Starting /dee2/code/volunteer_pipeline.sh ERR5052685 current disk space = 1525833261056 free memory = 1595991496 ERR5052685 SRAfilesize 678e9c2388542f1479a4192156424814 ERR5052685.sra ERR5052685.sra file validated ERR5052685 is paired end ERR5052685 is conventional basespace ERR5052685 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052685_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.29525 35.0 35.0 35.0 35.0 35.0 2 34.59825 35.0 35.0 35.0 35.0 35.0 3 34.6545 35.0 35.0 35.0 35.0 35.0 4 34.70425 35.0 35.0 35.0 35.0 35.0 5 34.72625 35.0 35.0 35.0 35.0 35.0 6 39.5005 40.0 40.0 40.0 39.0 40.0 7 39.495 40.0 40.0 40.0 39.0 40.0 8 39.4055 40.0 40.0 40.0 39.0 40.0 9 39.4575 40.0 40.0 40.0 39.0 40.0 10 39.49675 40.0 40.0 40.0 39.0 40.0 11 39.46875 40.0 40.0 40.0 39.0 40.0 12 39.439 40.0 40.0 40.0 39.0 40.0 13 39.46925 40.0 40.0 40.0 39.0 40.0 14 39.4285 40.0 40.0 40.0 39.0 40.0 15 39.43525 40.0 40.0 40.0 39.0 40.0 16 39.46425 40.0 40.0 40.0 39.0 40.0 17 39.3545 40.0 40.0 40.0 39.0 40.0 18 39.40275 40.0 40.0 40.0 39.0 40.0 19 39.458 40.0 40.0 40.0 39.0 40.0 20 39.46325 40.0 40.0 40.0 39.0 40.0 21 39.4325 40.0 40.0 40.0 39.0 40.0 22 39.453 40.0 40.0 40.0 39.0 40.0 23 39.38725 40.0 40.0 40.0 39.0 40.0 24 39.412 40.0 40.0 40.0 39.0 40.0 25 39.417 40.0 40.0 40.0 39.0 40.0 26 39.38425 40.0 40.0 40.0 39.0 40.0 27 39.39325 40.0 40.0 40.0 39.0 40.0 28 39.367 40.0 40.0 40.0 39.0 40.0 29 39.30125 40.0 40.0 40.0 39.0 40.0 30 39.36625 40.0 40.0 40.0 39.0 40.0 31 39.378 40.0 40.0 40.0 39.0 40.0 32 39.40675 40.0 40.0 40.0 39.0 40.0 33 39.375 40.0 40.0 40.0 39.0 40.0 34 39.4165 40.0 40.0 40.0 39.0 40.0 35 39.39425 40.0 40.0 40.0 39.0 40.0 36 39.375 40.0 40.0 40.0 39.0 40.0 37 39.3355 40.0 40.0 40.0 39.0 40.0 38 39.30775 40.0 40.0 40.0 39.0 40.0 39 39.3485 40.0 40.0 40.0 39.0 40.0 40 39.3105 40.0 40.0 40.0 39.0 40.0 41 39.357 40.0 40.0 40.0 39.0 40.0 42 39.278 40.0 40.0 40.0 39.0 40.0 43 39.42275 40.0 40.0 40.0 39.0 40.0 44 39.35475 40.0 40.0 40.0 39.0 40.0 45 39.39275 40.0 40.0 40.0 39.0 40.0 46 39.314 40.0 40.0 40.0 39.0 40.0 47 39.2575 40.0 40.0 40.0 39.0 40.0 48 39.318 40.0 40.0 40.0 39.0 40.0 49 39.36275 40.0 40.0 40.0 39.0 40.0 50 39.40675 40.0 40.0 40.0 39.0 40.0 51 39.38075 40.0 40.0 40.0 39.0 40.0 52 39.37975 40.0 40.0 40.0 39.0 40.0 53 39.37475 40.0 40.0 40.0 39.0 40.0 54 39.39625 40.0 40.0 40.0 39.0 40.0 55 39.38275 40.0 40.0 40.0 39.0 40.0 56 39.36025 40.0 40.0 40.0 39.0 40.0 57 39.275 40.0 40.0 40.0 39.0 40.0 58 39.31075 40.0 40.0 40.0 39.0 40.0 59 39.35675 40.0 40.0 40.0 39.0 40.0 60 39.348 40.0 40.0 40.0 39.0 40.0 61 39.37325 40.0 40.0 40.0 39.0 40.0 62 39.3875 40.0 40.0 40.0 39.0 40.0 63 39.414 40.0 40.0 40.0 39.0 40.0 64 39.35675 40.0 40.0 40.0 39.0 40.0 65 39.3445 40.0 40.0 40.0 39.0 40.0 66 39.329 40.0 40.0 40.0 39.0 40.0 67 39.3465 40.0 40.0 40.0 39.0 40.0 68 39.3465 40.0 40.0 40.0 39.0 40.0 69 39.3365 40.0 40.0 40.0 39.0 40.0 70 39.369 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 5.0 27 6.0 28 9.0 29 13.0 30 21.0 31 25.0 32 25.0 33 27.0 34 36.0 35 47.0 36 80.0 37 82.0 38 227.0 39 3395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3877241727709 10.709775195756505 11.366506693609498 42.5359939378631 2 23.1615807903952 12.8064032016008 32.31615807903952 31.715857928964482 3 22.6 19.1 22.25 36.05 4 27.625 25.5 21.25 25.624999999999996 5 25.474999999999998 31.075000000000003 23.025000000000002 20.424999999999997 6 21.525 30.099999999999998 26.275 22.1 7 18.15 24.25 37.574999999999996 20.025000000000002 8 20.0 21.75 30.65 27.6 9 19.1 24.2 31.900000000000002 24.8 10 21.45 32.05 24.9 21.6 11 26.1 24.6 22.425 26.875 12 22.525000000000002 22.650000000000002 26.6 28.225 13 22.325 23.599999999999998 27.05 27.025 14 21.575 25.4 28.075 24.95 15 22.7 24.675 25.974999999999998 26.650000000000002 16 23.1 25.525 25.025 26.35 17 24.125 24.25 25.674999999999997 25.95 18 22.475 25.0 27.450000000000003 25.074999999999996 19 23.75 24.775 26.1 25.374999999999996 20 24.05 24.125 26.724999999999998 25.1 21 23.275000000000002 24.25 26.424999999999997 26.05 22 23.400000000000002 25.474999999999998 25.124999999999996 26.0 23 22.8 24.75 27.125 25.324999999999996 24 22.55 25.35 25.224999999999998 26.875 25 22.75 25.15 24.925 27.175 26 22.400000000000002 26.375 25.45 25.775 27 22.1 24.875 27.325 25.7 28 23.775 23.400000000000002 25.775 27.05 29 23.400000000000002 27.200000000000003 24.025 25.374999999999996 30 22.900000000000002 24.925 25.324999999999996 26.85 31 23.425 24.95 25.974999999999998 25.650000000000002 32 22.5 24.9 26.6 26.0 33 23.1 25.124999999999996 24.75 27.025 34 23.849999999999998 26.474999999999998 24.099999999999998 25.575 35 23.150000000000002 24.9 26.125 25.825 36 23.95 25.5 24.875 25.674999999999997 37 24.8 25.2 24.25 25.75 38 24.25 26.025 24.375 25.35 39 23.35 26.375 24.9 25.374999999999996 40 23.125 25.85 24.875 26.150000000000002 41 23.875 25.074999999999996 25.5 25.55 42 23.525 25.3 25.874999999999996 25.3 43 23.724999999999998 24.825 25.074999999999996 26.375 44 24.4 24.45 26.200000000000003 24.95 45 22.625 25.1 26.224999999999998 26.05 46 24.05 25.724999999999998 23.474999999999998 26.75 47 23.175 26.424999999999997 24.65 25.75 48 23.25 24.925 25.2 26.625 49 22.8 25.974999999999998 25.650000000000002 25.575 50 24.975 24.65 24.85 25.525 51 22.325 26.075 25.974999999999998 25.624999999999996 52 23.625 25.525 24.675 26.174999999999997 53 22.725 26.474999999999998 24.75 26.05 54 22.875 25.0 25.2 26.924999999999997 55 23.95 24.3 25.55 26.200000000000003 56 24.15 24.65 25.8 25.4 57 24.125 25.174999999999997 25.124999999999996 25.575 58 24.075 24.55 25.775 25.6 59 23.45 25.575 25.5 25.474999999999998 60 24.5 25.174999999999997 24.0 26.325 61 23.1 25.75 25.374999999999996 25.775 62 23.305826456614152 25.30632658164541 24.18104526131533 27.206801700425103 63 22.655663915978995 26.70667666916729 25.03125781445361 25.6064016004001 64 24.23105776444111 25.406351587896975 25.10627656914228 25.256314078519633 65 23.48087021755439 24.85621405351338 26.231557889472366 25.431357839459867 66 23.78689344672336 25.41270635317659 25.86293146573287 24.937468734367183 67 23.89937106918239 24.40251572327044 24.855345911949687 26.842767295597486 68 23.27431357454452 24.45470875032076 26.969463690017964 25.30151398511676 69 24.199288256227756 19.682452778538188 26.444018614837123 29.674240350396936 70 26.544789762340038 0.0 34.771480804387565 38.6837294332724 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 2.5 26 5.5 27 6.0 28 7.0 29 13.5 30 19.0 31 19.5 32 29.0 33 38.0 34 47.5 35 70.0 36 99.0 37 115.0 38 140.0 39 175.5 40 186.0 41 190.0 42 208.0 43 222.0 44 248.5 45 271.5 46 262.0 47 256.0 48 267.0 49 256.0 50 234.0 51 212.5 52 177.0 53 163.0 54 169.0 55 161.5 56 137.5 57 127.0 58 124.5 59 116.5 60 111.0 61 95.5 62 77.0 63 74.0 64 72.0 65 70.0 66 67.5 67 65.0 68 55.5 69 47.0 70 48.0 71 39.0 72 21.5 73 13.0 74 12.5 75 10.5 76 8.0 77 7.0 78 5.5 79 2.5 80 1.0 81 0.5 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0250000000000001 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.025 63 0.025 64 0.025 65 0.025 66 0.05 67 0.625 68 2.5749999999999997 69 8.674999999999999 70 31.624999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052685 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052685_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3975 35.0 35.0 35.0 33.0 35.0 2 34.2005 35.0 35.0 35.0 33.0 35.0 3 34.2735 35.0 35.0 35.0 33.0 35.0 4 34.296 35.0 35.0 35.0 34.0 35.0 5 34.20875 35.0 35.0 35.0 34.0 35.0 6 38.939 40.0 40.0 40.0 39.0 40.0 7 38.95125 40.0 40.0 40.0 39.0 40.0 8 38.83175 40.0 40.0 40.0 38.0 40.0 9 38.98375 40.0 40.0 40.0 39.0 40.0 10 38.85975 40.0 40.0 40.0 39.0 40.0 11 38.9515 40.0 40.0 40.0 39.0 40.0 12 39.0065 40.0 40.0 40.0 39.0 40.0 13 38.96525 40.0 40.0 40.0 39.0 40.0 14 38.8895 40.0 40.0 40.0 39.0 40.0 15 38.9815 40.0 40.0 40.0 39.0 40.0 16 38.96 40.0 40.0 40.0 39.0 40.0 17 38.92875 40.0 40.0 40.0 39.0 40.0 18 38.97225 40.0 40.0 40.0 39.0 40.0 19 38.8935 40.0 40.0 40.0 39.0 40.0 20 38.94175 40.0 40.0 40.0 39.0 40.0 21 39.00125 40.0 40.0 40.0 39.0 40.0 22 38.96025 40.0 40.0 40.0 39.0 40.0 23 38.964 40.0 40.0 40.0 39.0 40.0 24 38.99525 40.0 40.0 40.0 39.0 40.0 25 38.9515 40.0 40.0 40.0 39.0 40.0 26 38.98525 40.0 40.0 40.0 39.0 40.0 27 38.94175 40.0 40.0 40.0 39.0 40.0 28 38.951 40.0 40.0 40.0 39.0 40.0 29 38.98975 40.0 40.0 40.0 39.0 40.0 30 38.9045 40.0 40.0 40.0 39.0 40.0 31 38.986 40.0 40.0 40.0 39.0 40.0 32 38.983 40.0 40.0 40.0 39.0 40.0 33 38.9575 40.0 40.0 40.0 39.0 40.0 34 38.9945 40.0 40.0 40.0 39.0 40.0 35 38.9395 40.0 40.0 40.0 39.0 40.0 36 38.95775 40.0 40.0 40.0 39.0 40.0 37 38.83575 40.0 40.0 40.0 39.0 40.0 38 38.887 40.0 40.0 40.0 39.0 40.0 39 38.91725 40.0 40.0 40.0 39.0 40.0 40 38.9475 40.0 40.0 40.0 39.0 40.0 41 38.9045 40.0 40.0 40.0 39.0 40.0 42 38.939 40.0 40.0 40.0 39.0 40.0 43 38.851 40.0 40.0 40.0 39.0 40.0 44 38.8005 40.0 40.0 40.0 38.0 40.0 45 38.85925 40.0 40.0 40.0 39.0 40.0 46 38.893 40.0 40.0 40.0 38.0 40.0 47 38.8135 40.0 40.0 40.0 38.0 40.0 48 38.799 40.0 40.0 40.0 38.0 40.0 49 38.86125 40.0 40.0 40.0 38.0 40.0 50 38.87175 40.0 40.0 40.0 38.0 40.0 51 38.90975 40.0 40.0 40.0 39.0 40.0 52 38.7825 40.0 40.0 40.0 38.0 40.0 53 38.8555 40.0 40.0 40.0 38.0 40.0 54 38.80725 40.0 40.0 40.0 39.0 40.0 55 38.82975 40.0 40.0 40.0 38.0 40.0 56 38.8115 40.0 40.0 40.0 38.0 40.0 57 38.883 40.0 40.0 40.0 38.0 40.0 58 38.91275 40.0 40.0 40.0 38.0 40.0 59 38.833 40.0 40.0 40.0 39.0 40.0 60 38.85875 40.0 40.0 40.0 39.0 40.0 61 38.894 40.0 40.0 40.0 38.0 40.0 62 38.85975 40.0 40.0 40.0 38.0 40.0 63 38.7675 40.0 40.0 40.0 38.0 40.0 64 38.81425 40.0 40.0 40.0 38.0 40.0 65 38.80025 40.0 40.0 40.0 38.0 40.0 66 38.78525 40.0 40.0 40.0 38.0 40.0 67 38.89625 40.0 40.0 40.0 38.0 40.0 68 38.8065 40.0 40.0 40.0 38.0 40.0 69 38.8355 40.0 40.0 40.0 38.0 40.0 70 38.8225 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 4.0 19 9.0 20 15.0 21 15.0 22 22.0 23 20.0 24 11.0 25 16.0 26 11.0 27 10.0 28 17.0 29 15.0 30 16.0 31 21.0 32 21.0 33 15.0 34 32.0 35 39.0 36 58.0 37 98.0 38 218.0 39 3316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.7 17.5 14.85 33.95 2 28.625 23.75 27.325 20.3 3 22.2 24.675 27.650000000000002 25.474999999999998 4 27.725 28.625 21.15 22.5 5 28.125 34.725 18.825 18.325 6 24.093069802351764 31.998999249437077 20.915686765073804 22.992244183137352 7 22.25 19.175 34.35 24.224999999999998 8 23.474999999999998 22.375 25.624999999999996 28.525 9 23.7 23.225 27.6 25.474999999999998 10 27.025 29.599999999999998 21.075 22.3 11 28.95 22.95 19.675 28.425 12 27.275 22.05 24.175 26.5 13 25.85 24.75 25.1 24.3 14 26.275 26.400000000000002 24.05 23.275000000000002 15 26.125 26.174999999999997 23.599999999999998 24.099999999999998 16 26.174999999999997 25.275 24.325 24.224999999999998 17 26.6 25.25 24.099999999999998 24.05 18 25.95 25.5 23.225 25.324999999999996 19 26.25 24.15 24.175 25.424999999999997 20 27.175 26.075 22.725 24.025 21 25.825 25.35 23.9 24.925 22 26.200000000000003 25.8 24.2 23.799999999999997 23 26.674999999999997 25.674999999999997 23.200000000000003 24.45 24 25.374999999999996 25.174999999999997 24.575 24.875 25 25.674999999999997 25.874999999999996 24.775 23.674999999999997 26 25.974999999999998 25.6 24.725 23.7 27 25.374999999999996 25.324999999999996 24.9 24.4 28 26.25 23.575 25.2 24.975 29 26.025 26.150000000000002 22.475 25.35 30 25.8 25.575 25.1 23.525 31 26.25 24.975 23.724999999999998 25.05 32 26.35 26.1 23.775 23.775 33 25.374999999999996 25.3 24.95 24.375 34 25.85 23.9 25.474999999999998 24.775 35 25.3 25.674999999999997 24.675 24.349999999999998 36 25.650000000000002 25.45 24.8 24.099999999999998 37 25.224999999999998 25.624999999999996 24.975 24.175 38 26.75 24.975 24.05 24.224999999999998 39 24.9 25.4 24.275 25.424999999999997 40 25.025 24.875 24.25 25.85 41 26.450000000000003 24.6 25.05 23.9 42 26.0 25.6 24.025 24.375 43 26.450000000000003 24.575 23.45 25.525 44 25.45 24.45 25.224999999999998 24.875 45 25.924999999999997 25.05 25.174999999999997 23.849999999999998 46 26.8 24.025 24.325 24.85 47 26.325 24.875 24.85 23.95 48 26.3 25.124999999999996 25.275 23.3 49 26.875 24.375 24.725 24.025 50 26.224999999999998 25.874999999999996 23.525 24.375 51 25.3 25.525 25.474999999999998 23.7 52 26.05 23.599999999999998 24.325 26.025 53 26.025 26.950000000000003 23.9 23.125 54 25.15 25.974999999999998 25.15 23.724999999999998 55 25.674999999999997 26.200000000000003 23.1 25.025 56 26.900000000000002 26.05 23.175 23.875 57 27.075 25.124999999999996 25.3 22.5 58 25.3 25.5 25.424999999999997 23.775 59 26.224999999999998 25.3 25.074999999999996 23.400000000000002 60 26.8 24.45 24.4 24.349999999999998 61 26.200000000000003 23.125 25.900000000000002 24.775 62 26.581645411352838 25.331332833208304 24.706176544136035 23.380845211302827 63 26.131532883220803 25.03125781445361 24.90622655663916 23.93098274568642 64 25.53776888444222 25.162581290645324 24.937468734367183 24.362181090545274 65 26.089133700550825 25.237856785177765 24.336504757135703 24.336504757135703 66 24.874623871614844 25.752256770310932 24.5987963891675 24.77432296890672 67 28.326612903225808 23.336693548387096 24.773185483870968 23.563508064516128 68 26.768198244708312 23.618998451213216 24.651522973670627 24.96128033040785 69 25.64601278132815 20.17227007502084 27.53542650736316 26.646290636287855 70 26.858877086494687 0.0 37.2154779969651 35.925644916540215 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 1.0 25 2.0 26 4.5 27 5.0 28 6.0 29 9.5 30 12.0 31 15.0 32 25.0 33 32.0 34 39.5 35 62.0 36 97.0 37 117.0 38 117.0 39 132.5 40 148.0 41 176.0 42 230.5 43 257.0 44 256.0 45 262.0 46 264.5 47 260.0 48 253.5 49 236.5 50 226.0 51 216.0 52 188.5 53 171.0 54 164.0 55 149.5 56 132.0 57 122.0 58 116.0 59 116.0 60 122.0 61 110.0 62 89.0 63 80.0 64 80.5 65 80.5 66 79.0 67 78.0 68 72.0 69 60.5 70 55.0 71 47.5 72 35.0 73 30.0 74 29.5 75 19.0 76 8.5 77 8.0 78 6.5 79 3.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.025 63 0.025 64 0.05 65 0.15 66 0.3 67 0.8 68 3.15 69 10.025 70 34.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62292609351434 99.075 2 0.301659125188537 0.6 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025138260432378077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331929 spots for ERR5052685.sra Written 331929 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra Read 331914 spots for ERR5052685.sra Written 331914 spots for ERR5052685.sra SRR ids: ['ERR5052685.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jhemg6tn ERR5052685.sra spots: 6638295 blocks: [[1, 331914], [331915, 663828], [663829, 995742], [995743, 1327656], [1327657, 1659570], [1659571, 1991484], [1991485, 2323398], [2323399, 2655312], [2655313, 2987226], [2987227, 3319140], [3319141, 3651054], [3651055, 3982968], [3982969, 4314882], [4314883, 4646796], [4646797, 4978710], [4978711, 5310624], [5310625, 5642538], [5642539, 5974452], [5974453, 6306366], [6306367, 6638295]] ERR5052685 file size 1177684 ERR5052685 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052685 ERR5052685_1.fastq ERR5052685_2.fastq Input file: ERR5052685_1.fastq Paired file: ERR5052685_2.fastq trimmed: ERR5052685-trimmed-pair1.fastq, ERR5052685-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:23:31 2024 >> started Tue Dec 10 05:23:38 2024 >> done (6.460s) 6638295 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 47 ( 0.00%) empty read pairs filtered out after trimming by size control 6638248 (100.00%) read pairs available; of these: 26 ( 0.00%) trimmed read pairs available after processing 6638222 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 1 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 23 0.00% 70 6638222 100.00% 6638248 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=6.69 fanout-score-rank=15 prefix-density=0.18 prefix-fanout=2.2 sequence=TCTCGCCGAAGTTGCTGAAGGCGGACTGGAGGTTGTGGTCGTCGGTGGCCCAGGCGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=234.41 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=24.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=29 prefix-density=0.35 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=247.78 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=13.0 sequence=CGGCGGCGGCTACGGTGGCAGCCGTGGAGGCTCCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGT ERR5052685 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:24:09 Started mapping on | Dec 10 05:24:09 Finished on | Dec 10 05:24:27 Mapping speed, Million of reads per hour | 1327.65 Number of input reads | 6638248 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 6361054 Uniquely mapped reads % | 95.82% Average mapped length | 138.74 Number of splices: Total | 3170924 Number of splices: Annotated (sjdb) | 3015894 Number of splices: GT/AG | 3129717 Number of splices: GC/AG | 36499 Number of splices: AT/AC | 1507 Number of splices: Non-canonical | 3201 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101283 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 14511 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 175911 175911 175911 N_multimapping 101283 101283 101283 N_noFeature 194138 6200980 232774 N_ambiguous 142938 562 21687 UnstrandedReadsAssigned:6023978 PositiveStrandReadsAssigned:159512 NegativeStrandReadsAssigned:6106593 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052685 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052685-trimmed-pair1.fastq ERR5052685-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,638,248 reads, 6,217,129 reads pseudoaligned [quant] estimated average fragment length: 186.805 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52973 ERR5052685.ke.tsv 35125 ERR5052685.se.tsv 88098 total ==> ERR5052685.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.44 25.0593 7.9939 PNS24247 1044 858.195 20.7484 5.78768 PNS24249 1928 1742.2 22.415 3.07998 PNS24246 1044 858.195 20.7484 5.78768 PNS24248 1044 858.195 20.7484 5.78768 PNS24244 1471 1285.2 44.2805 8.24801 PNS24243 293 122.171 0 0 KQK14069 1603 1417.2 8317.05 1404.9 KQK14071 474 290.882 258.262 212.544 ==> ERR5052685.se.tsv <== BRADI_1g14170v3 9204 BRADI_1g53295v3 44 BRADI_1g59795v3 236 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 369 BRADI_1g74790v3 157 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 ERR5052685 completed mapping pipeline successfully