.0 88-89 36.12775 37.0 37.0 37.0 37.0 37.0 90-91 36.0795 37.0 37.0 37.0 37.0 37.0 92-93 35.92875 37.0 37.0 37.0 37.0 37.0 94-95 35.97225 37.0 37.0 37.0 37.0 37.0 96-97 35.8855 37.0 37.0 37.0 37.0 37.0 98-99 35.84975 37.0 37.0 37.0 37.0 37.0 100-101 35.89075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 2.0 25 13.0 26 8.0 27 25.0 28 18.0 29 35.0 30 49.0 31 41.0 32 65.0 33 94.0 34 98.0 35 177.0 36 1775.0 37 1595.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.107545750814744 9.651541739784406 10.478816746051642 40.76209576334921 2 21.725 13.575000000000001 30.45 34.25 3 21.675 16.925 25.1 36.3 4 30.15 21.4 17.875 30.575000000000003 5 26.775 27.200000000000003 21.6 24.425 6 23.9 30.325000000000003 24.625 21.15 7 19.7 23.75 36.325 20.225 8 21.075 21.025 30.675 27.224999999999998 9 22.775000000000002 21.875 30.925000000000004 24.425 10-11 24.712500000000002 27.725 22.6 24.962500000000002 12-13 24.2625 22.6875 25.874999999999996 27.175 14-15 24.075 24.7375 25.1875 26.0 16-17 24.05 24.55 25.0 26.400000000000002 18-19 24.8 24.675 25.387500000000003 25.137500000000003 20-21 24.8125 24.9 25.137500000000003 25.15 22-23 23.9375 25.15 23.6375 27.275 24-25 24.6 23.4125 25.074999999999996 26.9125 26-27 23.45 24.15 24.712500000000002 27.6875 28-29 24.85 24.175 22.912499999999998 28.0625 30-31 23.9875 24.087500000000002 24.85 27.075 32-33 24.575 23.8875 24.8 26.737499999999997 34-35 25.224999999999998 23.95 24.575 26.25 36-37 24.962500000000002 23.125 24.825 27.0875 38-39 25.074999999999996 23.5875 24.0 27.3375 40-41 24.962500000000002 24.325 23.8625 26.85 42-43 25.7 24.7 23.9125 25.687500000000004 44-45 26.4125 23.6125 23.6625 26.3125 46-47 24.1625 24.375 24.9375 26.525 48-49 24.474999999999998 24.0375 23.6125 27.875 50-51 24.6125 22.825 24.625 27.9375 52-53 24.349999999999998 24.1375 23.1 28.4125 54-55 26.137500000000003 23.7375 23.1125 27.0125 56-57 25.6125 23.8125 24.45 26.125 58-59 25.2625 23.724999999999998 24.0 27.0125 60-61 25.2 23.375 24.099999999999998 27.325 62-63 24.2375 23.425 24.8 27.537499999999998 64-65 24.587500000000002 23.875 24.0625 27.474999999999998 66-67 25.637500000000003 24.0 23.7625 26.6 68-69 25.387500000000003 23.3 24.75 26.5625 70-71 23.5875 24.3 24.275 27.8375 72-73 25.224999999999998 23.8125 23.8625 27.1 74-75 24.8125 24.15 23.95 27.0875 76-77 25.525 24.0375 23.6125 26.825 78-79 24.9875 24.2625 22.825 27.925 80-81 24.474999999999998 24.887500000000003 24.2875 26.35 82-83 25.2375 23.8125 23.9125 27.037499999999998 84-85 25.112499999999997 23.7125 23.6875 27.487499999999997 86-87 24.7375 23.775 23.5625 27.925 88-89 24.7875 25.05 23.35 26.8125 90-91 25.837500000000002 23.8875 22.95 27.325 92-93 24.525 24.2375 24.8625 26.375 94-95 26.1 23.724999999999998 23.5125 26.6625 96-97 25.074999999999996 24.3875 22.9875 27.55 98-99 24.8625 24.1125 24.55 26.474999999999998 100-101 25.0125 23.9125 23.549999999999997 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.5 3 0.5 4 0.5 5 0.5 6 1.0 7 1.5 8 1.5 9 1.5 10 1.5 11 1.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 0.5 26 2.0 27 2.5 28 0.5 29 1.0 30 2.0 31 1.5 32 6.0 33 11.0 34 14.5 35 16.0 36 17.5 37 28.5 38 41.0 39 58.5 40 79.0 41 97.0 42 114.0 43 133.0 44 139.5 45 151.0 46 171.0 47 181.0 48 184.5 49 187.0 50 181.5 51 175.0 52 162.0 53 151.0 54 153.0 55 139.5 56 128.0 57 131.0 58 126.0 59 94.5 60 81.0 61 82.5 62 75.5 63 68.0 64 67.0 65 60.0 66 60.0 67 63.0 68 53.5 69 42.5 70 38.5 71 39.0 72 32.0 73 22.5 74 19.0 75 19.0 76 12.0 77 13.5 78 12.0 79 8.5 80 8.0 81 4.0 82 1.5 83 1.5 84 1.5 85 2.0 86 2.5 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.575 #Duplication Level Percentage of deduplicated Percentage of total 1 89.9802427321479 79.7 2 8.128704487722269 14.399999999999999 3 1.2983347445667512 3.45 4 0.4515946937623483 1.6 5 0.056449336720293536 0.25 6 0.056449336720293536 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028224668360146768 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit CCTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAGCAG 6 0.15 No Hit CCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTG 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) CTTCAAAGTAACGATGCCGGAGGCACGACCCGGCCAATTAAGGCTAGGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1375 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.2875 0.0 0.0 0.0 0.0 42-43 0.3375 0.0 0.0 0.0 0.0 44-45 0.3875 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.5875 0.0 0.0 0.0 0.0 50-51 0.6875 0.0 0.0 0.0 0.0 52-53 0.775 0.0 0.0 0.0 0.0 54-55 0.875 0.0 0.0 0.0 0.0 56-57 1.0375 0.0 0.0 0.0 0.0 58-59 1.1625 0.0 0.0 0.0 0.0 60-61 1.3 0.0 0.0 0.0 0.0 62-63 1.475 0.0 0.0 0.0 0.0 64-65 1.6625 0.0 0.0 0.0 0.0 66-67 1.85 0.0 0.0 0.0 0.0 68-69 2.1125 0.0 0.0 0.0 0.0 70-71 2.5375 0.0 0.0 0.0 0.0 72-73 2.7375 0.0 0.0 0.0 0.0 74-75 3.1125 0.0 0.0 0.0 0.0 76-77 3.475 0.0 0.0 0.0 0.0 78-79 3.85 0.0 0.0 0.0 0.0 80-81 4.25 0.0 0.0 0.0 0.0 82-83 4.6875 0.0 0.0 0.0 0.0 84-85 5.3625 0.0 0.0 0.0 0.0 86-87 5.8875 0.0 0.0 0.0 0.0 88-89 6.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450089 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1905 37.0 37.0 37.0 37.0 37.0 2 36.0255 37.0 37.0 37.0 37.0 37.0 3 36.063 37.0 37.0 37.0 37.0 37.0 4 36.085 37.0 37.0 37.0 37.0 37.0 5 36.2745 37.0 37.0 37.0 37.0 37.0 6 36.366 37.0 37.0 37.0 37.0 37.0 7 36.16 37.0 37.0 37.0 37.0 37.0 8 36.2355 37.0 37.0 37.0 37.0 37.0 9 36.1475 37.0 37.0 37.0 37.0 37.0 10-11 36.123000000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.216499999999996 37.0 37.0 37.0 37.0 37.0 14-15 36.0215 37.0 37.0 37.0 37.0 37.0 16-17 36.07925 37.0 37.0 37.0 37.0 37.0 18-19 36.01025 37.0 37.0 37.0 37.0 37.0 20-21 36.0165 37.0 37.0 37.0 37.0 37.0 22-23 36.09125 37.0 37.0 37.0 37.0 37.0 24-25 36.07425 37.0 37.0 37.0 37.0 37.0 26-27 35.84 37.0 37.0 37.0 37.0 37.0 28-29 35.764250000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.738 37.0 37.0 37.0 37.0 37.0 32-33 35.81 37.0 37.0 37.0 37.0 37.0 34-35 35.64075 37.0 37.0 37.0 37.0 37.0 36-37 35.7 37.0 37.0 37.0 37.0 37.0 38-39 35.614 37.0 37.0 37.0 37.0 37.0 40-41 35.595749999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.75175 37.0 37.0 37.0 37.0 37.0 44-45 35.78375 37.0 37.0 37.0 37.0 37.0 46-47 35.6415 37.0 37.0 37.0 37.0 37.0 48-49 35.689499999999995 37.0 37.0 37.0 37.0 37.0 50-51 35.754999999999995 37.0 37.0 37.0 37.0 37.0 52-53 35.70675 37.0 37.0 37.0 37.0 37.0 54-55 35.77075 37.0 37.0 37.0 37.0 37.0 56-57 35.732749999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.786500000000004 37.0 37.0 37.0 37.0 37.0 60-61 35.754999999999995 37.0 37.0 37.0 37.0 37.0 62-63 35.852 37.0 37.0 37.0 37.0 37.0 64-65 35.903999999999996 37.0 37.0 37.0 37.0 37.0 66-67 35.74125 37.0 37.0 37.0 37.0 37.0 68-69 35.72475 37.0 37.0 37.0 37.0 37.0 70-71 35.625 37.0 37.0 37.0 37.0 37.0 72-73 35.6725 37.0 37.0 37.0 37.0 37.0 74-75 35.5955 37.0 37.0 37.0 37.0 37.0 76-77 35.705 37.0 37.0 37.0 37.0 37.0 78-79 35.62625 37.0 37.0 37.0 37.0 37.0 80-81 35.394499999999994 37.0 37.0 37.0 37.0 37.0 82-83 35.5095 37.0 37.0 37.0 37.0 37.0 84-85 35.5775 37.0 37.0 37.0 37.0 37.0 86-87 35.5995 37.0 37.0 37.0 37.0 37.0 88-89 35.5715 37.0 37.0 37.0 37.0 37.0 90-91 35.66175 37.0 37.0 37.0 37.0 37.0 92-93 35.675250000000005 37.0 37.0 37.0 37.0 37.0 94-95 35.579750000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.55625 37.0 37.0 37.0 37.0 37.0 98-99 35.4895 37.0 37.0 37.0 37.0 37.0 100-101 35.576750000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 4.0 17 6.0 18 8.0 19 6.0 20 6.0 21 5.0 22 9.0 23 12.0 24 13.0 25 18.0 26 16.0 27 16.0 28 16.0 29 37.0 30 33.0 31 46.0 32 65.0 33 90.0 34 140.0 35 340.0 36 2385.0 37 727.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.300000000000004 17.150000000000002 12.85 29.7 2 27.500000000000004 22.425 25.374999999999996 24.7 3 26.575 24.75 26.375 22.3 4 30.375000000000004 28.449999999999996 16.5 24.675 5 29.299999999999997 29.125 19.725 21.85 6 24.725 31.474999999999998 20.575 23.225 7 24.325 19.3 30.875000000000004 25.5 8 25.775 22.2 23.3 28.725 9 26.674999999999997 22.95 24.75 25.624999999999996 10-11 29.612500000000004 25.224999999999998 19.8125 25.35 12-13 28.249999999999996 22.675 22.3625 26.7125 14-15 27.0625 24.5625 22.8625 25.5125 16-17 29.325000000000003 23.549999999999997 21.6 25.525 18-19 28.475 25.275 22.125 24.125 20-21 27.275 23.925 23.9125 24.887500000000003 22-23 27.9125 24.025 22.85 25.2125 24-25 27.1125 25.3 23.1625 24.425 26-27 27.575 24.85 23.549999999999997 24.025 28-29 27.875 25.0625 22.125 24.9375 30-31 28.349999999999998 24.4125 21.925 25.3125 32-33 27.737499999999997 24.05 22.6125 25.6 34-35 28.3875 24.975 22.175 24.462500000000002 36-37 27.1125 24.6125 22.8125 25.4625 38-39 28.287499999999998 24.224999999999998 22.3125 25.174999999999997 40-41 28.4 24.099999999999998 22.775000000000002 24.725 42-43 28.549999999999997 23.4375 22.6125 25.4 44-45 26.6125 25.025 22.8375 25.525 46-47 28.3875 24.425 21.9625 25.224999999999998 48-49 27.0 25.1875 22.95 24.8625 50-51 27.0 23.35 23.875 25.775 52-53 28.262500000000003 23.9875 23.0875 24.6625 54-55 28.275 24.1375 22.25 25.337500000000002 56-57 27.9125 24.875 23.0875 24.125 58-59 27.5125 24.4875 22.400000000000002 25.6 60-61 28.9 24.1125 22.5625 24.425 62-63 27.250000000000004 24.2375 22.775000000000002 25.7375 64-65 28.212500000000002 25.374999999999996 21.55 24.8625 66-67 28.212500000000002 23.925 22.787499999999998 25.074999999999996 68-69 29.275000000000002 23.825 22.175 24.725 70-71 29.4875 25.224999999999998 21.975 23.3125 72-73 27.725 24.474999999999998 23.225 24.575 74-75 27.962500000000002 24.462500000000002 22.6875 24.887500000000003 76-77 28.349999999999998 24.425 22.5 24.725 78-79 28.475 23.0875 22.787499999999998 25.650000000000002 80-81 28.4 24.6625 22.675 24.2625 82-83 27.85 24.375 22.825 24.95 84-85 27.762500000000003 24.087500000000002 23.075000000000003 25.074999999999996 86-87 27.750000000000004 25.0125 23.6625 23.575 88-89 29.612500000000004 23.7125 22.325 24.349999999999998 90-91 29.3875 24.85 22.1375 23.625 92-93 29.212500000000002 24.525 22.2625 24.0 94-95 28.7 25.525 21.825 23.95 96-97 28.499999999999996 25.3 23.05 23.150000000000002 98-99 28.925 24.5 22.975 23.599999999999998 100-101 30.5125 23.7375 22.4375 23.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.5 18 1.0 19 1.5 20 2.5 21 2.5 22 3.0 23 1.5 24 0.5 25 0.5 26 1.0 27 2.0 28 2.0 29 1.5 30 2.5 31 4.5 32 6.5 33 6.0 34 9.5 35 17.5 36 24.5 37 40.5 38 48.5 39 51.0 40 66.5 41 83.0 42 92.0 43 116.5 44 144.5 45 152.5 46 162.5 47 182.0 48 176.5 49 161.5 50 156.5 51 151.5 52 163.0 53 163.0 54 136.0 55 136.5 56 143.5 57 125.5 58 108.0 59 98.5 60 97.5 61 82.5 62 74.5 63 75.5 64 87.0 65 84.0 66 65.5 67 65.5 68 61.5 69 53.0 70 44.0 71 37.0 72 32.5 73 30.5 74 28.0 75 24.5 76 19.0 77 12.5 78 12.5 79 8.0 80 3.0 81 5.0 82 4.0 83 2.0 84 2.0 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 1.0 97 2.5 98 3.0 99 4.5 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.775 #Duplication Level Percentage of deduplicated Percentage of total 1 90.08729935229512 79.975 2 8.138552520416784 14.45 3 1.4080540692762602 3.75 4 0.25344973246972685 0.8999999999999999 5 0.0 0.0 6 0.028161081385525203 0.15 7 0.028161081385525203 0.17500000000000002 8 0.028161081385525203 0.2 9 0.0 0.0 >10 0.028161081385525203 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 8 0.2 No Hit GTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTATATAGCC 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1375 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.2875 0.0 0.0 0.0 0.0 42-43 0.3375 0.0 0.0 0.0 0.0 44-45 0.3875 0.0 0.0 0.0 0.0 46-47 0.4 0.0 0.0 0.0 0.0 48-49 0.5875 0.0 0.0 0.0 0.0 50-51 0.6875 0.0 0.0 0.0 0.0 52-53 0.75 0.0 0.0 0.0 0.0 54-55 0.85 0.0 0.0 0.0 0.0 56-57 0.9625 0.0 0.0 0.0 0.0 58-59 1.0875 0.0 0.0 0.0 0.0 60-61 1.225 0.0 0.0 0.0 0.0 62-63 1.4125 0.0 0.0 0.0 0.0 64-65 1.6125 0.0 0.0 0.0 0.0 66-67 1.8 0.0 0.0 0.0 0.0 68-69 2.075 0.0 0.0 0.0 0.0 70-71 2.5125 0.0 0.0 0.0 0.0 72-73 2.7375 0.0 0.0 0.0 0.0 74-75 3.1375 0.0 0.0 0.0 0.0 76-77 3.5 0.0 0.0 0.0 0.0 78-79 3.875 0.0 0.0 0.0 0.0 80-81 4.275 0.0 0.0 0.0 0.0 82-83 4.699999999999999 0.0 0.0 0.0 0.0 84-85 5.3625 0.0 0.0 0.0 0.0 86-87 5.8625 0.0 0.0 0.0 0.0 88-89 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124137 spots for ERR3450089.sra Written 1124137 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra Read 1124121 spots for ERR3450089.sra Written 1124121 spots for ERR3450089.sra SRR ids: ['ERR3450089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vax60w24 ERR3450089.sra spots: 22482436 blocks: [[1, 1124121], [1124122, 2248242], [2248243, 3372363], [3372364, 4496484], [4496485, 5620605], [5620606, 6744726], [6744727, 7868847], [7868848, 8992968], [8992969, 10117089], [10117090, 11241210], [11241211, 12365331], [12365332, 13489452], [13489453, 14613573], [14613574, 15737694], [15737695, 16861815], [16861816, 17985936], [17985937, 19110057], [19110058, 20234178], [20234179, 21358299], [21358300, 22482436]] ERR3450089 file size 5401309 ERR3450089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450089 ERR3450089_1.fastq ERR3450089_2.fastq Input file: ERR3450089_1.fastq Paired file: ERR3450089_2.fastq trimmed: ERR3450089-trimmed-pair1.fastq, ERR3450089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:06:20 2024 >> started Sat Dec 7 15:07:19 2024 >> done (59.703s) 22482436 read pairs processed; of these: 193 ( 0.00%) short read pairs filtered out after trimming by size control 54530 ( 0.24%) empty read pairs filtered out after trimming by size control 22427713 (99.76%) read pairs available; of these: 2728096 (12.16%) trimmed read pairs available after processing 19699617 (87.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 45 0.00% 19 81 0.00% 20 193 0.00% 21 509 0.00% 22 654 0.00% 23 293 0.00% 24 303 0.00% 25 471 0.00% 26 588 0.00% 27 910 0.00% 28 1262 0.01% 29 1564 0.01% 30 1916 0.01% 31 2410 0.01% 32 2521 0.01% 33 2372 0.01% 34 2331 0.01% 35 2348 0.01% 36 2738 0.01% 37 2886 0.01% 38 3553 0.02% 39 4094 0.02% 40 4732 0.02% 41 5611 0.03% 42 6474 0.03% 43 6757 0.03% 44 6348 0.03% 45 6309 0.03% 46 6667 0.03% 47 7643 0.03% 48 8224 0.04% 49 9194 0.04% 50 10358 0.05% 51 11570 0.05% 52 12453 0.06% 53 13475 0.06% 54 13971 0.06% 55 14839 0.07% 56 15320 0.07% 57 16114 0.07% 58 17659 0.08% 59 19219 0.09% 60 20738 0.09% 61 22800 0.10% 62 24650 0.11% 63 26662 0.12% 64 28074 0.13% 65 28794 0.13% 66 30465 0.14% 67 31971 0.14% 68 33207 0.15% 69 34442 0.15% 70 36890 0.16% 71 39695 0.18% 72 42571 0.19% 73 44360 0.20% 74 46186 0.21% 75 48123 0.21% 76 49533 0.22% 77 51027 0.23% 78 53478 0.24% 79 55759 0.25% 80 57200 0.26% 81 59332 0.26% 82 62849 0.28% 83 64494 0.29% 84 67499 0.30% 85 70896 0.32% 86 71531 0.32% 87 75032 0.33% 88 76953 0.34% 89 79465 0.35% 90 81263 0.36% 91 85110 0.38% 92 88785 0.40% 93 89678 0.40% 94 93388 0.42% 95 95577 0.43% 96 96704 0.43% 97 99589 0.44% 98 101472 0.45% 99 101782 0.45% 100 113093 0.50% 101 19699617 87.84% 22427713 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.1 sequence=CCCACTTGGAGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=159.42 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.4 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=23 prefix-density=0.19 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=183.31 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=21.0 sequence=CGGCGGCGGCGC ERR3450089 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:07:54 Started mapping on | Dec 07 15:07:54 Finished on | Dec 07 15:09:32 Mapping speed, Million of reads per hour | 823.88 Number of input reads | 22427713 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 16196142 Uniquely mapped reads % | 72.21% Average mapped length | 196.88 Number of splices: Total | 10165112 Number of splices: Annotated (sjdb) | 9643002 Number of splices: GT/AG | 10033836 Number of splices: GC/AG | 114802 Number of splices: AT/AC | 5554 Number of splices: Non-canonical | 10920 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1282334 % of reads mapped to multiple loci | 5.72% Number of reads mapped to too many loci | 898688 % of reads mapped to too many loci | 4.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 15.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4949237 4949237 4949237 N_multimapping 1282334 1282334 1282334 N_noFeature 521203 15562541 918302 N_ambiguous 289163 2304 55138 UnstrandedReadsAssigned:15385776 PositiveStrandReadsAssigned:631297 NegativeStrandReadsAssigned:15222702 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450089-trimmed-pair1.fastq ERR3450089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,427,713 reads, 16,214,863 reads pseudoaligned [quant] estimated average fragment length: 179.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 ERR3450089.ke.tsv 35125 ERR3450089.se.tsv 88098 total ==> ERR3450089.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.01 0 0 PNS24247 1044 865.786 25.4822 2.71242 PNS24249 1928 1749.79 183.374 9.6579 PNS24246 1044 865.786 25.4822 2.71242 PNS24248 1044 865.786 25.4822 2.71242 PNS24244 1471 1292.79 31.1792 2.22263 PNS24243 293 134.47 0 0 KQK14069 1603 1424.79 3014.49 194.982 KQK14071 474 299.294 152.324 46.9029 ==> ERR3450089.se.tsv <== BRADI_1g14170v3 3233 BRADI_1g53295v3 17 BRADI_1g59795v3 168 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 1666 BRADI_1g74790v3 151 BRADI_1g09890v3 19 BRADI_1g77505v3 196 BRADI_1g48960v3 0 ERR3450089 completed mapping pipeline successfully