Starting /dee2/code/volunteer_pipeline.sh ERR3959325 current disk space = 1547348455424 free memory = 1600065684 ERR3959325 SRAfilesize 683cc5f268590a6ec70032bb397b2837 ERR3959325.sra ERR3959325.sra file validated ERR3959325 is paired end ERR3959325 is conventional basespace ERR3959325 read1 length is 20-140 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3959325_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 20-140 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.596 37.0 37.0 37.0 37.0 37.0 2 36.485 37.0 37.0 37.0 37.0 37.0 3 36.477 37.0 37.0 37.0 37.0 37.0 4 36.4985 37.0 37.0 37.0 37.0 37.0 5 36.548 37.0 37.0 37.0 37.0 37.0 6 36.5675 37.0 37.0 37.0 37.0 37.0 7 36.5425 37.0 37.0 37.0 37.0 37.0 8 36.479 37.0 37.0 37.0 37.0 37.0 9 36.484 37.0 37.0 37.0 37.0 37.0 10-14 36.5125 37.0 37.0 37.0 37.0 37.0 15-19 36.47 37.0 37.0 37.0 37.0 37.0 20-24 36.479174230972546 37.0 37.0 37.0 37.0 37.0 25-29 36.439200517442025 37.0 37.0 37.0 37.0 37.0 30-34 36.47866969427808 37.0 37.0 37.0 37.0 37.0 35-39 36.43651350311427 37.0 37.0 37.0 37.0 37.0 40-44 36.43690080393882 37.0 37.0 37.0 37.0 37.0 45-49 36.480505197373326 37.0 37.0 37.0 37.0 37.0 50-54 36.465338009730104 37.0 37.0 37.0 37.0 37.0 55-59 36.448737634602615 37.0 37.0 37.0 37.0 37.0 60-64 36.456517555306064 37.0 37.0 37.0 37.0 37.0 65-69 36.42616743703346 37.0 37.0 37.0 37.0 37.0 70-74 36.419224455351944 37.0 37.0 37.0 37.0 37.0 75-79 36.47778865490958 37.0 37.0 37.0 37.0 37.0 80-84 36.38907017069122 37.0 37.0 37.0 37.0 37.0 85-89 36.381127551956766 37.0 37.0 37.0 37.0 37.0 90-94 36.402408859135036 37.0 37.0 37.0 37.0 37.0 95-99 36.37685064325767 37.0 37.0 37.0 37.0 37.0 100-104 36.363239928257414 37.0 37.0 37.0 37.0 37.0 105-109 36.36926471939586 37.0 37.0 37.0 37.0 37.0 110-114 36.30208451251844 37.0 37.0 37.0 37.0 37.0 115-119 36.34103348847104 37.0 37.0 37.0 37.0 37.0 120-124 36.28399947565104 37.0 37.0 37.0 37.0 37.0 125-129 36.309194405515896 37.0 37.0 37.0 37.0 37.0 130-134 36.149583890210735 37.0 37.0 37.0 37.0 37.0 135-139 36.17655865407545 37.0 37.0 37.0 37.0 37.0 140 36.6148588410104 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 1.0 28 4.0 29 9.0 30 20.0 31 35.0 32 58.0 33 66.0 34 119.0 35 304.0 36 2860.0 37 523.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 27.175 23.875 20.150000000000002 28.799999999999997 2 26.275 21.45 23.325000000000003 28.95 3 25.650000000000002 22.35 24.9 27.1 4 23.575 23.75 25.35 27.325 5 24.9 24.224999999999998 23.9 26.974999999999998 6 25.374999999999996 23.5 23.849999999999998 27.275 7 24.5 24.625 23.825 27.05 8 26.75 23.549999999999997 24.075 25.624999999999996 9 25.35 23.599999999999998 22.5 28.549999999999997 10-14 25.245 23.805 24.01 26.939999999999998 15-19 25.16 22.91 23.885 28.044999999999998 20-24 25.18147684605757 23.41927409261577 23.92991239048811 27.469336670838544 25-29 24.76290832455216 24.180841989061168 23.50845501530433 27.547794671082343 30-34 25.41325428327388 23.378385168065115 23.785358991106868 27.423001557554137 35-39 25.5784708249497 23.455734406438633 23.37022132796781 27.59557344064386 40-44 25.442444410830433 23.168456612716177 24.070992789794786 27.318106186658596 45-49 25.303030303030305 23.48989898989899 23.525252525252522 27.68181818181818 50-54 25.645952368913385 22.68291449663751 23.6385700561258 28.032563078323303 55-59 26.40466531440162 22.910750507099394 23.49898580121704 27.18559837728195 60-64 26.002034587995933 23.12817904374364 23.835198372329604 27.034587995930824 65-69 25.887211911074854 22.960432388333672 23.822149704262696 27.330205996328775 70-74 25.839595154117468 23.48310586310893 23.33997853090017 27.33732045187344 75-79 25.840217558622815 23.792908820360203 23.567140438195906 26.79973318282108 80-84 25.92611674996136 22.95842135091968 23.4118192591066 27.703642640012365 85-89 25.834024036469128 23.124740986324078 23.21798590965603 27.823249067550766 90-94 26.36055309157318 22.895903991651448 23.443777719801723 27.299765196973652 95-99 26.734134514020663 22.72823107737719 23.023402909550917 27.514231499051235 100-104 26.22123000053155 23.08510072821985 23.244564928506882 27.44910434274172 105-109 26.706231454005934 22.956568653898028 22.665227947127057 27.671971944968977 110-114 26.528378304416833 22.604126758250782 23.156915330304855 27.71057960702753 115-119 26.515193600355534 23.098716737959002 22.75984667518471 27.62624298650075 120-124 26.76000677468526 23.033929882007563 22.723423474284424 27.48263986902275 125-129 26.761937557392102 23.140495867768596 22.974058769513313 27.123507805325985 130-134 26.44211258623688 22.818714128355268 23.073801379790133 27.665371905617718 135-139 27.451892331841172 23.144003255624675 22.7079820940643 26.696122318469858 140 26.448736998514118 23.744427934621097 23.417533432392272 26.389301634472513 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.0 28 3.5 29 4.5 30 5.0 31 9.5 32 11.0 33 10.5 34 22.5 35 32.5 36 40.0 37 46.0 38 65.5 39 83.5 40 91.5 41 107.5 42 130.0 43 154.5 44 161.0 45 174.0 46 173.0 47 154.5 48 156.0 49 149.5 50 147.5 51 143.0 52 124.0 53 112.0 54 109.0 55 109.0 56 97.0 57 89.0 58 82.5 59 87.5 60 90.0 61 75.5 62 74.0 63 80.0 64 76.5 65 80.5 66 88.0 67 76.0 68 68.0 69 67.0 70 63.0 71 65.0 72 61.5 73 61.0 74 54.5 75 36.5 76 28.0 77 25.5 78 20.5 79 17.5 80 14.0 81 11.0 82 10.5 83 6.0 84 3.5 85 3.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.011625879207115037 140 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 20-24 11.0 25-29 6.0 30-34 5.0 35-39 7.0 40-44 7.0 45-49 7.0 50-54 8.0 55-59 12.0 60-64 11.0 65-69 8.0 70-74 11.0 75-79 18.0 80-84 18.0 85-89 26.0 90-94 35.0 95-99 37.0 100-104 40.0 105-109 57.0 110-114 56.0 115-119 53.0 120-124 63.0 125-129 51.0 130-134 9.0 135-139 79.0 140-141 3365.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.87809422411499 88.175 2 5.77588501463934 10.85 3 0.34602076124567477 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGACTA 10 0.006708013 145.64789 134 >>END_MODULE ERR3959325 read2 length is 20-140 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3959325_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 20-140 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5915 37.0 37.0 37.0 37.0 37.0 2 36.498 37.0 37.0 37.0 37.0 37.0 3 36.463 37.0 37.0 37.0 37.0 37.0 4 36.5545 37.0 37.0 37.0 37.0 37.0 5 36.455 37.0 37.0 37.0 37.0 37.0 6 36.4515 37.0 37.0 37.0 37.0 37.0 7 36.43 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.4535 37.0 37.0 37.0 37.0 37.0 10-14 36.4639 37.0 37.0 37.0 37.0 37.0 15-19 36.463499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.406500128698326 37.0 37.0 37.0 37.0 37.0 25-29 36.43004647405474 37.0 37.0 37.0 37.0 37.0 30-34 36.40500748965262 37.0 37.0 37.0 37.0 37.0 35-39 36.42826118844916 37.0 37.0 37.0 37.0 37.0 40-44 36.418479213667986 37.0 37.0 37.0 37.0 37.0 45-49 36.35713877815697 37.0 37.0 37.0 37.0 37.0 50-54 36.36700258312693 37.0 37.0 37.0 37.0 37.0 55-59 36.392870026740454 37.0 37.0 37.0 37.0 37.0 60-64 36.40473672387492 37.0 37.0 37.0 37.0 37.0 65-69 36.3456466656927 37.0 37.0 37.0 37.0 37.0 70-74 36.33654437230071 37.0 37.0 37.0 37.0 37.0 75-79 36.33564122879551 37.0 37.0 37.0 37.0 37.0 80-84 36.277220968147475 37.0 37.0 37.0 37.0 37.0 85-89 36.32834689598472 37.0 37.0 37.0 37.0 37.0 90-94 36.31599175437775 37.0 37.0 37.0 37.0 37.0 95-99 36.263862653909136 37.0 37.0 37.0 37.0 37.0 100-104 36.21740305727973 37.0 37.0 37.0 37.0 37.0 105-109 36.206426290141025 37.0 37.0 37.0 37.0 37.0 110-114 36.20246187418243 37.0 37.0 37.0 37.0 37.0 115-119 36.15006921827715 37.0 37.0 37.0 37.0 37.0 120-124 36.12282136640323 37.0 37.0 37.0 37.0 37.0 125-129 36.03069241231656 37.0 37.0 37.0 37.0 37.0 130-134 36.12380435353633 37.0 37.0 37.0 37.0 37.0 135-139 36.057188784580674 37.0 37.0 37.0 37.0 37.0 140 36.463035019455255 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 0.0 28 0.0 29 6.0 30 17.0 31 25.0 32 45.0 33 85.0 34 157.0 35 460.0 36 2817.0 37 387.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 28.825 21.975 17.75 31.45 2 28.599999999999998 19.225 23.05 29.125 3 26.650000000000002 21.85 23.1 28.4 4 27.3 22.475 23.825 26.400000000000002 5 25.7 23.200000000000003 22.75 28.349999999999998 6 27.6 22.825 22.325 27.250000000000004 7 26.5 22.975 23.474999999999998 27.05 8 26.125 25.074999999999996 20.8 28.000000000000004 9 26.974999999999998 24.275 23.425 25.324999999999996 10-14 26.669999999999998 23.669999999999998 22.91 26.75 15-19 27.095000000000002 23.305 22.665 26.935 20-24 27.24862431215608 23.94197098549275 22.07103551775888 26.738369184592298 25-29 26.656317291802296 23.561520356552656 22.289548800640993 27.49261355100406 30-34 27.451078775715004 23.181133968891118 22.49372804816859 26.874059207225287 35-39 26.853294466502486 23.596522088757098 22.460672463185404 27.08951098155501 40-44 27.033552995623523 23.134966547613057 22.667136173851805 27.164344282911618 45-49 27.752039480310202 22.766643166482023 22.222781750428037 27.258535602779737 50-54 27.12787414279952 23.260387252924566 22.065348931020573 27.546389673255344 55-59 27.785634912617436 23.083139711081927 22.39115062127488 26.740074755025763 60-64 27.430046045640843 22.673683145271468 22.55224409249608 27.344026716591614 65-69 28.054711246200608 22.786220871327252 22.299898682877405 26.859169199594728 70-74 28.228791643425787 23.005932762030323 22.412656558998023 26.352619035545864 75-79 27.93497586995174 22.910845821691645 22.58064516129032 26.573533147066293 80-84 27.3924539814909 23.4516424285569 22.08379945082884 27.07210413912336 85-89 27.99755613257981 23.527315309811108 22.38684384705463 26.088284710554454 90-94 28.90792291220557 23.32007749566636 21.55093300703579 26.221066585092277 95-99 28.079950925263265 23.479194356405277 21.88937736427768 26.551477354053777 100-104 28.33572453371593 23.50379176060668 22.28940356630457 25.871080139372822 105-109 28.04621309370988 23.501925545571247 22.392811296534017 26.059050064184852 110-114 28.218076883438115 23.0444192517778 22.32814593424714 26.40935793053695 115-119 28.343767785998864 23.87851192632069 21.762301443576344 26.015418844104104 120-124 29.368377311448164 23.078121753584043 22.319758986079368 25.233741948888426 125-129 28.930256948085997 22.99423177766125 22.501310959622444 25.574200314630307 130-134 29.389536430890416 24.067273404651658 21.640321464686785 24.902868699771144 135-139 29.758770751625207 23.010798903991834 22.135066888733682 25.095363455649277 140 30.211228460255697 23.76320177876598 21.51195108393552 24.5136186770428 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.5 27 1.5 28 2.5 29 3.0 30 3.5 31 4.5 32 7.5 33 12.5 34 17.5 35 22.5 36 27.5 37 41.5 38 50.5 39 60.5 40 68.5 41 80.5 42 109.0 43 128.5 44 150.5 45 161.5 46 154.0 47 153.5 48 153.0 49 138.0 50 137.0 51 137.0 52 123.5 53 110.5 54 104.0 55 97.5 56 94.5 57 99.5 58 89.5 59 81.5 60 86.0 61 86.5 62 88.5 63 92.0 64 97.0 65 100.0 66 92.5 67 97.5 68 87.0 69 78.0 70 79.0 71 73.5 72 72.0 73 66.0 74 56.0 75 43.0 76 36.5 77 33.5 78 29.5 79 19.5 80 11.0 81 7.5 82 7.5 83 7.0 84 3.5 85 2.0 86 1.5 87 0.5 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 20-24 3.0 25-29 9.0 30-34 6.0 35-39 4.0 40-44 4.0 45-49 6.0 50-54 5.0 55-59 8.0 60-64 5.0 65-69 5.0 70-74 6.0 75-79 3.0 80-84 6.0 85-89 4.0 90-94 10.0 95-99 9.0 100-104 8.0 105-109 13.0 110-114 18.0 115-119 9.0 120-124 23.0 125-129 64.0 130-134 31.0 135-139 143.0 140-141 3598.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.79494007989348 88.05 2 5.885486018641811 11.05 3 0.3195739014647137 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.4125 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.575 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.8 0.0 0.0 0.0 0.0 80-81 0.9 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.2 0.0 0.0 0.0 0.0 86-87 1.375 0.0 0.0 0.0 0.0 88-89 1.5375 0.0 0.0 0.0 0.0 90-91 1.775 0.0 0.0 0.0 0.0 92-93 2.0875 0.0 0.0 0.0 0.0 94-95 2.3875 0.0 0.0 0.0 0.0 96-97 2.625 0.0 0.0 0.0 0.0 98-99 2.8875 0.0 0.0 0.0 0.0 100-101 3.0875 0.0 0.0 0.0 0.0 102-103 3.425 0.0 0.0 0.0 0.0 104-105 4.0375 0.0 0.0 0.0 0.0 106-107 4.7 0.0 0.0 0.0 0.0 108-109 5.1 0.0 0.0 0.0 0.0 110-111 5.5 0.0 0.0 0.0 0.0 112-113 6.050000000000001 0.0 0.0 0.0 0.0 114-115 6.525 0.0 0.0 0.0 0.0 116-117 6.925000000000001 0.0 0.0 0.0 0.0 118-119 7.45 0.0 0.0 0.0 0.0 120-121 7.9875 0.0 0.0 0.0 0.0 122-123 8.5 0.0 0.0 0.0 0.0 124-125 9.0625 0.0 0.0 0.0 0.0 126-127 9.175 0.0 0.0 0.0 0.0 128 9.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATCT 10 0.009351744 130.5375 2 >>END_MODULE Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497645 spots for ERR3959325.sra Written 2497645 spots for ERR3959325.sra Read 2497661 spots for ERR3959325.sra Written 2497661 spots for ERR3959325.sra SRR ids: ['ERR3959325.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u6gtjdrz ERR3959325.sra spots: 49952916 blocks: [[1, 2497645], [2497646, 4995290], [4995291, 7492935], [7492936, 9990580], [9990581, 12488225], [12488226, 14985870], [14985871, 17483515], [17483516, 19981160], [19981161, 22478805], [22478806, 24976450], [24976451, 27474095], [27474096, 29971740], [29971741, 32469385], [32469386, 34967030], [34967031, 37464675], [37464676, 39962320], [39962321, 42459965], [42459966, 44957610], [44957611, 47455255], [47455256, 49952916]] ERR3959325 file size 15281249 ERR3959325 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3959325 ERR3959325_1.fastq ERR3959325_2.fastq Input file: ERR3959325_1.fastq Paired file: ERR3959325_2.fastq trimmed: ERR3959325-trimmed-pair1.fastq, ERR3959325-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:44:19 2024 >> started Sat Dec 7 02:45:08 2024 >> done (49.756s) 49952916 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 49952915 (100.00%) read pairs available; of these: 113509 ( 0.23%) trimmed read pairs available after processing 49839406 (99.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 370 0.00% 21 878 0.00% 22 1384 0.00% 23 1692 0.00% 24 2056 0.00% 25 2333 0.00% 26 2572 0.01% 27 2897 0.01% 28 3091 0.01% 29 3266 0.01% 30 3450 0.01% 31 3696 0.01% 32 3695 0.01% 33 4019 0.01% 34 4121 0.01% 35 4243 0.01% 36 4261 0.01% 37 4447 0.01% 38 4639 0.01% 39 4665 0.01% 40 4817 0.01% 41 4947 0.01% 42 4968 0.01% 43 4958 0.01% 44 5250 0.01% 45 5451 0.01% 46 5300 0.01% 47 5472 0.01% 48 5462 0.01% 49 5547 0.01% 50 5686 0.01% 51 5678 0.01% 52 5903 0.01% 53 6079 0.01% 54 6172 0.01% 55 6215 0.01% 56 6357 0.01% 57 6463 0.01% 58 6697 0.01% 59 6692 0.01% 60 6962 0.01% 61 7280 0.01% 62 7272 0.01% 63 7405 0.01% 64 7733 0.02% 65 7806 0.02% 66 8071 0.02% 67 8324 0.02% 68 8833 0.02% 69 8927 0.02% 70 9510 0.02% 71 9615 0.02% 72 10212 0.02% 73 10636 0.02% 74 11241 0.02% 75 11577 0.02% 76 12198 0.02% 77 12877 0.03% 78 13555 0.03% 79 16709 0.03% 80 50171 0.10% 81 50789 0.10% 82 50838 0.10% 83 50483 0.10% 84 51291 0.10% 85 52600 0.11% 86 52894 0.11% 87 53751 0.11% 88 55301 0.11% 89 56773 0.11% 90 57156 0.11% 91 58527 0.12% 92 59606 0.12% 93 62112 0.12% 94 64105 0.13% 95 65496 0.13% 96 66307 0.13% 97 68877 0.14% 98 71672 0.14% 99 72328 0.14% 100 75942 0.15% 101 77410 0.15% 102 80970 0.16% 103 84217 0.17% 104 88444 0.18% 105 91583 0.18% 106 92764 0.19% 107 96206 0.19% 108 98599 0.20% 109 103322 0.21% 110 106336 0.21% 111 108446 0.22% 112 114532 0.23% 113 115444 0.23% 114 118095 0.24% 115 123517 0.25% 116 130991 0.26% 117 129209 0.26% 118 144235 0.29% 119 155838 0.31% 120 171386 0.34% 121 169838 0.34% 122 240408 0.48% 123 256890 0.51% 124 268371 0.54% 125 280856 0.56% 126 422959 0.85% 127 435314 0.87% 128 440861 0.88% 129 310549 0.62% 130 313173 0.63% 131 319849 0.64% 132 321125 0.64% 133 72315 0.14% 134 54526 0.11% 135 36340 0.07% 136 37292 0.07% 137 45594 0.09% 138 78940 0.16% 139 1549865 3.10% 140 40446655 80.97% 49952915 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=7.01 fanout-score-rank=24 prefix-density=0.20 prefix-fanout=4.6 sequence=TGCAGTTGTCGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=288.59 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.1 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=8.69 sequence-density-rank=1 fanout-score=44.39 fanout-score-rank=1 prefix-density=9.84 prefix-fanout=39.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGCGTT criterion=fanout-score sequence-density=8.69 sequence-density-rank=1 fanout-score=44.39 fanout-score-rank=1 prefix-density=9.84 prefix-fanout=39.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGCGTT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGCAGTTGTCGC -y AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGCGTT -o ERR3959325 ERR3959325_1.fastq ERR3959325_2.fastq Input file: ERR3959325_1.fastq Paired file: ERR3959325_2.fastq trimmed: ERR3959325-trimmed-pair1.fastq, ERR3959325-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TGCAGTTGTCGC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGCGTT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:48:19 2024 >> started Sat Dec 7 02:48:47 2024 >> done (27.314s) 29971749 read pairs processed; of these: 206 ( 0.00%) short read pairs filtered out after trimming by size control 276 ( 0.00%) empty read pairs filtered out after trimming by size control 29971267 (100.00%) read pairs available; of these: 45940 ( 0.15%) trimmed read pairs available after processing 29925327 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 224 0.00% 21 517 0.00% 22 833 0.00% 23 989 0.00% 24 1233 0.00% 25 1365 0.00% 26 1544 0.01% 27 1746 0.01% 28 1830 0.01% 29 1968 0.01% 30 2078 0.01% 31 2220 0.01% 32 2179 0.01% 33 2425 0.01% 34 2476 0.01% 35 2535 0.01% 36 2591 0.01% 37 2689 0.01% 38 2806 0.01% 39 2762 0.01% 40 2849 0.01% 41 2976 0.01% 42 2992 0.01% 43 2943 0.01% 44 3134 0.01% 45 3338 0.01% 46 3202 0.01% 47 3232 0.01% 48 3255 0.01% 49 3276 0.01% 50 3418 0.01% 51 3448 0.01% 52 3544 0.01% 53 3626 0.01% 54 3676 0.01% 55 3681 0.01% 56 3883 0.01% 57 3904 0.01% 58 4102 0.01% 59 3989 0.01% 60 4212 0.01% 61 4410 0.01% 62 4362 0.01% 63 4478 0.01% 64 4675 0.02% 65 4673 0.02% 66 4798 0.02% 67 5038 0.02% 68 5268 0.02% 69 5349 0.02% 70 5719 0.02% 71 5772 0.02% 72 6124 0.02% 73 6349 0.02% 74 6845 0.02% 75 6838 0.02% 76 7330 0.02% 77 7822 0.03% 78 8078 0.03% 79 10067 0.03% 80 30097 0.10% 81 30481 0.10% 82 30616 0.10% 83 30270 0.10% 84 30850 0.10% 85 31833 0.11% 86 31589 0.11% 87 32275 0.11% 88 33089 0.11% 89 34017 0.11% 90 34226 0.11% 91 35045 0.12% 92 35847 0.12% 93 37310 0.12% 94 38475 0.13% 95 39265 0.13% 96 39716 0.13% 97 41510 0.14% 98 42861 0.14% 99 43515 0.15% 100 45398 0.15% 101 46164 0.15% 102 48879 0.16% 103 50440 0.17% 104 52951 0.18% 105 55128 0.18% 106 55647 0.19% 107 57876 0.19% 108 59017 0.20% 109 62061 0.21% 110 63798 0.21% 111 65020 0.22% 112 69093 0.23% 113 69290 0.23% 114 70654 0.24% 115 74157 0.25% 116 78778 0.26% 117 77573 0.26% 118 86415 0.29% 119 93826 0.31% 120 103251 0.34% 121 102276 0.34% 122 144480 0.48% 123 154093 0.51% 124 160886 0.54% 125 168795 0.56% 126 253373 0.85% 127 261130 0.87% 128 263904 0.88% 129 186517 0.62% 130 187618 0.63% 131 191961 0.64% 132 192881 0.64% 133 43403 0.14% 134 32893 0.11% 135 22078 0.07% 136 23143 0.08% 137 30272 0.10% 138 59566 0.20% 139 957558 3.19% 140 24222451 80.82% criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=7.03 fanout-score-rank=25 prefix-density=0.20 prefix-fanout=4.6 sequence=TGCAGTTGTCGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=276.47 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=27.3 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=8.94 sequence-density-rank=1 fanout-score=44.57 fanout-score-rank=1 prefix-density=10.12 prefix-fanout=39.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGCGTT criterion=fanout-score sequence-density=8.94 sequence-density-rank=1 fanout-score=44.57 fanout-score-rank=1 prefix-density=10.12 prefix-fanout=39.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGCGTT ERR3959325 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:49:44 Started mapping on | Dec 07 02:49:44 Finished on | Dec 07 02:52:58 Mapping speed, Million of reads per hour | 926.95 Number of input reads | 49952433 Average input read length | 271 UNIQUE READS: Uniquely mapped reads number | 38557549 Uniquely mapped reads % | 77.19% Average mapped length | 274.28 Number of splices: Total | 34135195 Number of splices: Annotated (sjdb) | 32221488 Number of splices: GT/AG | 33622197 Number of splices: GC/AG | 461541 Number of splices: AT/AC | 19331 Number of splices: Non-canonical | 32126 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 516656 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 471386 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.37% % of reads unmapped: other | 3.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10983146 10983146 10983146 N_multimapping 516656 516656 516656 N_noFeature 1246441 37542950 1624496 N_ambiguous 879122 6251 247201 UnstrandedReadsAssigned:36431986 PositiveStrandReadsAssigned:1008348 NegativeStrandReadsAssigned:36685852 Dataset is classified negative stranded MeadianReadLen=140 20thPercentileLength=140 echo kmer=135 ERR3959325 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR3959325-trimmed-pair1.fastq ERR3959325-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 49,952,433 reads, 44,814,071 reads pseudoaligned [quant] estimated average fragment length: 223.128 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 ERR3959325.ke.tsv 35125 ERR3959325.se.tsv 88098 total ==> ERR3959325.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.112 0 0 PNS24247 1044 821.872 82.7697 3.29381 PNS24249 1928 1705.87 815.261 15.6308 PNS24246 1044 821.872 82.7697 3.29381 PNS24248 1044 821.872 82.7697 3.29381 PNS24244 1471 1248.87 120.43 3.15389 PNS24243 293 114.472 1 0.285715 KQK14069 1603 1380.87 41889.7 992.167 KQK14071 474 263.662 1703.82 211.352 ==> ERR3959325.se.tsv <== BRADI_1g14170v3 36997 BRADI_1g53295v3 295 BRADI_1g59795v3 385 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 2332 BRADI_1g74790v3 1356 BRADI_1g09890v3 7 BRADI_1g77505v3 387 BRADI_1g48960v3 0 ERR3959325 completed mapping pipeline successfully