Starting /dee2/code/volunteer_pipeline.sh ERR3959281 current disk space = 1547871150080 free memory = 1603943188 ERR3959281 SRAfilesize b096e5244ff94912462806d24d6f2d5f ERR3959281.sra ERR3959281.sra file validated ERR3959281 is paired end ERR3959281 is conventional basespace ERR3959281 read1 length is 20-140 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3959281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 20-140 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.633 37.0 37.0 37.0 37.0 37.0 2 36.5015 37.0 37.0 37.0 37.0 37.0 3 36.534 37.0 37.0 37.0 37.0 37.0 4 36.525 37.0 37.0 37.0 37.0 37.0 5 36.5305 37.0 37.0 37.0 37.0 37.0 6 36.5855 37.0 37.0 37.0 37.0 37.0 7 36.5455 37.0 37.0 37.0 37.0 37.0 8 36.479 37.0 37.0 37.0 37.0 37.0 9 36.49 37.0 37.0 37.0 37.0 37.0 10-14 36.5253 37.0 37.0 37.0 37.0 37.0 15-19 36.4452 37.0 37.0 37.0 37.0 37.0 20-24 36.47670034029268 37.0 37.0 37.0 37.0 37.0 25-29 36.434232808390995 37.0 37.0 37.0 37.0 37.0 30-34 36.474938493642604 37.0 37.0 37.0 37.0 37.0 35-39 36.42796294087258 37.0 37.0 37.0 37.0 37.0 40-44 36.418684008615884 37.0 37.0 37.0 37.0 37.0 45-49 36.42791462828667 37.0 37.0 37.0 37.0 37.0 50-54 36.4276519721877 37.0 37.0 37.0 37.0 37.0 55-59 36.4088943927394 37.0 37.0 37.0 37.0 37.0 60-64 36.447960661449 37.0 37.0 37.0 37.0 37.0 65-69 36.41518519149089 37.0 37.0 37.0 37.0 37.0 70-74 36.3770750862984 37.0 37.0 37.0 37.0 37.0 75-79 36.42865523198096 37.0 37.0 37.0 37.0 37.0 80-84 36.35554150231957 37.0 37.0 37.0 37.0 37.0 85-89 36.33224436366762 37.0 37.0 37.0 37.0 37.0 90-94 36.37812630616486 37.0 37.0 37.0 37.0 37.0 95-99 36.364165812974946 37.0 37.0 37.0 37.0 37.0 100-104 36.340807775633365 37.0 37.0 37.0 37.0 37.0 105-109 36.307294600267475 37.0 37.0 37.0 37.0 37.0 110-114 36.30454522502781 37.0 37.0 37.0 37.0 37.0 115-119 36.32083916609313 37.0 37.0 37.0 37.0 37.0 120-124 36.30117960024674 37.0 37.0 37.0 37.0 37.0 125-129 36.20760420627563 37.0 37.0 37.0 37.0 37.0 130-134 36.178253627160494 37.0 37.0 37.0 37.0 37.0 135-139 36.13571289955286 37.0 37.0 37.0 37.0 37.0 140 36.64106988783434 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 0.0 27 1.0 28 7.0 29 6.0 30 17.0 31 28.0 32 62.0 33 82.0 34 123.0 35 316.0 36 2860.0 37 497.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 26.775 24.15 19.400000000000002 29.675 2 27.725 21.0 23.849999999999998 27.425 3 25.05 21.575 24.6 28.775000000000002 4 25.174999999999997 24.325 24.25 26.25 5 25.15 21.525 25.724999999999998 27.6 6 24.5 24.65 24.15 26.700000000000003 7 25.224999999999998 22.75 25.174999999999997 26.85 8 25.4 24.025 24.775 25.8 9 25.2 24.75 23.65 26.400000000000002 10-14 25.650000000000002 23.95 23.830000000000002 26.57 15-19 25.595000000000002 23.95 23.11 27.345000000000002 20-24 25.188891668751562 24.358268701526146 23.482611958969226 26.970227670753065 25-29 25.79917827437619 23.39913819019942 23.7699168253332 27.031766710091194 30-34 26.227863342196358 23.067275372497868 23.503737520694326 27.201123764611445 35-39 25.480044234442545 22.936563788076807 24.117824469689353 27.465567507791295 40-44 25.462962962962965 23.389694041867955 23.22866344605475 27.918679549114334 45-49 25.863024744242303 23.055989517714057 23.892556569067178 27.188429168976462 50-54 26.03424761327474 23.594484012729204 23.22069000353589 27.15057837046017 55-59 26.169028340080974 22.742914979757085 23.90182186234818 27.186234817813766 60-64 26.345393736698085 23.076923076923077 22.96037296037296 27.617310226005877 65-69 25.68047938249035 22.89762340036563 23.786309161080645 27.635588056063376 70-74 26.550249465431218 23.078097953365237 22.823541390897056 27.548111190306486 75-79 25.95353586928772 22.685728874138373 23.890732703599692 27.470002552974215 80-84 25.863836768173897 23.105711063262586 23.36204244847739 27.668409720086128 85-89 26.35974635252874 23.33350518121359 23.189152961798214 27.11759550445945 90-94 26.409218312052317 22.770684106716494 22.941970310391362 27.87812727083982 95-99 26.14611680971321 23.12120577768474 23.257274440025117 27.47540297257693 100-104 26.683186587230452 22.966204460378552 23.55143143354247 26.799177518848527 105-109 26.362477424837987 22.69202167215553 23.302878997131625 27.642621905874854 110-114 25.835213234504245 23.25706305725642 23.004619185734235 27.9031045225051 115-119 26.349809885931556 23.45464421510049 22.259641499185225 27.93590439978273 120-124 26.57816459182549 22.650655502919466 23.20700672028203 27.564173184973008 125-129 26.1066145687971 22.55093497069495 23.393804074797657 27.948646385710298 130-134 27.02596380802518 22.569405417556478 23.007755423176352 27.396875351241988 135-139 26.693316817746748 22.628230392432858 22.62260007882439 28.055852710996003 140 27.610008628127698 23.61230946218004 21.77164222030486 27.0060396893874 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 0.5 28 1.0 29 1.5 30 3.0 31 6.5 32 15.5 33 20.0 34 24.5 35 31.0 36 32.5 37 39.5 38 55.5 39 84.0 40 103.5 41 117.5 42 133.0 43 136.0 44 154.0 45 171.0 46 162.0 47 157.0 48 146.5 49 146.5 50 149.5 51 123.0 52 119.5 53 118.0 54 100.5 55 101.5 56 112.5 57 110.5 58 91.0 59 76.0 60 74.5 61 81.5 62 86.5 63 84.5 64 83.5 65 82.5 66 82.0 67 77.5 68 65.0 69 65.5 70 66.0 71 63.5 72 66.0 73 52.5 74 43.5 75 44.0 76 36.0 77 25.5 78 17.5 79 16.5 80 12.5 81 8.0 82 9.0 83 7.5 84 6.5 85 4.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 20-24 6.0 25-29 7.0 30-34 6.0 35-39 5.0 40-44 5.0 45-49 6.0 50-54 11.0 55-59 5.0 60-64 7.0 65-69 8.0 70-74 13.0 75-79 13.0 80-84 19.0 85-89 24.0 90-94 32.0 95-99 28.0 100-104 29.0 105-109 34.0 110-114 35.0 115-119 62.0 120-124 39.0 125-129 44.0 130-134 7.0 135-139 78.0 140-141 3477.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.10515135422199 88.6 2 5.6027615507169415 10.549999999999999 3 0.2655337227827934 0.75 4 0.02655337227827934 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAGC 10 0.009063391 131.91249 3 GGTAGAG 10 0.009063391 131.91249 2 >>END_MODULE ERR3959281 read2 length is 22-140 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3959281_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 22-140 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5065 37.0 37.0 37.0 37.0 37.0 2 36.473 37.0 37.0 37.0 37.0 37.0 3 36.491 37.0 37.0 37.0 37.0 37.0 4 36.554 37.0 37.0 37.0 37.0 37.0 5 36.43 37.0 37.0 37.0 37.0 37.0 6 36.5095 37.0 37.0 37.0 37.0 37.0 7 36.4765 37.0 37.0 37.0 37.0 37.0 8 36.524 37.0 37.0 37.0 37.0 37.0 9 36.4355 37.0 37.0 37.0 37.0 37.0 10-14 36.4899 37.0 37.0 37.0 37.0 37.0 15-19 36.4765 37.0 37.0 37.0 37.0 37.0 20-24 36.364420411673635 37.0 37.0 37.0 37.0 37.0 25-29 36.36995890856031 37.0 37.0 37.0 37.0 37.0 30-34 36.350209780154124 37.0 37.0 37.0 37.0 37.0 35-39 36.36392258832517 37.0 37.0 37.0 37.0 37.0 40-44 36.363360207273445 37.0 37.0 37.0 37.0 37.0 45-49 36.349379099398256 37.0 37.0 37.0 37.0 37.0 50-54 36.29013260208298 37.0 37.0 37.0 37.0 37.0 55-59 36.31112021271476 37.0 37.0 37.0 37.0 37.0 60-64 36.32369451705084 37.0 37.0 37.0 37.0 37.0 65-69 36.27645039680849 37.0 37.0 37.0 37.0 37.0 70-74 36.31208227446636 37.0 37.0 37.0 37.0 37.0 75-79 36.31297580380439 37.0 37.0 37.0 37.0 37.0 80-84 36.248013536779794 37.0 37.0 37.0 37.0 37.0 85-89 36.29488566435573 37.0 37.0 37.0 37.0 37.0 90-94 36.279889466991634 37.0 37.0 37.0 37.0 37.0 95-99 36.232059192291565 37.0 37.0 37.0 37.0 37.0 100-104 36.17342906643137 37.0 37.0 37.0 37.0 37.0 105-109 36.20794717486895 37.0 37.0 37.0 37.0 37.0 110-114 36.23550393056976 37.0 37.0 37.0 37.0 37.0 115-119 36.086189672481076 37.0 37.0 37.0 37.0 37.0 120-124 36.09703027267887 37.0 37.0 37.0 37.0 37.0 125-129 35.969330254569705 37.0 37.0 37.0 37.0 37.0 130-134 36.03286022435366 37.0 37.0 37.0 37.0 37.0 135-139 35.95414866019872 37.0 37.0 37.0 37.0 37.0 140 36.461706783369806 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 2.0 28 6.0 29 9.0 30 14.0 31 24.0 32 52.0 33 90.0 34 153.0 35 507.0 36 2801.0 37 342.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 27.925 23.849999999999998 18.099999999999998 30.125 2 27.950000000000003 20.599999999999998 21.15 30.3 3 26.224999999999998 22.125 22.875 28.775000000000002 4 26.575 23.65 22.075 27.700000000000003 5 25.474999999999998 24.275 24.175 26.075 6 27.650000000000002 22.6 22.8 26.950000000000003 7 27.950000000000003 22.0 22.75 27.3 8 25.650000000000002 23.775 22.525000000000002 28.050000000000004 9 27.025 23.75 22.1 27.125 10-14 26.905 23.48 22.455 27.16 15-19 27.415 23.145 22.1 27.339999999999996 20-24 27.13313994198259 22.99189756927078 22.661798539561868 27.213163949184754 25-29 26.61492238357536 23.765648472709064 22.483725588382576 27.135703555333002 30-34 27.55644756648269 22.880080280983442 22.363271450075263 27.200200702458606 35-39 27.29741964689905 23.132639203259394 22.22222222222222 27.347718927619336 40-44 27.977629987908102 22.944377267230955 22.460701330108826 26.617291414752113 45-49 28.41281857178905 23.083522583901082 21.56447136008075 26.939187484229123 50-54 27.884518151481448 23.106481949641015 22.06997674183436 26.93902315704318 55-59 27.861880411118424 23.365905523770948 22.27229001063237 26.499924054478253 60-64 27.821721934895038 22.883074738870295 22.107291349761688 27.18791197647297 65-69 28.197320341047504 22.74665042630938 22.34064149411287 26.71538773853025 70-74 27.77636594663278 22.98856416772554 22.536213468869125 26.698856416772554 75-79 27.57830404889228 23.51413292589763 22.1441303794245 26.763432645785585 80-84 28.063200815494394 22.497451580020385 22.747196738022428 26.692150866462793 85-89 28.182096560171484 22.654894355414925 22.65999795855874 26.503011125854854 90-94 28.97158045389491 22.837865467184628 22.20915968104682 25.981394397873647 95-99 28.268768230899134 23.361138119850573 21.912901079780973 26.457192569469324 100-104 28.74647526275314 23.732376313765702 21.727762112278903 25.793386311202255 105-109 28.615432003696288 23.19420914831357 21.93644437599466 26.253914471995483 110-114 28.658913132976533 23.296624125154384 22.123301770275834 25.92116097159325 115-119 28.309866419103614 23.71447728093249 21.991851049564186 25.983805250399712 120-124 29.08094696578104 23.482890520004133 21.787449601984907 25.64871291222992 125-129 29.136971336419915 23.409457420798002 22.20256983821464 25.251001404567447 130-134 28.852407426833103 23.392426308612187 22.149375852302526 25.605790412252176 135-139 28.917378917378915 23.641447715521792 22.185290703809223 25.25588266329007 140 29.157549234135665 24.48030634573304 21.280087527352297 25.082056892778994 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 2.0 28 5.5 29 8.0 30 4.5 31 6.0 32 9.5 33 7.5 34 16.5 35 24.5 36 26.5 37 33.0 38 50.0 39 68.5 40 78.5 41 101.0 42 121.5 43 125.0 44 136.0 45 142.5 46 157.0 47 169.5 48 148.5 49 129.0 50 117.5 51 110.5 52 111.0 53 103.0 54 102.0 55 98.5 56 99.0 57 106.5 58 92.0 59 84.0 60 87.5 61 85.0 62 80.0 63 75.0 64 85.0 65 107.0 66 107.0 67 89.0 68 85.0 69 87.5 70 78.5 71 81.0 72 81.5 73 72.5 74 63.0 75 57.5 76 49.5 77 30.5 78 23.0 79 16.5 80 13.5 81 16.5 82 9.0 83 2.0 84 2.0 85 2.5 86 2.0 87 2.0 88 1.5 89 1.5 90 1.0 91 0.5 92 1.0 93 1.5 94 1.5 95 1.0 96 0.5 97 0.0 98 0.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 20-24 5.0 25-29 4.0 30-34 12.0 35-39 8.0 40-44 5.0 45-49 7.0 50-54 6.0 55-59 6.0 60-64 4.0 65-69 5.0 70-74 8.0 75-79 5.0 80-84 3.0 85-89 6.0 90-94 7.0 95-99 6.0 100-104 4.0 105-109 7.0 110-114 11.0 115-119 7.0 120-124 11.0 125-129 44.0 130-134 17.0 135-139 146.0 140-141 3656.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.98616285258116 88.3 2 5.64129856306546 10.6 3 0.31931878658861096 0.8999999999999999 4 0.05321979776476849 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.38749999999999996 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7625 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.2374999999999998 0.0 0.0 0.0 0.0 90-91 1.5125000000000002 0.0 0.0 0.0 0.0 92-93 1.7 0.0 0.0 0.0 0.0 94-95 1.9874999999999998 0.0 0.0 0.0 0.0 96-97 2.2375 0.0 0.0 0.0 0.0 98-99 2.375 0.0 0.0 0.0 0.0 100-101 2.625 0.0 0.0 0.0 0.0 102-103 2.7249999999999996 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.1875 0.0 0.0 0.0 0.0 108-109 3.55 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.2625 0.0 0.0 0.0 0.0 114-115 4.550000000000001 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.575 0.0 0.0 0.0 0.0 120-121 6.012499999999999 0.0 0.0 0.0 0.0 122-123 6.3375 0.0 0.0 0.0 0.0 124-125 6.925 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594372 spots for ERR3959281.sra Written 2594372 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra Read 2594359 spots for ERR3959281.sra Written 2594359 spots for ERR3959281.sra SRR ids: ['ERR3959281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_93bu8x10 ERR3959281.sra spots: 51887193 blocks: [[1, 2594359], [2594360, 5188718], [5188719, 7783077], [7783078, 10377436], [10377437, 12971795], [12971796, 15566154], [15566155, 18160513], [18160514, 20754872], [20754873, 23349231], [23349232, 25943590], [25943591, 28537949], [28537950, 31132308], [31132309, 33726667], [33726668, 36321026], [36321027, 38915385], [38915386, 41509744], [41509745, 44104103], [44104104, 46698462], [46698463, 49292821], [49292822, 51887193]] ERR3959281 file size 15959270 ERR3959281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3959281 ERR3959281_1.fastq ERR3959281_2.fastq Input file: ERR3959281_1.fastq Paired file: ERR3959281_2.fastq trimmed: ERR3959281-trimmed-pair1.fastq, ERR3959281-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:12:51 2024 >> started Sat Dec 7 02:13:40 2024 >> done (49.295s) 51887193 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 51887193 (100.00%) read pairs available; of these: 94551 ( 0.18%) trimmed read pairs available after processing 51792642 (99.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 426 0.00% 21 956 0.00% 22 1419 0.00% 23 1859 0.00% 24 2220 0.00% 25 2506 0.00% 26 2800 0.01% 27 3123 0.01% 28 3396 0.01% 29 3472 0.01% 30 3823 0.01% 31 3977 0.01% 32 4181 0.01% 33 4367 0.01% 34 4500 0.01% 35 4642 0.01% 36 4739 0.01% 37 4793 0.01% 38 5051 0.01% 39 5112 0.01% 40 5152 0.01% 41 5366 0.01% 42 5400 0.01% 43 5573 0.01% 44 5612 0.01% 45 5603 0.01% 46 5801 0.01% 47 5761 0.01% 48 5925 0.01% 49 6074 0.01% 50 6086 0.01% 51 6194 0.01% 52 6393 0.01% 53 6323 0.01% 54 6444 0.01% 55 6489 0.01% 56 6602 0.01% 57 6752 0.01% 58 6874 0.01% 59 7020 0.01% 60 7086 0.01% 61 7226 0.01% 62 7344 0.01% 63 7361 0.01% 64 7496 0.01% 65 7614 0.01% 66 7848 0.02% 67 7962 0.02% 68 8095 0.02% 69 8180 0.02% 70 8685 0.02% 71 8727 0.02% 72 8989 0.02% 73 9241 0.02% 74 9669 0.02% 75 9744 0.02% 76 10325 0.02% 77 10386 0.02% 78 10718 0.02% 79 13867 0.03% 80 51137 0.10% 81 51322 0.10% 82 51215 0.10% 83 50019 0.10% 84 50441 0.10% 85 50744 0.10% 86 51313 0.10% 87 51622 0.10% 88 51804 0.10% 89 52640 0.10% 90 52846 0.10% 91 53291 0.10% 92 53268 0.10% 93 55035 0.11% 94 55238 0.11% 95 56111 0.11% 96 55747 0.11% 97 57825 0.11% 98 59486 0.11% 99 60220 0.12% 100 62130 0.12% 101 62905 0.12% 102 65495 0.13% 103 68765 0.13% 104 71113 0.14% 105 74038 0.14% 106 75367 0.15% 107 79495 0.15% 108 81654 0.16% 109 87947 0.17% 110 95136 0.18% 111 94104 0.18% 112 111405 0.21% 113 104718 0.20% 114 115403 0.22% 115 122829 0.24% 116 137275 0.26% 117 157257 0.30% 118 171051 0.33% 119 177025 0.34% 120 194406 0.37% 121 187540 0.36% 122 200538 0.39% 123 213059 0.41% 124 220806 0.43% 125 230798 0.44% 126 343074 0.66% 127 349747 0.67% 128 353871 0.68% 129 254951 0.49% 130 255086 0.49% 131 260835 0.50% 132 261884 0.50% 133 67767 0.13% 134 54462 0.10% 135 40548 0.08% 136 41941 0.08% 137 49264 0.09% 138 81768 0.16% 139 1730000 3.33% 140 43043041 82.96% 51887193 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=294.61 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=25.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=6.63 sequence-density-rank=1 fanout-score=45.81 fanout-score-rank=1 prefix-density=7.51 prefix-fanout=40.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGATACGGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA criterion=fanout-score sequence-density=6.63 sequence-density-rank=1 fanout-score=45.81 fanout-score-rank=1 prefix-density=7.51 prefix-fanout=40.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGATACGGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x GGTGTTGTCGAAGCCGATGATGCGGAC -y AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGATACGGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA -o ERR3959281 ERR3959281_1.fastq ERR3959281_2.fastq Input file: ERR3959281_1.fastq Paired file: ERR3959281_2.fastq trimmed: ERR3959281-trimmed-pair1.fastq, ERR3959281-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): GGTGTTGTCGAAGCCGATGATGCGGAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGATACGGTGTAGATCTCGGTGGTCGCCGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:17:01 2024 >> started Sat Dec 7 02:17:25 2024 >> done (24.505s) 25943597 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 539 ( 0.00%) empty read pairs filtered out after trimming by size control 25942972 (100.00%) read pairs available; of these: 19968 ( 0.08%) trimmed read pairs available after processing 25923004 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 214 0.00% 21 481 0.00% 22 720 0.00% 23 993 0.00% 24 1111 0.00% 25 1269 0.00% 26 1408 0.01% 27 1569 0.01% 28 1727 0.01% 29 1721 0.01% 30 1906 0.01% 31 1933 0.01% 32 2090 0.01% 33 2192 0.01% 34 2249 0.01% 35 2360 0.01% 36 2319 0.01% 37 2417 0.01% 38 2533 0.01% 39 2544 0.01% 40 2626 0.01% 41 2704 0.01% 42 2687 0.01% 43 2846 0.01% 44 2829 0.01% 45 2854 0.01% 46 2875 0.01% 47 2905 0.01% 48 2930 0.01% 49 2977 0.01% 50 3058 0.01% 51 3062 0.01% 52 3179 0.01% 53 3104 0.01% 54 3227 0.01% 55 3315 0.01% 56 3266 0.01% 57 3405 0.01% 58 3519 0.01% 59 3487 0.01% 60 3545 0.01% 61 3623 0.01% 62 3657 0.01% 63 3645 0.01% 64 3801 0.01% 65 3803 0.01% 66 3851 0.01% 67 3886 0.01% 68 4060 0.02% 69 4083 0.02% 70 4362 0.02% 71 4356 0.02% 72 4522 0.02% 73 4573 0.02% 74 4869 0.02% 75 4829 0.02% 76 5110 0.02% 77 5158 0.02% 78 5345 0.02% 79 6872 0.03% 80 25492 0.10% 81 25883 0.10% 82 25627 0.10% 83 25009 0.10% 84 25161 0.10% 85 25418 0.10% 86 25656 0.10% 87 25939 0.10% 88 25719 0.10% 89 26317 0.10% 90 26524 0.10% 91 26686 0.10% 92 26485 0.10% 93 27554 0.11% 94 27685 0.11% 95 28140 0.11% 96 27860 0.11% 97 28801 0.11% 98 29595 0.11% 99 30001 0.12% 100 30905 0.12% 101 31554 0.12% 102 32539 0.13% 103 34234 0.13% 104 35647 0.14% 105 36973 0.14% 106 37712 0.15% 107 40074 0.15% 108 41058 0.16% 109 43945 0.17% 110 47610 0.18% 111 47063 0.18% 112 55934 0.22% 113 52305 0.20% 114 57747 0.22% 115 61699 0.24% 116 68393 0.26% 117 78318 0.30% 118 85445 0.33% 119 88600 0.34% 120 97045 0.37% 121 93935 0.36% 122 99982 0.39% 123 106239 0.41% 124 110388 0.43% 125 115083 0.44% 126 171549 0.66% 127 175084 0.67% 128 176712 0.68% 129 127650 0.49% 130 127070 0.49% 131 130556 0.50% 132 130821 0.50% 133 33837 0.13% 134 27327 0.11% 135 20277 0.08% 136 21362 0.08% 137 25438 0.10% 138 45507 0.18% 139 877363 3.38% 140 21503877 82.89% criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=11.91 fanout-score-rank=10 prefix-density=0.48 prefix-fanout=4.1 sequence=TCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=302.83 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=26.1 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=6.86 sequence-density-rank=1 fanout-score=45.82 fanout-score-rank=1 prefix-density=7.76 prefix-fanout=40.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGATACGGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA criterion=fanout-score sequence-density=6.86 sequence-density-rank=1 fanout-score=45.82 fanout-score-rank=1 prefix-density=7.76 prefix-fanout=40.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGAGATACGGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA ERR3959281 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:18:23 Started mapping on | Dec 07 02:18:23 Finished on | Dec 07 02:21:02 Mapping speed, Million of reads per hour | 1174.79 Number of input reads | 51886568 Average input read length | 272 UNIQUE READS: Uniquely mapped reads number | 43147248 Uniquely mapped reads % | 83.16% Average mapped length | 274.46 Number of splices: Total | 39177101 Number of splices: Annotated (sjdb) | 36924215 Number of splices: GT/AG | 38612584 Number of splices: GC/AG | 506130 Number of splices: AT/AC | 23584 Number of splices: Non-canonical | 34803 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.49 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 705652 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 219524 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.48% % of reads unmapped: other | 1.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8128965 8128965 8128965 N_multimapping 705652 705652 705652 N_noFeature 1450689 42026110 1839984 N_ambiguous 1004555 7694 276015 UnstrandedReadsAssigned:40692004 PositiveStrandReadsAssigned:1113444 NegativeStrandReadsAssigned:41031249 Dataset is classified negative stranded MeadianReadLen=140 20thPercentileLength=140 echo kmer=135 ERR3959281 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3959281-trimmed-pair1.fastq ERR3959281-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,886,568 reads, 47,811,481 reads pseudoaligned [quant] estimated average fragment length: 243.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 ERR3959281.ke.tsv 35125 ERR3959281.se.tsv 88098 total ==> ERR3959281.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.141 0.0963677 0.00408467 PNS24247 1044 801.682 75.9658 2.78798 PNS24249 1928 1685.68 803.269 14.0203 PNS24246 1044 801.682 75.9658 2.78798 PNS24248 1044 801.682 75.9658 2.78798 PNS24244 1471 1228.68 79.7371 1.90939 PNS24243 293 106.531 1 0.276182 KQK14069 1603 1360.68 32020.1 692.372 KQK14071 474 247.756 1504.47 178.662 ==> ERR3959281.se.tsv <== BRADI_1g14170v3 30874 BRADI_1g53295v3 624 BRADI_1g59795v3 709 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 3112 BRADI_1g74790v3 1625 BRADI_1g09890v3 19 BRADI_1g77505v3 527 BRADI_1g48960v3 0 ERR3959281 completed mapping pipeline successfully