Starting /dee2/code/volunteer_pipeline.sh ERR3450090 current disk space = 1542669754368 free memory = 1596886864 ERR3450090 SRAfilesize 611c90b7ff97e1b32273b002c72a3c81 ERR3450090.sra ERR3450090.sra file validated ERR3450090 is paired end ERR3450090 is conventional basespace ERR3450090 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99525 37.0 37.0 37.0 37.0 37.0 2 36.424 37.0 37.0 37.0 37.0 37.0 3 36.4295 37.0 37.0 37.0 37.0 37.0 4 36.3855 37.0 37.0 37.0 37.0 37.0 5 36.54 37.0 37.0 37.0 37.0 37.0 6 36.547 37.0 37.0 37.0 37.0 37.0 7 36.51 37.0 37.0 37.0 37.0 37.0 8 36.4795 37.0 37.0 37.0 37.0 37.0 9 36.5665 37.0 37.0 37.0 37.0 37.0 10-11 36.536249999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.54975 37.0 37.0 37.0 37.0 37.0 14-15 36.518249999999995 37.0 37.0 37.0 37.0 37.0 16-17 36.506 37.0 37.0 37.0 37.0 37.0 18-19 36.453 37.0 37.0 37.0 37.0 37.0 20-21 36.546499999999995 37.0 37.0 37.0 37.0 37.0 22-23 36.459 37.0 37.0 37.0 37.0 37.0 24-25 36.489000000000004 37.0 37.0 37.0 37.0 37.0 26-27 36.419 37.0 37.0 37.0 37.0 37.0 28-29 36.428749999999994 37.0 37.0 37.0 37.0 37.0 30-31 36.367999999999995 37.0 37.0 37.0 37.0 37.0 32-33 36.3485 37.0 37.0 37.0 37.0 37.0 34-35 36.32625 37.0 37.0 37.0 37.0 37.0 36-37 36.3655 37.0 37.0 37.0 37.0 37.0 38-39 36.366 37.0 37.0 37.0 37.0 37.0 40-41 36.3525 37.0 37.0 37.0 37.0 37.0 42-43 36.282125 37.0 37.0 37.0 37.0 37.0 44-45 36.259249999999994 37.0 37.0 37.0 37.0 37.0 46-47 36.176249999999996 37.0 37.0 37.0 37.0 37.0 48-49 36.27125 37.0 37.0 37.0 37.0 37.0 50-51 36.2615 37.0 37.0 37.0 37.0 37.0 52-53 36.253 37.0 37.0 37.0 37.0 37.0 54-55 36.2115 37.0 37.0 37.0 37.0 37.0 56-57 36.2295 37.0 37.0 37.0 37.0 37.0 58-59 36.096000000000004 37.0 37.0 37.0 37.0 37.0 60-61 36.15175 37.0 37.0 37.0 37.0 37.0 62-63 35.98825 37.0 37.0 37.0 37.0 37.0 64-65 36.04525 37.0 37.0 37.0 37.0 37.0 66-67 36.0835 37.0 37.0 37.0 37.0 37.0 68-69 36.022 37.0 37.0 37.0 37.0 37.0 70-71 35.911500000000004 37.0 37.0 37.0 37.0 37.0 72-73 35.78875 37.0 37.0 37.0 37.0 37.0 74-75 36.11225 37.0 37.0 37.0 37.0 37.0 76-77 36.17525 37.0 37.0 37.0 37.0 37.0 78-79 36.12575 37.0 37.0 37.0 37.0 37.0 80-81 36.076499999999996 37.0 37.0 37.0 37.0 37.0 82-83 36.14575 37.0 37.0 37.0 37.0 37.0 84-85 36.11725 37.0 37.0 37.0 37.0 37.0 86-87 36.089 37.0 37.0 37.0 37.0 37.0 88-89 36.039249999999996 37.0 37.0 37.0 37.0 37.0 90-91 36.08025 37.0 37.0 37.0 37.0 37.0 92-93 36.03725 37.0 37.0 37.0 37.0 37.0 94-95 36.09025 37.0 37.0 37.0 37.0 37.0 96-97 35.97925 37.0 37.0 37.0 37.0 37.0 98-99 35.97625 37.0 37.0 37.0 37.0 37.0 100-101 35.936499999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 5.0 24 8.0 25 4.0 26 10.0 27 19.0 28 16.0 29 22.0 30 44.0 31 55.0 32 62.0 33 98.0 34 104.0 35 189.0 36 1688.0 37 1674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.392309625534054 9.499874340286505 11.058054787635085 38.04976124654436 2 22.075 15.174999999999999 28.925 33.825 3 21.875 17.925 25.0 35.199999999999996 4 29.425 22.075 17.05 31.45 5 27.675 27.35 21.975 23.0 6 23.275000000000002 30.85 22.85 23.025000000000002 7 19.8 23.325000000000003 35.5 21.375 8 21.224999999999998 22.15 30.15 26.474999999999998 9 22.1 21.275 31.424999999999997 25.2 10-11 24.075 28.212500000000002 22.8625 24.85 12-13 24.325 22.6 25.874999999999996 27.200000000000003 14-15 24.05 24.8 26.3625 24.7875 16-17 24.55 24.425 24.875 26.150000000000002 18-19 23.9875 24.55 25.074999999999996 26.387500000000003 20-21 24.25 25.7625 24.425 25.5625 22-23 24.887500000000003 24.212500000000002 24.099999999999998 26.8 24-25 23.6875 24.3 24.8125 27.200000000000003 26-27 24.2 24.1375 24.337500000000002 27.325 28-29 24.9375 23.625 24.85 26.5875 30-31 25.0625 23.5375 24.625 26.775 32-33 24.25 24.3875 24.637500000000003 26.724999999999998 34-35 25.1 24.0625 24.224999999999998 26.6125 36-37 25.687500000000004 24.3625 23.674999999999997 26.275 38-39 25.3 24.212500000000002 23.45 27.037499999999998 40-41 25.2375 24.1125 23.4375 27.212500000000002 42-43 25.078134766845857 23.665458182272783 24.615576947118388 26.64083010376297 44-45 24.4875 23.65 24.45 27.4125 46-47 24.675 24.1625 24.95 26.2125 48-49 25.174999999999997 24.4 23.974999999999998 26.450000000000003 50-51 24.837500000000002 23.474999999999998 24.4125 27.275 52-53 25.0625 24.337500000000002 23.7625 26.8375 54-55 25.75 24.375 23.3375 26.5375 56-57 24.825 23.2625 24.95 26.9625 58-59 25.025 23.6375 24.15 27.187499999999996 60-61 24.9 23.6375 23.799999999999997 27.6625 62-63 24.725 23.3125 25.424999999999997 26.5375 64-65 25.7375 22.975 24.3 26.987499999999997 66-67 25.412499999999998 23.3375 23.9 27.35 68-69 25.275 23.5375 24.9125 26.275 70-71 25.224999999999998 23.849999999999998 23.6375 27.287499999999998 72-73 26.437500000000004 24.275 22.7125 26.575 74-75 26.5875 24.4 23.0125 26.0 76-77 26.2875 24.6875 22.5 26.525 78-79 26.125 23.45 23.5875 26.8375 80-81 25.912499999999998 24.325 23.1375 26.625 82-83 27.05 24.1375 22.5625 26.25 84-85 25.6125 24.2875 23.75 26.35 86-87 25.275 24.5 23.3375 26.887499999999996 88-89 26.2625 23.799999999999997 24.0375 25.900000000000002 90-91 25.9625 23.974999999999998 22.112499999999997 27.950000000000003 92-93 25.4625 24.8125 23.3375 26.387500000000003 94-95 26.150000000000002 23.9375 22.7125 27.200000000000003 96-97 25.2875 25.025 23.275000000000002 26.4125 98-99 25.5625 24.474999999999998 24.125 25.837500000000002 100-101 26.2625 26.275 21.5375 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 2.0 3 1.5 4 0.5 5 0.5 6 0.5 7 1.5 8 1.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 2.5 30 2.5 31 2.5 32 6.5 33 10.0 34 17.5 35 25.5 36 27.5 37 29.5 38 37.5 39 54.5 40 75.5 41 98.5 42 119.0 43 138.0 44 151.0 45 168.0 46 175.5 47 182.5 48 189.5 49 182.5 50 169.5 51 151.5 52 156.5 53 153.0 54 145.0 55 135.0 56 115.0 57 109.5 58 101.0 59 92.5 60 80.5 61 76.0 62 72.5 63 74.5 64 82.5 65 73.0 66 66.5 67 63.5 68 58.5 69 47.0 70 42.0 71 41.0 72 32.5 73 26.0 74 25.0 75 22.0 76 18.0 77 15.0 78 9.5 79 8.5 80 5.5 81 2.5 82 2.0 83 1.5 84 2.5 85 1.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.63445610160133 82.975 2 7.261181667586969 13.15 3 0.8282716731087797 2.25 4 0.13804527885146328 0.5 5 0.05521811154058532 0.25 6 0.02760905577029266 0.15 7 0.0 0.0 8 0.02760905577029266 0.2 9 0.0 0.0 >10 0.02760905577029266 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 21 0.525 TruSeq Adapter, Index 1 (97% over 36bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 8 0.2 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit TATGATGTTATCCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGC 5 0.125 No Hit CGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.16249999999999998 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2375 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.38749999999999996 0.0 0.0 0.0 0.0 50-51 0.4375 0.0 0.0 0.0 0.0 52-53 0.5375000000000001 0.0 0.0 0.0 0.0 54-55 0.6499999999999999 0.0 0.0 0.0 0.0 56-57 0.7625 0.0 0.0 0.0 0.0 58-59 0.95 0.0 0.0 0.0 0.0 60-61 1.1875 0.0 0.0 0.0 0.0 62-63 1.3375 0.0 0.0 0.0 0.0 64-65 1.725 0.0 0.0 0.0 0.0 66-67 1.875 0.0 0.0 0.0 0.0 68-69 2.175 0.0 0.0 0.0 0.0 70-71 2.5 0.0 0.0 0.0 0.0 72-73 2.675 0.0 0.0 0.0 0.0 74-75 3.0375 0.0 0.0 0.0 0.0 76-77 3.4375 0.0 0.0 0.0 0.0 78-79 3.925 0.0 0.0 0.0 0.0 80-81 4.4 0.0 0.0 0.0 0.0 82-83 4.925 0.0 0.0 0.0 0.0 84-85 5.2625 0.0 0.0 0.0 0.0 86-87 5.875 0.0 0.0 0.0 0.0 88-89 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR3450090 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3450090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.213 37.0 37.0 37.0 37.0 37.0 2 36.017 37.0 37.0 37.0 37.0 37.0 3 36.2215 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.2555 37.0 37.0 37.0 37.0 37.0 6 36.208 37.0 37.0 37.0 37.0 37.0 7 36.174 37.0 37.0 37.0 37.0 37.0 8 36.227 37.0 37.0 37.0 37.0 37.0 9 36.176 37.0 37.0 37.0 37.0 37.0 10-11 36.17825 37.0 37.0 37.0 37.0 37.0 12-13 36.09025 37.0 37.0 37.0 37.0 37.0 14-15 36.125 37.0 37.0 37.0 37.0 37.0 16-17 36.16375 37.0 37.0 37.0 37.0 37.0 18-19 36.107 37.0 37.0 37.0 37.0 37.0 20-21 36.15275 37.0 37.0 37.0 37.0 37.0 22-23 36.150999999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.964749999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.943 37.0 37.0 37.0 37.0 37.0 28-29 35.809250000000006 37.0 37.0 37.0 37.0 37.0 30-31 35.848 37.0 37.0 37.0 37.0 37.0 32-33 35.905 37.0 37.0 37.0 37.0 37.0 34-35 35.832 37.0 37.0 37.0 37.0 37.0 36-37 35.7355 37.0 37.0 37.0 37.0 37.0 38-39 35.71825 37.0 37.0 37.0 37.0 37.0 40-41 35.81175 37.0 37.0 37.0 37.0 37.0 42-43 35.674499999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.73175 37.0 37.0 37.0 37.0 37.0 46-47 35.7505 37.0 37.0 37.0 37.0 37.0 48-49 35.76675 37.0 37.0 37.0 37.0 37.0 50-51 35.709 37.0 37.0 37.0 37.0 37.0 52-53 35.7685 37.0 37.0 37.0 37.0 37.0 54-55 35.818 37.0 37.0 37.0 37.0 37.0 56-57 35.826 37.0 37.0 37.0 37.0 37.0 58-59 35.75975 37.0 37.0 37.0 37.0 37.0 60-61 35.82725 37.0 37.0 37.0 37.0 37.0 62-63 35.89575 37.0 37.0 37.0 37.0 37.0 64-65 35.928250000000006 37.0 37.0 37.0 37.0 37.0 66-67 35.781 37.0 37.0 37.0 37.0 37.0 68-69 35.723 37.0 37.0 37.0 37.0 37.0 70-71 35.719750000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.65475 37.0 37.0 37.0 37.0 37.0 74-75 35.659 37.0 37.0 37.0 37.0 37.0 76-77 35.632000000000005 37.0 37.0 37.0 37.0 37.0 78-79 35.5775 37.0 37.0 37.0 37.0 37.0 80-81 35.52575 37.0 37.0 37.0 37.0 37.0 82-83 35.58325 37.0 37.0 37.0 37.0 37.0 84-85 35.7265 37.0 37.0 37.0 37.0 37.0 86-87 35.59425 37.0 37.0 37.0 37.0 37.0 88-89 35.63775 37.0 37.0 37.0 37.0 37.0 90-91 35.7335 37.0 37.0 37.0 37.0 37.0 92-93 35.6605 37.0 37.0 37.0 37.0 37.0 94-95 35.58475 37.0 37.0 37.0 37.0 37.0 96-97 35.661500000000004 37.0 37.0 37.0 37.0 37.0 98-99 35.65275 37.0 37.0 37.0 37.0 37.0 100-101 35.630750000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 3.0 17 1.0 18 5.0 19 9.0 20 11.0 21 8.0 22 13.0 23 14.0 24 11.0 25 19.0 26 13.0 27 18.0 28 17.0 29 22.0 30 29.0 31 46.0 32 49.0 33 84.0 34 139.0 35 331.0 36 2337.0 37 818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 15.950000000000001 12.45 30.049999999999997 2 27.325 23.0 25.3 24.375 3 26.6 23.9 26.075 23.425 4 29.925 27.400000000000002 16.925 25.75 5 29.25 29.375 18.425 22.95 6 23.474999999999998 32.225 20.875 23.425 7 25.025 17.75 30.725 26.5 8 26.05 21.375 22.25 30.325000000000003 9 26.700000000000003 21.7 25.974999999999998 25.624999999999996 10-11 28.575 25.775 19.425 26.224999999999998 12-13 29.349999999999998 21.2875 22.175 27.187499999999996 14-15 27.125 24.2 22.912499999999998 25.7625 16-17 28.675 23.7375 21.762500000000003 25.825 18-19 28.449999999999996 24.837500000000002 22.375 24.337500000000002 20-21 27.275 24.3 22.575 25.85 22-23 26.775 24.349999999999998 22.400000000000002 26.474999999999998 24-25 27.35 24.675 22.2625 25.7125 26-27 27.187499999999996 24.975 22.625 25.2125 28-29 28.499999999999996 24.175 21.625 25.7 30-31 27.3125 24.3 22.1875 26.200000000000003 32-33 28.575 24.5375 22.25 24.637500000000003 34-35 27.537499999999998 23.724999999999998 22.787499999999998 25.95 36-37 27.775 24.5625 22.1375 25.525 38-39 27.750000000000004 24.15 22.475 25.624999999999996 40-41 28.4 24.075 21.7875 25.7375 42-43 27.1375 24.712500000000002 22.4875 25.662499999999998 44-45 27.1 24.175 22.975 25.75 46-47 27.975 23.75 22.1375 26.137500000000003 48-49 28.1625 24.175 22.2 25.4625 50-51 27.5125 25.1 22.112499999999997 25.275 52-53 27.55 24.05 22.787499999999998 25.6125 54-55 28.7375 24.2375 22.575 24.45 56-57 28.325 24.175 22.400000000000002 25.1 58-59 28.449999999999996 24.0125 22.1375 25.4 60-61 28.7 24.15 21.875 25.275 62-63 27.5625 24.45 22.6875 25.3 64-65 28.962500000000002 24.0625 22.075 24.9 66-67 28.275 24.2875 22.1875 25.25 68-69 27.8375 24.8125 22.15 25.2 70-71 28.499999999999996 24.175 21.825 25.5 72-73 28.237499999999997 24.325 23.025000000000002 24.4125 74-75 27.8875 24.1625 22.525000000000002 25.424999999999997 76-77 28.875 24.0125 22.45 24.6625 78-79 28.325 24.825 21.912499999999998 24.9375 80-81 28.475 24.6 22.825 24.099999999999998 82-83 28.999999999999996 23.6875 22.3125 25.0 84-85 28.249999999999996 24.099999999999998 22.55 25.1 86-87 28.175 25.5375 22.3125 23.974999999999998 88-89 29.3875 24.85 21.875 23.8875 90-91 29.1625 24.9 22.025 23.9125 92-93 29.212500000000002 25.124999999999996 22.3 23.3625 94-95 29.4875 25.5125 21.025 23.974999999999998 96-97 28.8375 24.9375 23.6875 22.537499999999998 98-99 29.4 25.2625 22.0 23.3375 100-101 29.325000000000003 25.5625 21.7 23.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 1.5 8 1.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 2.5 17 3.0 18 1.5 19 1.0 20 1.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.5 26 1.5 27 1.0 28 1.5 29 2.5 30 4.5 31 7.5 32 7.0 33 4.5 34 7.5 35 17.0 36 26.0 37 30.0 38 38.5 39 57.0 40 78.5 41 89.5 42 108.0 43 131.0 44 146.0 45 160.5 46 173.5 47 171.5 48 151.5 49 149.0 50 158.0 51 156.5 52 154.0 53 144.0 54 125.0 55 122.0 56 121.5 57 107.0 58 89.0 59 90.0 60 96.0 61 83.0 62 77.0 63 76.5 64 68.0 65 68.5 66 71.0 67 70.5 68 69.0 69 64.0 70 58.0 71 46.5 72 44.0 73 41.5 74 33.5 75 31.5 76 27.0 77 20.5 78 19.5 79 13.0 80 5.0 81 5.0 82 5.0 83 3.0 84 1.0 85 2.5 86 3.0 87 1.5 88 0.5 89 0.5 90 1.0 91 1.0 92 0.5 93 0.5 94 1.5 95 2.0 96 2.5 97 3.0 98 3.0 99 4.5 100 10.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.07217058501914 84.2 2 7.107709130672498 13.0 3 0.683433570256971 1.875 4 0.08201202843083652 0.3 5 0.027337342810278838 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027337342810278838 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit GTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTATATAGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2375 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.38749999999999996 0.0 0.0 0.0 0.0 50-51 0.425 0.0 0.0 0.0 0.0 52-53 0.5125 0.0 0.0 0.0 0.0 54-55 0.625 0.0 0.0 0.0 0.0 56-57 0.7375 0.0 0.0 0.0 0.0 58-59 0.925 0.0 0.0 0.0 0.0 60-61 1.1625 0.0 0.0 0.0 0.0 62-63 1.3125 0.0 0.0 0.0 0.0 64-65 1.675 0.0 0.0 0.0 0.0 66-67 1.825 0.0 0.0 0.0 0.0 68-69 2.125 0.0 0.0 0.0 0.0 70-71 2.45 0.0 0.0 0.0 0.0 72-73 2.6125 0.0 0.0 0.0 0.0 74-75 2.9625 0.0 0.0 0.0 0.0 76-77 3.375 0.0 0.0 0.0 0.0 78-79 3.9000000000000004 0.0 0.0 0.0 0.0 80-81 4.4 0.0 0.0 0.0 0.0 82-83 4.925 0.0 0.0 0.0 0.0 84-85 5.2625 0.0 0.0 0.0 0.0 86-87 5.875 0.0 0.0 0.0 0.0 88-89 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACCAG 15 0.009957196 47.5 76-77 >>END_MODULE Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401298 spots for ERR3450090.sra Written 1401298 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra Read 1401285 spots for ERR3450090.sra Written 1401285 spots for ERR3450090.sra SRR ids: ['ERR3450090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rq2kz6l0 ERR3450090.sra spots: 28025713 blocks: [[1, 1401285], [1401286, 2802570], [2802571, 4203855], [4203856, 5605140], [5605141, 7006425], [7006426, 8407710], [8407711, 9808995], [9808996, 11210280], [11210281, 12611565], [12611566, 14012850], [14012851, 15414135], [15414136, 16815420], [16815421, 18216705], [18216706, 19617990], [19617991, 21019275], [21019276, 22420560], [22420561, 23821845], [23821846, 25223130], [25223131, 26624415], [26624416, 28025713]] ERR3450090 file size 6738408 ERR3450090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3450090 ERR3450090_1.fastq ERR3450090_2.fastq Input file: ERR3450090_1.fastq Paired file: ERR3450090_2.fastq trimmed: ERR3450090-trimmed-pair1.fastq, ERR3450090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:06:25 2024 >> started Sat Dec 7 15:07:46 2024 >> done (80.208s) 28025713 read pairs processed; of these: 267 ( 0.00%) short read pairs filtered out after trimming by size control 114118 ( 0.41%) empty read pairs filtered out after trimming by size control 27911328 (99.59%) read pairs available; of these: 3094958 (11.09%) trimmed read pairs available after processing 24816370 (88.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 54 0.00% 19 116 0.00% 20 330 0.00% 21 734 0.00% 22 972 0.00% 23 504 0.00% 24 457 0.00% 25 639 0.00% 26 894 0.00% 27 1315 0.00% 28 1845 0.01% 29 2262 0.01% 30 2774 0.01% 31 3340 0.01% 32 3496 0.01% 33 3270 0.01% 34 3303 0.01% 35 3260 0.01% 36 3587 0.01% 37 3985 0.01% 38 4722 0.02% 39 5631 0.02% 40 6227 0.02% 41 7393 0.03% 42 8317 0.03% 43 8561 0.03% 44 8001 0.03% 45 7949 0.03% 46 8552 0.03% 47 9250 0.03% 48 10110 0.04% 49 11138 0.04% 50 12712 0.05% 51 13751 0.05% 52 14981 0.05% 53 15850 0.06% 54 16715 0.06% 55 17272 0.06% 56 18104 0.06% 57 18847 0.07% 58 20328 0.07% 59 22358 0.08% 60 23715 0.08% 61 26202 0.09% 62 28262 0.10% 63 30075 0.11% 64 31649 0.11% 65 32736 0.12% 66 34216 0.12% 67 35734 0.13% 68 37288 0.13% 69 38899 0.14% 70 41392 0.15% 71 43626 0.16% 72 47181 0.17% 73 49512 0.18% 74 51409 0.18% 75 53071 0.19% 76 55322 0.20% 77 57352 0.21% 78 59452 0.21% 79 62189 0.22% 80 64746 0.23% 81 67192 0.24% 82 69921 0.25% 83 72920 0.26% 84 76148 0.27% 85 78861 0.28% 86 80436 0.29% 87 83030 0.30% 88 85986 0.31% 89 89144 0.32% 90 91274 0.33% 91 95236 0.34% 92 98864 0.35% 93 101868 0.36% 94 104719 0.38% 95 107926 0.39% 96 109104 0.39% 97 112214 0.40% 98 114957 0.41% 99 114929 0.41% 100 132295 0.47% 101 24816370 88.91% 27911328 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.0 sequence=CCCACTTGGAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=167.30 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=21.5 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=160.12 fanout-score-rank=6 prefix-density=1.27 prefix-fanout=17.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=297.63 fanout-score-rank=1 prefix-density=1.27 prefix-fanout=17.7 sequence=CGCCGCCGCCGTC ERR3450090 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:08:15 Started mapping on | Dec 07 15:08:15 Finished on | Dec 07 15:10:22 Mapping speed, Million of reads per hour | 791.19 Number of input reads | 27911328 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 22540878 Uniquely mapped reads % | 80.76% Average mapped length | 197.16 Number of splices: Total | 14263997 Number of splices: Annotated (sjdb) | 13514279 Number of splices: GT/AG | 14077718 Number of splices: GC/AG | 161355 Number of splices: AT/AC | 9008 Number of splices: Non-canonical | 15916 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1194467 % of reads mapped to multiple loci | 4.28% Number of reads mapped to too many loci | 661809 % of reads mapped to too many loci | 2.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 9.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4175983 4175983 4175983 N_multimapping 1194467 1194467 1194467 N_noFeature 635774 21677866 1171080 N_ambiguous 397744 3366 73628 UnstrandedReadsAssigned:21507360 PositiveStrandReadsAssigned:859646 NegativeStrandReadsAssigned:21296170 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR3450090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3450090-trimmed-pair1.fastq ERR3450090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,911,328 reads, 22,415,859 reads pseudoaligned [quant] estimated average fragment length: 184.038 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 ERR3450090.ke.tsv 35125 ERR3450090.se.tsv 88098 total ==> ERR3450090.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.11 3.63808 0.329647 PNS24247 1044 860.962 38.6205 3.06104 PNS24249 1928 1744.96 302.634 11.835 PNS24246 1044 860.962 38.6205 3.06104 PNS24248 1044 860.962 38.6205 3.06104 PNS24244 1471 1287.96 58.866 3.11887 PNS24243 293 131.754 0 0 KQK14069 1603 1419.96 4931.78 237.008 KQK14071 474 295.015 197.981 45.7946 ==> ERR3450090.se.tsv <== BRADI_1g14170v3 5309 BRADI_1g53295v3 46 BRADI_1g59795v3 257 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 2325 BRADI_1g74790v3 174 BRADI_1g09890v3 34 BRADI_1g77505v3 295 BRADI_1g48960v3 0 ERR3450090 completed mapping pipeline successfully