Starting /dee2/code/volunteer_pipeline.sh ERR5052684 current disk space = 1525824380928 free memory = 1555438536 ERR5052684 SRAfilesize bed28a3d882e1a7897574aef0266d307 ERR5052684.sra ERR5052684.sra file validated ERR5052684 is paired end ERR5052684 is conventional basespace ERR5052684 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052684_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2715 35.0 35.0 35.0 35.0 35.0 2 34.6045 35.0 35.0 35.0 35.0 35.0 3 34.666 35.0 35.0 35.0 35.0 35.0 4 34.697 35.0 35.0 35.0 35.0 35.0 5 34.649 35.0 35.0 35.0 35.0 35.0 6 39.40175 40.0 40.0 40.0 39.0 40.0 7 39.41325 40.0 40.0 40.0 39.0 40.0 8 39.474 40.0 40.0 40.0 39.0 40.0 9 39.4395 40.0 40.0 40.0 39.0 40.0 10 39.426 40.0 40.0 40.0 39.0 40.0 11 39.48 40.0 40.0 40.0 39.0 40.0 12 39.44725 40.0 40.0 40.0 39.0 40.0 13 39.435 40.0 40.0 40.0 39.0 40.0 14 39.39475 40.0 40.0 40.0 39.0 40.0 15 39.4145 40.0 40.0 40.0 39.0 40.0 16 39.43 40.0 40.0 40.0 39.0 40.0 17 39.4165 40.0 40.0 40.0 39.0 40.0 18 39.4065 40.0 40.0 40.0 39.0 40.0 19 39.41975 40.0 40.0 40.0 39.0 40.0 20 39.415 40.0 40.0 40.0 39.0 40.0 21 39.4255 40.0 40.0 40.0 39.0 40.0 22 39.381 40.0 40.0 40.0 39.0 40.0 23 39.35225 40.0 40.0 40.0 39.0 40.0 24 39.29775 40.0 40.0 40.0 39.0 40.0 25 39.40725 40.0 40.0 40.0 39.0 40.0 26 39.3825 40.0 40.0 40.0 39.0 40.0 27 39.39225 40.0 40.0 40.0 39.0 40.0 28 39.38 40.0 40.0 40.0 39.0 40.0 29 39.3765 40.0 40.0 40.0 39.0 40.0 30 39.382 40.0 40.0 40.0 39.0 40.0 31 39.4085 40.0 40.0 40.0 39.0 40.0 32 39.3685 40.0 40.0 40.0 39.0 40.0 33 39.4215 40.0 40.0 40.0 39.0 40.0 34 39.33875 40.0 40.0 40.0 39.0 40.0 35 39.38125 40.0 40.0 40.0 39.0 40.0 36 39.40625 40.0 40.0 40.0 39.0 40.0 37 39.4055 40.0 40.0 40.0 39.0 40.0 38 39.3435 40.0 40.0 40.0 39.0 40.0 39 39.41175 40.0 40.0 40.0 39.0 40.0 40 39.35125 40.0 40.0 40.0 39.0 40.0 41 39.2945 40.0 40.0 40.0 39.0 40.0 42 39.3245 40.0 40.0 40.0 39.0 40.0 43 39.37475 40.0 40.0 40.0 39.0 40.0 44 39.379 40.0 40.0 40.0 39.0 40.0 45 39.34125 40.0 40.0 40.0 39.0 40.0 46 39.32375 40.0 40.0 40.0 39.0 40.0 47 39.39025 40.0 40.0 40.0 39.0 40.0 48 39.39175 40.0 40.0 40.0 39.0 40.0 49 39.3635 40.0 40.0 40.0 39.0 40.0 50 39.3665 40.0 40.0 40.0 39.0 40.0 51 39.33675 40.0 40.0 40.0 39.0 40.0 52 39.338 40.0 40.0 40.0 39.0 40.0 53 39.40725 40.0 40.0 40.0 39.0 40.0 54 39.3095 40.0 40.0 40.0 39.0 40.0 55 39.34825 40.0 40.0 40.0 39.0 40.0 56 39.3505 40.0 40.0 40.0 39.0 40.0 57 39.30725 40.0 40.0 40.0 39.0 40.0 58 39.34175 40.0 40.0 40.0 39.0 40.0 59 39.325 40.0 40.0 40.0 39.0 40.0 60 39.38775 40.0 40.0 40.0 39.0 40.0 61 39.30575 40.0 40.0 40.0 39.0 40.0 62 39.319 40.0 40.0 40.0 39.0 40.0 63 39.337 40.0 40.0 40.0 39.0 40.0 64 39.3175 40.0 40.0 40.0 39.0 40.0 65 39.3825 40.0 40.0 40.0 39.0 40.0 66 39.32 40.0 40.0 40.0 39.0 40.0 67 39.31775 40.0 40.0 40.0 39.0 40.0 68 39.2675 40.0 40.0 40.0 39.0 40.0 69 39.2505 40.0 40.0 40.0 39.0 40.0 70 39.3415 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 9.0 27 12.0 28 2.0 29 17.0 30 17.0 31 25.0 32 19.0 33 28.0 34 42.0 35 46.0 36 64.0 37 108.0 38 235.0 39 3376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.180966843837005 10.933940774487471 11.592002024803847 42.29309035687167 2 22.5 13.700000000000001 30.725 33.074999999999996 3 21.95 18.725 23.95 35.375 4 26.025 24.575 22.3 27.1 5 26.125 30.225 23.375 20.275000000000002 6 21.8 30.75 24.975 22.475 7 17.525 23.925 37.325 21.224999999999998 8 20.25 22.475 30.125 27.150000000000002 9 19.475 22.975 32.375 25.174999999999997 10 20.849999999999998 31.974999999999998 23.95 23.225 11 24.55 25.8 22.0 27.650000000000002 12 24.099999999999998 23.025000000000002 27.05 25.825 13 22.75 25.45 28.050000000000004 23.75 14 23.35 25.15 26.3 25.2 15 22.0 24.85 26.424999999999997 26.724999999999998 16 23.275000000000002 25.0 25.0 26.724999999999998 17 23.425 26.075 23.7 26.8 18 23.35 24.875 26.700000000000003 25.074999999999996 19 22.875 25.7 26.025 25.4 20 22.6 26.424999999999997 25.95 25.025 21 24.175 25.874999999999996 24.925 25.025 22 22.8 25.624999999999996 26.075 25.5 23 23.175 25.825 25.374999999999996 25.624999999999996 24 23.474999999999998 25.7 25.224999999999998 25.6 25 24.275 25.025 24.825 25.874999999999996 26 23.275000000000002 25.474999999999998 26.075 25.174999999999997 27 23.625 25.35 25.35 25.674999999999997 28 22.525000000000002 26.375 24.325 26.775 29 22.225 25.6 25.424999999999997 26.75 30 21.925 25.2 26.474999999999998 26.400000000000002 31 23.599999999999998 26.1 23.175 27.125 32 22.775000000000002 25.0 26.35 25.874999999999996 33 22.725 24.775 26.375 26.125 34 23.724999999999998 25.374999999999996 24.2 26.700000000000003 35 22.275 26.974999999999998 24.875 25.874999999999996 36 23.724999999999998 24.4 24.474999999999998 27.400000000000002 37 24.2 26.075 24.55 25.174999999999997 38 23.25 25.974999999999998 24.875 25.900000000000002 39 23.5 25.575 25.424999999999997 25.5 40 23.474999999999998 24.975 25.45 26.1 41 23.1 25.474999999999998 25.825 25.6 42 24.5 24.85 25.525 25.124999999999996 43 23.150000000000002 25.825 24.375 26.650000000000002 44 22.2 25.724999999999998 25.7 26.375 45 24.5 24.375 24.65 26.474999999999998 46 23.925 24.675 24.825 26.575 47 22.5 26.224999999999998 24.175 27.1 48 22.95 25.224999999999998 25.15 26.674999999999997 49 23.549999999999997 26.150000000000002 24.45 25.85 50 23.599999999999998 25.75 25.25 25.4 51 23.075000000000003 25.424999999999997 25.525 25.974999999999998 52 23.974999999999998 25.374999999999996 25.0 25.650000000000002 53 23.275000000000002 26.25 24.525 25.95 54 21.975 24.875 26.174999999999997 26.974999999999998 55 24.675 25.2 25.25 24.875 56 23.3 24.275 26.8 25.624999999999996 57 22.400000000000002 25.85 25.25 26.5 58 22.425 26.174999999999997 25.1 26.3 59 23.575 25.55 25.174999999999997 25.7 60 23.325000000000003 25.0 26.174999999999997 25.5 61 23.474999999999998 25.174999999999997 25.75 25.6 62 23.474999999999998 25.650000000000002 25.474999999999998 25.4 63 23.849999999999998 24.5 25.85 25.8 64 23.875 24.625 25.974999999999998 25.525 65 21.625 25.35 25.900000000000002 27.125 66 24.81240620310155 24.412206103051524 25.337668834417208 25.437718859429715 67 23.39944765252322 26.085864925935226 25.583730856138587 24.930956565402962 68 24.343614580678054 23.808309966862097 24.522049451950036 27.326026000509813 69 23.288424525708002 19.54907891119054 28.045092108880947 29.117404454220512 70 24.177029992684712 0.0 37.19824433065106 38.62472567666423 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 2.5 26 4.0 27 5.0 28 8.5 29 12.0 30 12.0 31 20.0 32 29.5 33 31.0 34 42.0 35 68.5 36 91.0 37 98.0 38 132.5 39 168.5 40 170.0 41 189.0 42 229.5 43 251.0 44 261.5 45 275.5 46 275.0 47 271.0 48 266.0 49 268.5 50 276.0 51 244.0 52 202.0 53 192.0 54 173.0 55 147.0 56 123.5 57 107.0 58 96.0 59 87.5 60 90.0 61 83.0 62 77.0 63 78.0 64 68.0 65 63.5 66 66.0 67 63.0 68 54.5 69 44.0 70 42.0 71 37.0 72 28.5 73 25.0 74 21.5 75 14.5 76 8.0 77 5.0 78 4.5 79 3.0 80 2.0 81 3.0 82 2.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.05 67 0.42500000000000004 68 1.925 69 9.075 70 31.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052684 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052684_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.386 35.0 35.0 35.0 33.0 35.0 2 34.16825 35.0 35.0 35.0 33.0 35.0 3 34.27375 35.0 35.0 35.0 33.0 35.0 4 34.305 35.0 35.0 35.0 33.0 35.0 5 34.264 35.0 35.0 35.0 33.0 35.0 6 39.03875 40.0 40.0 40.0 39.0 40.0 7 39.03375 40.0 40.0 40.0 39.0 40.0 8 39.009 40.0 40.0 40.0 39.0 40.0 9 39.08075 40.0 40.0 40.0 39.0 40.0 10 39.04975 40.0 40.0 40.0 39.0 40.0 11 39.0185 40.0 40.0 40.0 39.0 40.0 12 39.02375 40.0 40.0 40.0 39.0 40.0 13 39.028 40.0 40.0 40.0 39.0 40.0 14 39.06375 40.0 40.0 40.0 39.0 40.0 15 39.04225 40.0 40.0 40.0 39.0 40.0 16 38.98725 40.0 40.0 40.0 39.0 40.0 17 39.035 40.0 40.0 40.0 39.0 40.0 18 39.02725 40.0 40.0 40.0 39.0 40.0 19 39.059 40.0 40.0 40.0 39.0 40.0 20 39.0035 40.0 40.0 40.0 39.0 40.0 21 38.99575 40.0 40.0 40.0 39.0 40.0 22 38.95375 40.0 40.0 40.0 39.0 40.0 23 38.97775 40.0 40.0 40.0 39.0 40.0 24 39.0175 40.0 40.0 40.0 39.0 40.0 25 39.03675 40.0 40.0 40.0 39.0 40.0 26 38.98825 40.0 40.0 40.0 39.0 40.0 27 39.016 40.0 40.0 40.0 39.0 40.0 28 38.99025 40.0 40.0 40.0 39.0 40.0 29 39.028 40.0 40.0 40.0 39.0 40.0 30 39.01825 40.0 40.0 40.0 39.0 40.0 31 39.017 40.0 40.0 40.0 39.0 40.0 32 39.04075 40.0 40.0 40.0 39.0 40.0 33 39.001 40.0 40.0 40.0 39.0 40.0 34 39.01125 40.0 40.0 40.0 39.0 40.0 35 39.00775 40.0 40.0 40.0 39.0 40.0 36 38.94725 40.0 40.0 40.0 39.0 40.0 37 39.07 40.0 40.0 40.0 39.0 40.0 38 39.03125 40.0 40.0 40.0 39.0 40.0 39 39.00575 40.0 40.0 40.0 39.0 40.0 40 39.01025 40.0 40.0 40.0 39.0 40.0 41 39.00775 40.0 40.0 40.0 39.0 40.0 42 38.912 40.0 40.0 40.0 39.0 40.0 43 38.959 40.0 40.0 40.0 38.0 40.0 44 39.0015 40.0 40.0 40.0 39.0 40.0 45 38.94225 40.0 40.0 40.0 39.0 40.0 46 38.97525 40.0 40.0 40.0 39.0 40.0 47 38.97075 40.0 40.0 40.0 39.0 40.0 48 38.956 40.0 40.0 40.0 38.0 40.0 49 38.90775 40.0 40.0 40.0 38.0 40.0 50 38.9225 40.0 40.0 40.0 38.0 40.0 51 38.91775 40.0 40.0 40.0 38.0 40.0 52 38.8355 40.0 40.0 40.0 38.0 40.0 53 38.8595 40.0 40.0 40.0 38.0 40.0 54 38.886 40.0 40.0 40.0 38.0 40.0 55 38.966 40.0 40.0 40.0 38.0 40.0 56 38.8385 40.0 40.0 40.0 38.0 40.0 57 38.90575 40.0 40.0 40.0 38.0 40.0 58 38.90225 40.0 40.0 40.0 38.0 40.0 59 38.86575 40.0 40.0 40.0 38.0 40.0 60 38.9405 40.0 40.0 40.0 39.0 40.0 61 39.006 40.0 40.0 40.0 39.0 40.0 62 38.9265 40.0 40.0 40.0 38.0 40.0 63 38.79975 40.0 40.0 40.0 38.0 40.0 64 38.85575 40.0 40.0 40.0 38.0 40.0 65 38.90775 40.0 40.0 40.0 38.0 40.0 66 38.861 40.0 40.0 40.0 38.0 40.0 67 38.84475 40.0 40.0 40.0 38.0 40.0 68 38.84675 40.0 40.0 40.0 38.0 40.0 69 38.8465 40.0 40.0 40.0 38.0 40.0 70 38.726 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 5.0 18 4.0 19 8.0 20 7.0 21 5.0 22 15.0 23 10.0 24 14.0 25 14.0 26 11.0 27 11.0 28 19.0 29 20.0 30 17.0 31 14.0 32 28.0 33 27.0 34 37.0 35 41.0 36 56.0 37 107.0 38 225.0 39 3303.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.050000000000004 18.275 14.325 33.35 2 28.65 24.65 26.6 20.1 3 22.650000000000002 26.674999999999997 26.400000000000002 24.275 4 27.0 30.025000000000002 20.625 22.35 5 26.5 33.050000000000004 20.45 20.0 6 23.425 30.375000000000004 22.5 23.7 7 22.575 18.8 33.1 25.525 8 23.45 23.0 25.724999999999998 27.825 9 24.025 21.625 27.975 26.375 10 25.35 30.075000000000003 21.425 23.150000000000002 11 28.475 23.225 20.349999999999998 27.950000000000003 12 26.075 22.675 24.45 26.8 13 25.374999999999996 23.525 25.724999999999998 25.374999999999996 14 24.85 25.75 25.525 23.875 15 25.650000000000002 25.775 23.7 24.875 16 26.474999999999998 23.275000000000002 23.45 26.8 17 26.150000000000002 26.450000000000003 23.075000000000003 24.325 18 25.3 24.85 25.15 24.7 19 26.55 24.075 24.75 24.625 20 26.400000000000002 24.75 23.474999999999998 25.374999999999996 21 25.35 24.775 23.95 25.924999999999997 22 25.3 23.425 25.35 25.924999999999997 23 26.200000000000003 25.275 24.075 24.45 24 25.724999999999998 24.25 24.725 25.3 25 26.775 24.224999999999998 24.0 25.0 26 26.075 24.975 23.625 25.324999999999996 27 24.525 23.925 26.575 24.975 28 25.724999999999998 23.825 25.650000000000002 24.8 29 26.0 25.5 23.974999999999998 24.525 30 25.724999999999998 25.05 25.5 23.724999999999998 31 25.724999999999998 23.75 25.724999999999998 24.8 32 26.0 25.45 24.125 24.425 33 26.5 24.25 25.1 24.15 34 24.775 25.974999999999998 24.25 25.0 35 26.125 26.05 23.974999999999998 23.849999999999998 36 25.05 25.75 26.125 23.075000000000003 37 25.924999999999997 24.375 24.825 24.875 38 26.275 25.424999999999997 23.875 24.425 39 24.8 25.55 25.35 24.3 40 26.375 25.55 24.15 23.925 41 26.700000000000003 25.424999999999997 22.75 25.124999999999996 42 25.324999999999996 26.3 24.474999999999998 23.9 43 26.025 24.0 24.95 25.025 44 27.075 25.674999999999997 23.849999999999998 23.400000000000002 45 25.525 25.724999999999998 25.7 23.05 46 26.700000000000003 24.925 25.025 23.35 47 26.450000000000003 25.05 23.95 24.55 48 25.45 25.174999999999997 26.05 23.325000000000003 49 26.700000000000003 23.849999999999998 25.2 24.25 50 25.775 25.374999999999996 25.025 23.825 51 24.875 24.6 26.125 24.4 52 25.85 24.825 24.625 24.7 53 28.1 25.6 23.875 22.425 54 25.324999999999996 27.400000000000002 24.8 22.475 55 26.875 23.925 25.724999999999998 23.474999999999998 56 27.525 26.450000000000003 22.875 23.150000000000002 57 25.624999999999996 25.374999999999996 24.725 24.275 58 26.174999999999997 25.324999999999996 23.825 24.675 59 26.625 25.174999999999997 24.775 23.425 60 25.974999999999998 25.124999999999996 25.75 23.150000000000002 61 27.33183295823956 24.5311327831958 25.406351587896975 22.73068267066767 62 25.056264066016503 25.756439109777446 25.206301575393848 23.980995248812203 63 25.756439109777446 25.756439109777446 25.331332833208304 23.15578894723681 64 27.28182045511378 25.581395348837212 24.406101525381345 22.73068267066767 65 26.088044022011005 25.11255627813907 24.912456228114056 23.88694347173587 66 25.319949811794228 25.84692597239649 25.345043914680048 23.488080301129237 67 26.897773279352226 25.0 24.493927125506072 23.6082995951417 68 26.853291861067913 23.302229134266458 25.246241575946087 24.598237428719543 69 25.719120135363788 19.289340101522843 27.918781725888326 27.072758037225043 70 28.587402161759222 0.0 37.08535221766679 34.32724562057398 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 1.5 26 2.0 27 2.0 28 3.0 29 10.0 30 16.0 31 16.0 32 18.0 33 20.0 34 33.0 35 65.0 36 98.5 37 113.0 38 113.5 39 134.0 40 154.0 41 193.0 42 247.0 43 262.0 44 257.0 45 262.0 46 269.5 47 267.0 48 253.5 49 231.0 50 222.0 51 199.5 52 185.5 53 194.0 54 184.5 55 161.0 56 144.5 57 142.0 58 124.5 59 114.0 60 121.0 61 106.5 62 81.0 63 70.0 64 79.0 65 75.0 66 69.0 67 76.0 68 64.5 69 53.0 70 53.0 71 48.5 72 35.5 73 27.0 74 23.0 75 13.5 76 8.0 77 8.0 78 8.0 79 5.0 80 2.0 81 1.0 82 1.5 83 3.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.375 67 1.2 68 3.55 69 11.35 70 32.925 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52165156092649 98.825 2 0.3776435045317221 0.75 3 0.050352467270896276 0.15 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025176233635448138 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322209 spots for ERR5052684.sra Written 322209 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra Read 322208 spots for ERR5052684.sra Written 322208 spots for ERR5052684.sra SRR ids: ['ERR5052684.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hjohbicx ERR5052684.sra spots: 6444161 blocks: [[1, 322208], [322209, 644416], [644417, 966624], [966625, 1288832], [1288833, 1611040], [1611041, 1933248], [1933249, 2255456], [2255457, 2577664], [2577665, 2899872], [2899873, 3222080], [3222081, 3544288], [3544289, 3866496], [3866497, 4188704], [4188705, 4510912], [4510913, 4833120], [4833121, 5155328], [5155329, 5477536], [5477537, 5799744], [5799745, 6121952], [6121953, 6444161]] ERR5052684 file size 1143179 ERR5052684 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052684 ERR5052684_1.fastq ERR5052684_2.fastq Input file: ERR5052684_1.fastq Paired file: ERR5052684_2.fastq trimmed: ERR5052684-trimmed-pair1.fastq, ERR5052684-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:23:21 2024 >> started Tue Dec 10 05:23:28 2024 >> done (6.861s) 6444161 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 31 ( 0.00%) empty read pairs filtered out after trimming by size control 6444130 (100.00%) read pairs available; of these: 22 ( 0.00%) trimmed read pairs available after processing 6444108 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 20 0.00% 70 6444108 100.00% 6444130 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=26 prefix-density=0.06 prefix-fanout=2.4 sequence=GTCGAAGTCGTACTTGTCCTCCTCATCTGGGTCCATCACCTGGACGAAGAGCTTCCACTCGGGGAAGTTGCCGGCGTCGATGGAGTCGTAGAGGTCCTGGGTGGCGTGGCTATGGTTCTTCCCGCCGACGAGCGTGGCCTCGTCGTCCATGAGGCAGCTGACCCCGCACGTGGGCTTCCAGTGGAACTTGACGTACTTGGACTTCCCTTCCCGTGTCACGAACGTGTAGGTGTTGACCCCGAAGCCTTCCATGTGGCGGTAATCGGTGGGGATGCCCACGTCATCAAACAAGAAGAAGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=218.53 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=22.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=29 prefix-density=0.35 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=269.53 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=18.5 sequence=GCGGCGGCGGCTACGGTGGCAGCCGTGGAGGCTCCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGT ERR5052684 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:24:00 Started mapping on | Dec 10 05:24:00 Finished on | Dec 10 05:24:18 Mapping speed, Million of reads per hour | 1288.83 Number of input reads | 6444130 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 6177951 Uniquely mapped reads % | 95.87% Average mapped length | 138.75 Number of splices: Total | 3074083 Number of splices: Annotated (sjdb) | 2922883 Number of splices: GT/AG | 3033984 Number of splices: GC/AG | 35450 Number of splices: AT/AC | 1554 Number of splices: Non-canonical | 3095 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 98864 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 14221 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 167315 167315 167315 N_multimapping 98864 98864 98864 N_noFeature 188205 6022881 226012 N_ambiguous 138350 576 21289 UnstrandedReadsAssigned:5851396 PositiveStrandReadsAssigned:154494 NegativeStrandReadsAssigned:5930650 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052684 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052684-trimmed-pair1.fastq ERR5052684-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,444,130 reads, 6,035,238 reads pseudoaligned [quant] estimated average fragment length: 187.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52973 ERR5052684.ke.tsv 35125 ERR5052684.se.tsv 88098 total ==> ERR5052684.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.13 28.5228 9.35318 PNS24247 1044 857.942 8.76582 2.51326 PNS24249 1928 1741.94 42.9811 6.06943 PNS24246 1044 857.942 8.76582 2.51326 PNS24248 1044 857.942 8.76582 2.51326 PNS24244 1471 1284.94 58.1986 11.1412 PNS24243 293 121.91 0 0 KQK14069 1603 1416.94 8211.22 1425.47 KQK14071 474 290.87 251.573 212.749 ==> ERR5052684.se.tsv <== BRADI_1g14170v3 9105 BRADI_1g53295v3 52 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 385 BRADI_1g74790v3 142 BRADI_1g09890v3 0 BRADI_1g77505v3 225 BRADI_1g48960v3 0 ERR5052684 completed mapping pipeline successfully