Starting /dee2/code/volunteer_pipeline.sh ERR4656701 current disk space = 1547737821184 free memory = 1599514656 ERR4656701 SRAfilesize 0fbb691bf23ea0e12193c50a74783dbe ERR4656701.sra ERR4656701.sra file validated ERR4656701 is paired end ERR4656701 is conventional basespace ERR4656701 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR4656701_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.63325 32.0 27.0 33.0 18.0 33.0 2 30.5425 33.0 31.0 33.0 25.0 33.0 3 30.8585 33.0 31.0 33.0 25.0 34.0 4 30.76675 33.0 32.0 33.0 25.0 34.0 5 31.023 33.0 32.0 33.0 25.0 34.0 6 33.28575 37.0 33.0 38.0 16.0 38.0 7 33.759 37.0 33.0 38.0 16.0 38.0 8 33.14425 37.0 31.0 38.0 16.0 38.0 9 33.50075 38.0 33.0 38.0 16.0 38.0 10-11 33.85875 38.0 34.0 38.0 16.0 38.0 12-13 33.863 38.0 33.5 38.0 16.0 38.0 14-15 33.852875 38.0 33.5 38.0 16.0 38.0 16-17 33.868750000000006 38.0 33.5 38.0 16.0 38.0 18-19 34.109125 38.0 34.0 38.0 20.0 38.0 20-21 33.946625 38.0 33.5 38.0 16.0 38.0 22-23 33.988875 38.0 34.0 38.0 16.0 38.0 24-25 33.656375 38.0 33.0 38.0 20.0 38.0 26-27 33.966 38.0 34.0 38.0 20.0 38.0 28-29 34.070125000000004 38.0 34.0 38.0 16.0 38.0 30-31 34.127875 38.0 34.0 38.0 16.0 38.0 32-33 34.081125 38.0 34.0 38.0 20.0 38.0 34-35 34.304375 38.0 34.0 38.0 25.0 38.0 36-37 34.127375 38.0 34.0 38.0 20.5 38.0 38-39 34.287875 38.0 34.0 38.0 24.0 38.0 40-41 34.138625000000005 38.0 34.0 38.0 20.0 38.0 42-43 34.115875 38.0 34.0 38.0 20.5 38.0 44-45 34.27075 38.0 34.0 38.0 24.5 38.0 46-47 34.204875 38.0 34.0 38.0 20.5 38.0 48-49 34.22825 38.0 34.0 38.0 20.0 38.0 50-51 34.11725 38.0 34.0 38.0 20.0 38.0 52-53 34.116625 38.0 34.0 38.0 20.5 38.0 54-55 34.187 38.0 34.0 38.0 20.5 38.0 56-57 34.26375 38.0 34.0 38.0 24.5 38.0 58-59 33.937375 38.0 34.0 38.0 16.0 38.0 60-61 33.907375 38.0 34.0 38.0 16.0 38.0 62-63 33.894 38.0 33.5 38.0 16.0 38.0 64-65 34.182 38.0 34.0 38.0 20.5 38.0 66-67 34.15775 38.0 34.0 38.0 24.0 38.0 68-69 34.180125000000004 38.0 34.0 38.0 20.0 38.0 70-71 34.194 38.0 34.0 38.0 24.5 38.0 72-73 33.744 38.0 33.5 38.0 16.0 38.0 74-75 34.167125 38.0 34.0 38.0 24.0 38.0 76-77 33.95875 38.0 34.0 38.0 19.0 38.0 78-79 33.986125 38.0 34.0 38.0 19.5 38.0 80-81 34.051375 38.0 34.0 38.0 19.5 38.0 82-83 33.944625 38.0 34.0 38.0 15.0 38.0 84-85 34.117875 38.0 34.0 38.0 23.0 38.0 86-87 33.815875 38.0 34.0 38.0 15.5 38.0 88-89 33.571125 38.0 33.0 38.0 15.0 38.0 90-91 33.783500000000004 38.0 34.0 38.0 18.5 38.0 92-93 33.748999999999995 38.0 34.0 38.0 15.0 38.0 94-95 33.727125 38.0 34.0 38.0 15.0 38.0 96-97 33.596875 38.0 34.0 38.0 15.0 38.0 98-99 33.218125 38.0 33.0 38.0 15.0 38.0 100-101 32.367625000000004 37.0 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 8.0 19 27.0 20 39.0 21 46.0 22 44.0 23 51.0 24 74.0 25 68.0 26 83.0 27 89.0 28 118.0 29 103.0 30 140.0 31 160.0 32 190.0 33 211.0 34 293.0 35 379.0 36 667.0 37 1208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.354430379746837 10.481012658227847 11.69620253164557 49.46835443037975 2 21.349999999999998 16.85 39.25 22.55 3 21.425 20.349999999999998 24.4 33.825 4 25.624999999999996 27.35 22.45 24.575 5 25.95 31.3 24.325 18.425 6 19.55 34.875 25.974999999999998 19.6 7 15.778944736184048 22.1055263815954 41.96049012253063 20.155038759689923 8 17.883941970985493 21.135567783891947 34.26713356678339 26.713356678339167 9 18.704676169042262 21.030257564391096 33.908477119279816 26.356589147286826 10-11 21.21780445111278 31.357839459864966 22.918229557389346 24.50612653163291 12-13 21.980495123780948 23.493373343335833 28.169542385596397 26.356589147286826 14-15 21.039448966812774 25.410144020037574 28.9167188478397 24.633688165309955 16-17 21.606405604904293 26.323032653571875 26.66082822469661 25.409733516827227 18-19 21.54288572143036 26.756689172293076 26.494123530882717 25.206301575393848 20-21 21.165145643205403 26.078259782472806 27.315914489311165 25.440680085010626 22-23 22.537499999999998 25.674999999999997 26.924999999999997 24.8625 24-25 21.57769721215152 26.153269158644832 27.053381672709087 25.21565195649456 26-27 20.252531566445807 26.440805100637583 27.665958244780597 25.640705088136016 28-29 21.625 26.200000000000003 25.9875 26.187500000000004 30-31 21.349999999999998 26.700000000000003 26.337500000000002 25.6125 32-33 22.15 26.3125 26.337500000000002 25.2 34-35 22.025 26.5625 26.900000000000002 24.5125 36-37 21.5625 26.674999999999997 27.1 24.6625 38-39 20.6625 26.9625 27.3375 25.0375 40-41 21.099999999999998 26.787499999999998 26.325 25.7875 42-43 21.837500000000002 26.575 26.275 25.3125 44-45 21.75 26.950000000000003 26.737499999999997 24.5625 46-47 21.875 26.650000000000002 26.6625 24.8125 48-49 21.675 25.900000000000002 26.6625 25.7625 50-51 22.025 25.974999999999998 27.3375 24.6625 52-53 21.925 26.0375 26.687499999999996 25.35 54-55 21.4875 26.1125 27.6 24.8 56-57 21.525 25.85 26.924999999999997 25.7 58-59 22.0625 26.187500000000004 26.9625 24.7875 60-61 21.9625 26.375 26.424999999999997 25.2375 62-63 21.212500000000002 25.724999999999998 27.9125 25.15 64-65 22.5 25.724999999999998 26.487500000000004 25.2875 66-67 22.5625 26.437500000000004 26.35 24.65 68-69 21.1625 27.05 25.837500000000002 25.95 70-71 22.2 26.087500000000002 25.662499999999998 26.05 72-73 21.6625 25.650000000000002 26.9125 25.775 74-75 21.9625 26.275 26.3125 25.45 76-77 21.85 26.7625 25.387500000000003 26.0 78-79 22.3625 25.224999999999998 26.450000000000003 25.9625 80-81 22.5125 26.2625 26.0125 25.2125 82-83 22.662499999999998 26.0 26.387500000000003 24.95 84-85 21.8125 26.25 25.7625 26.174999999999997 86-87 22.650000000000002 26.237500000000004 25.874999999999996 25.2375 88-89 22.825 26.325 26.1 24.75 90-91 22.9375 25.662499999999998 26.1125 25.2875 92-93 21.912499999999998 26.3625 25.95 25.775 94-95 22.325 25.412499999999998 26.8125 25.45 96-97 21.8875 26.337500000000002 26.075 25.7 98-99 21.5625 27.0125 25.525 25.900000000000002 100-101 22.875 26.787499999999998 25.474999999999998 24.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 0.5 28 1.0 29 2.5 30 6.5 31 11.5 32 15.0 33 17.5 34 21.5 35 32.0 36 46.0 37 67.0 38 88.5 39 117.5 40 171.5 41 196.0 42 195.5 43 214.5 44 221.0 45 216.5 46 210.0 47 198.0 48 180.0 49 179.5 50 191.5 51 186.5 52 179.5 53 160.0 54 132.5 55 136.5 56 130.0 57 91.0 58 76.0 59 77.5 60 65.5 61 49.0 62 37.5 63 26.5 64 19.5 65 13.0 66 5.5 67 5.5 68 5.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.025 10-11 0.025 12-13 0.025 14-15 0.1875 16-17 0.08750000000000001 18-19 0.025 20-21 0.0125 22-23 0.0 24-25 0.0125 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.97798822626056 95.7 2 1.7660609163040697 3.45 3 0.15357051446122344 0.44999999999999996 4 0.10238034297414896 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR4656701 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR4656701_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.54075 32.0 27.0 33.0 18.0 33.0 2 29.9305 32.0 28.0 33.0 18.0 34.0 3 26.54425 30.0 18.0 33.0 18.0 33.0 4 28.6075 32.0 27.0 33.0 15.0 33.0 5 29.4725 32.0 27.0 33.0 15.0 33.0 6 26.969 29.0 16.0 37.0 15.0 38.0 7 30.5435 34.0 27.0 38.0 16.0 38.0 8 32.463 36.0 29.0 38.0 16.0 38.0 9 32.95425 37.0 31.0 38.0 16.0 38.0 10-11 33.508875 37.5 33.0 38.0 16.0 38.0 12-13 33.59675 38.0 33.0 38.0 16.0 38.0 14-15 33.7355 38.0 33.5 38.0 16.0 38.0 16-17 33.510000000000005 38.0 33.0 38.0 16.0 38.0 18-19 33.460499999999996 38.0 33.0 38.0 16.0 38.0 20-21 33.44225 38.0 33.0 38.0 16.0 38.0 22-23 33.582875 38.0 33.0 38.0 16.0 38.0 24-25 33.267875000000004 37.5 33.0 38.0 16.0 38.0 26-27 33.38075 37.5 32.0 38.0 16.0 38.0 28-29 31.67975 36.5 24.5 38.0 16.0 38.0 30-31 32.957375 37.0 30.5 38.0 16.0 38.0 32-33 33.59325 38.0 33.0 38.0 16.0 38.0 34-35 33.65625 38.0 33.0 38.0 16.0 38.0 36-37 33.213625 38.0 31.5 38.0 16.0 38.0 38-39 33.378625 38.0 33.0 38.0 16.0 38.0 40-41 33.613 38.0 33.0 38.0 16.0 38.0 42-43 33.619625 38.0 33.0 38.0 16.0 38.0 44-45 33.976749999999996 38.0 34.0 38.0 20.0 38.0 46-47 33.68925 38.0 33.5 38.0 16.0 38.0 48-49 33.88225 38.0 34.0 38.0 16.0 38.0 50-51 34.044875000000005 38.0 34.0 38.0 20.0 38.0 52-53 34.107875 38.0 34.0 38.0 20.0 38.0 54-55 33.905249999999995 38.0 34.0 38.0 16.0 38.0 56-57 33.943375 38.0 34.0 38.0 16.0 38.0 58-59 33.870625000000004 38.0 34.0 38.0 16.0 38.0 60-61 33.866875 38.0 34.0 38.0 16.0 38.0 62-63 33.793625000000006 38.0 33.5 38.0 16.0 38.0 64-65 33.766 38.0 33.5 38.0 16.0 38.0 66-67 33.810500000000005 38.0 33.5 38.0 16.0 38.0 68-69 33.9125 38.0 34.0 38.0 16.0 38.0 70-71 33.714 38.0 33.5 38.0 16.0 38.0 72-73 33.753 38.0 33.5 38.0 16.0 38.0 74-75 33.721875 38.0 33.5 38.0 16.0 38.0 76-77 33.824124999999995 38.0 34.0 38.0 16.0 38.0 78-79 33.150125 37.5 31.5 38.0 15.5 38.0 80-81 33.1945 37.5 32.5 38.0 16.0 38.0 82-83 33.1525 38.0 32.0 38.0 16.0 38.0 84-85 33.543625 38.0 33.0 38.0 15.5 38.0 86-87 33.13275 37.5 32.0 38.0 15.0 38.0 88-89 33.391125 38.0 33.0 38.0 15.0 38.0 90-91 33.160375 38.0 32.0 38.0 15.0 38.0 92-93 33.30875 38.0 33.0 38.0 15.0 38.0 94-95 33.263125 38.0 33.0 38.0 15.0 38.0 96-97 33.311125000000004 38.0 33.0 38.0 15.0 38.0 98-99 33.11775 38.0 32.0 38.0 15.0 38.0 100-101 31.249499999999998 36.0 28.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 15.0 18 35.0 19 37.0 20 48.0 21 46.0 22 35.0 23 86.0 24 75.0 25 69.0 26 85.0 27 106.0 28 116.0 29 132.0 30 140.0 31 182.0 32 208.0 33 235.0 34 353.0 35 396.0 36 708.0 37 893.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.65 14.6 13.850000000000001 40.9 2 27.950000000000003 21.725 32.574999999999996 17.75 3 19.05 23.45 34.675 22.825 4 26.974999999999998 30.325000000000003 20.25 22.45 5 27.200000000000003 32.975 20.775 19.05 6 19.6 33.925 26.174999999999997 20.3 7 21.825 16.950000000000003 39.0 22.225 8 23.400000000000002 22.225 27.224999999999998 27.150000000000002 9 23.375 23.575 28.549999999999997 24.5 10-11 27.3875 29.5 20.5375 22.575 12-13 26.090761345168147 22.802850356294538 25.30316289536192 25.803225403175396 14-15 25.575 26.5125 25.8125 22.1 16-17 26.450000000000003 25.4625 24.212500000000002 23.875 18-19 25.674999999999997 26.087500000000002 25.337500000000002 22.900000000000002 20-21 26.400000000000002 26.8375 24.3875 22.375 22-23 26.525 26.0625 24.7375 22.675 24-25 25.424999999999997 26.55 25.174999999999997 22.85 26-27 25.900000000000002 26.437500000000004 25.124999999999996 22.537499999999998 28-29 26.55 26.075 25.224999999999998 22.15 30-31 25.3125 27.537499999999998 24.2375 22.912499999999998 32-33 26.275 26.437500000000004 24.175 23.1125 34-35 25.431357839459867 25.906476619154787 24.968742185546386 23.69342335583896 36-37 25.56739811912226 26.244514106583072 25.61755485893417 22.570532915360502 38-39 25.647117669125922 27.872952357133922 24.934350381393024 21.54557959234713 40-41 26.463231615807903 26.18809404702351 24.899949974987493 22.448724362181093 42-43 25.431197280624453 26.325066095933526 25.783708926098452 22.460027697343573 44-45 25.83791895947974 26.713356678339167 24.787393696848426 22.661330665332667 46-47 26.394284998120064 26.644942975310187 24.752475247524753 22.208296779044993 48-49 26.094023505876468 25.63140785196299 26.219054763690924 22.05551387846962 50-51 25.1875 27.212500000000002 25.900000000000002 21.7 52-53 26.2125 26.1125 25.124999999999996 22.55 54-55 25.2 26.2875 26.1 22.412499999999998 56-57 25.1 26.450000000000003 25.8 22.650000000000002 58-59 25.30316289536192 26.615826978372297 25.55319414926866 22.527815976997125 60-61 25.418854713678417 26.78169542385596 26.03150787696924 21.767941985496375 62-63 24.93123280820205 26.694173543385848 25.806451612903224 22.568142035508878 64-65 25.853231653956744 26.540817602200274 25.240655081885237 22.365295661957745 66-67 25.4875 26.2625 26.1625 22.0875 68-69 25.4625 26.1 25.05 23.3875 70-71 26.006501625406354 26.39409852463116 25.481370342585645 22.118029507376843 72-73 26.128266033254157 26.003250406300786 26.090761345168147 21.77772221527691 74-75 25.387500000000003 27.700000000000003 26.05 20.8625 76-77 25.728216027003377 26.428303537942245 25.278159769971246 22.565320665083135 78-79 25.965745718214777 25.440680085010626 26.67833479184898 21.915239404925615 80-81 25.381345336334082 27.406851712928233 25.731432858214554 21.48037009252313 82-83 25.528191023877984 25.90323790473809 26.62832854106763 21.94024253031629 84-85 25.85646411602901 26.331582895723933 25.868967241810452 21.94298574643661 86-87 25.79394848712178 26.19404851212803 26.131532883220803 21.880470117529384 88-89 26.056514128532132 25.831457864466117 26.319079769942487 21.792948237059264 90-91 24.962500000000002 27.212500000000002 25.937500000000004 21.8875 92-93 24.25 27.3 26.35 22.1 94-95 25.8125 26.5 25.2875 22.400000000000002 96-97 25.21565195649456 26.903362920365048 24.928116014501814 22.95286910863858 98-99 26.237500000000004 26.5375 26.0 21.224999999999998 100-101 26.075 26.674999999999997 25.4875 21.762500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 0.5 30 1.0 31 2.0 32 4.0 33 13.0 34 19.5 35 24.0 36 42.5 37 64.0 38 74.5 39 88.0 40 128.0 41 160.5 42 173.5 43 196.0 44 207.0 45 211.0 46 218.5 47 222.0 48 218.5 49 194.0 50 167.5 51 187.0 52 192.0 53 164.5 54 167.5 55 153.0 56 141.5 57 121.0 58 90.5 59 76.0 60 65.5 61 64.0 62 46.0 63 36.5 64 26.0 65 11.5 66 10.0 67 8.0 68 6.0 69 3.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.025 36-37 0.3125 38-39 0.0375 40-41 0.05 42-43 0.7125 44-45 0.05 46-47 0.2625 48-49 0.025 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.025 62-63 0.025 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.0125 80-81 0.025 82-83 0.0125 84-85 0.025 86-87 0.025 88-89 0.025 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.6560686348725713 1.3 3 0.10093363613424174 0.3 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163303 spots for ERR4656701.sra Written 163303 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra Read 163288 spots for ERR4656701.sra Written 163288 spots for ERR4656701.sra SRR ids: ['ERR4656701.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ng64j5et ERR4656701.sra spots: 3265775 blocks: [[1, 163288], [163289, 326576], [326577, 489864], [489865, 653152], [653153, 816440], [816441, 979728], [979729, 1143016], [1143017, 1306304], [1306305, 1469592], [1469593, 1632880], [1632881, 1796168], [1796169, 1959456], [1959457, 2122744], [2122745, 2286032], [2286033, 2449320], [2449321, 2612608], [2612609, 2775896], [2775897, 2939184], [2939185, 3102472], [3102473, 3265775]] ERR4656701 file size 779193 ERR4656701 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR4656701 ERR4656701_1.fastq ERR4656701_2.fastq Input file: ERR4656701_1.fastq Paired file: ERR4656701_2.fastq trimmed: ERR4656701-trimmed-pair1.fastq, ERR4656701-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:17:27 2024 >> started Sat Dec 7 02:17:30 2024 >> done (3.631s) 3265775 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 242 ( 0.01%) empty read pairs filtered out after trimming by size control 3265523 (99.99%) read pairs available; of these: 113159 ( 3.47%) trimmed read pairs available after processing 3152364 (96.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 3 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 5 0.00% 32 2 0.00% 33 2 0.00% 34 5 0.00% 35 4 0.00% 36 5 0.00% 37 5 0.00% 38 6 0.00% 39 11 0.00% 40 12 0.00% 41 15 0.00% 42 4 0.00% 43 15 0.00% 44 24 0.00% 45 19 0.00% 46 17 0.00% 47 30 0.00% 48 28 0.00% 49 29 0.00% 50 37 0.00% 51 47 0.00% 52 38 0.00% 53 61 0.00% 54 76 0.00% 55 82 0.00% 56 88 0.00% 57 93 0.00% 58 107 0.00% 59 121 0.00% 60 133 0.00% 61 159 0.00% 62 151 0.00% 63 206 0.01% 64 191 0.01% 65 239 0.01% 66 274 0.01% 67 285 0.01% 68 319 0.01% 69 375 0.01% 70 455 0.01% 71 513 0.02% 72 529 0.02% 73 603 0.02% 74 719 0.02% 75 742 0.02% 76 913 0.03% 77 989 0.03% 78 1168 0.04% 79 1281 0.04% 80 1420 0.04% 81 1609 0.05% 82 1760 0.05% 83 2051 0.06% 84 2311 0.07% 85 2554 0.08% 86 2910 0.09% 87 3114 0.10% 88 3601 0.11% 89 3827 0.12% 90 4268 0.13% 91 4781 0.15% 92 5265 0.16% 93 5589 0.17% 94 6203 0.19% 95 6807 0.21% 96 7313 0.22% 97 8194 0.25% 98 8589 0.26% 99 9593 0.29% 100 10161 0.31% 101 3152364 96.53% 3265523 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.34 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=13.52 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.4 sequence=CCTGATCTGAAACAGATTTATTTAAAACAGTAAGATGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCACCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGTTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=28.36 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.5 sequence=AAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTCATCCGTGACGGTCGTATGGAGAAGTTCTACTGGGCCCCCACCCGCGAAGACCGTATCGGTGTCTGCAGGGGTATCTTCCAAACTGACAACATCAGCGACGAGTCCGTCATCAAGATCGTAGACACCTTCCCAGGCCAATCCATCGACTTTTTCGGAGCGCTGCGTGCCCGGGTGTACGACGATGAGGTGCGCAAGTGGGTCAGCTCAACCGGAATAGAGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTTGAGCAGCCAAAGATGACAATCGAGAAGCTCCTGGAGTACGGCCACATGCTCGTCCAAGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACAAGTACATGAGCGAGGCTGCTCTGGGAGATGCTAACTCAGATGCCATGAAGACTGGTTCCTTCTACGGTTAGAACACTCTTC ERR4656701 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:18:07 Started mapping on | Dec 07 02:18:07 Finished on | Dec 07 02:18:54 Mapping speed, Million of reads per hour | 250.13 Number of input reads | 3265523 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 2582697 Uniquely mapped reads % | 79.09% Average mapped length | 192.13 Number of splices: Total | 1392739 Number of splices: Annotated (sjdb) | 1283320 Number of splices: GT/AG | 1367514 Number of splices: GC/AG | 16065 Number of splices: AT/AC | 494 Number of splices: Non-canonical | 8666 Mismatch rate per base, % | 0.85% Deletion rate per base | 0.02% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 239588 % of reads mapped to multiple loci | 7.34% Number of reads mapped to too many loci | 20303 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.77% % of reads unmapped: other | 3.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443238 443238 443238 N_multimapping 239588 239588 239588 N_noFeature 153453 2501619 169038 N_ambiguous 77665 273 12528 UnstrandedReadsAssigned:2351579 PositiveStrandReadsAssigned:80805 NegativeStrandReadsAssigned:2401131 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR4656701 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR4656701-trimmed-pair1.fastq ERR4656701-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,265,523 reads, 2,612,692 reads pseudoaligned [quant] estimated average fragment length: 161.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52973 ERR4656701.ke.tsv 35125 ERR4656701.se.tsv 88098 total ==> ERR4656701.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.436 2.90365e-08 2.08074e-08 PNS24247 1044 883.324 6.28867 3.95602 PNS24249 1928 1767.32 0 0 PNS24246 1044 883.324 6.28867 3.95602 PNS24248 1044 883.324 6.28867 3.95602 PNS24244 1471 1310.32 20.134 8.53828 PNS24243 293 138.78 0 0 KQK14069 1603 1442.32 78 30.0505 KQK14071 474 314.582 1 1.76639 ==> ERR4656701.se.tsv <== BRADI_1g14170v3 74 BRADI_1g53295v3 46 BRADI_1g59795v3 67 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 64 BRADI_1g74790v3 7 BRADI_1g09890v3 0 BRADI_1g77505v3 57 BRADI_1g48960v3 0 ERR4656701 completed mapping pipeline successfully