Starting /dee2/code/volunteer_pipeline.sh ERR5052686 current disk space = 1525943848960 free memory = 1560839552 ERR5052686 SRAfilesize c06066d2267d37df69c5b56c5bae402b ERR5052686.sra ERR5052686.sra file validated ERR5052686 is paired end ERR5052686 is conventional basespace ERR5052686 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052686_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.283 35.0 35.0 35.0 35.0 35.0 2 34.589 35.0 35.0 35.0 35.0 35.0 3 34.56625 35.0 35.0 35.0 34.0 35.0 4 34.6415 35.0 35.0 35.0 35.0 35.0 5 34.58825 35.0 35.0 35.0 35.0 35.0 6 39.3265 40.0 40.0 40.0 39.0 40.0 7 39.3835 40.0 40.0 40.0 39.0 40.0 8 39.382 40.0 40.0 40.0 39.0 40.0 9 39.43025 40.0 40.0 40.0 39.0 40.0 10 39.383 40.0 40.0 40.0 39.0 40.0 11 39.3895 40.0 40.0 40.0 39.0 40.0 12 39.33725 40.0 40.0 40.0 39.0 40.0 13 39.336 40.0 40.0 40.0 39.0 40.0 14 39.34275 40.0 40.0 40.0 39.0 40.0 15 39.339 40.0 40.0 40.0 39.0 40.0 16 39.2965 40.0 40.0 40.0 39.0 40.0 17 39.354 40.0 40.0 40.0 39.0 40.0 18 39.35375 40.0 40.0 40.0 39.0 40.0 19 39.36075 40.0 40.0 40.0 39.0 40.0 20 39.35575 40.0 40.0 40.0 39.0 40.0 21 39.325 40.0 40.0 40.0 39.0 40.0 22 39.3 40.0 40.0 40.0 39.0 40.0 23 39.32525 40.0 40.0 40.0 39.0 40.0 24 39.31825 40.0 40.0 40.0 39.0 40.0 25 39.37375 40.0 40.0 40.0 39.0 40.0 26 39.2985 40.0 40.0 40.0 39.0 40.0 27 39.27675 40.0 40.0 40.0 39.0 40.0 28 39.26825 40.0 40.0 40.0 39.0 40.0 29 39.31075 40.0 40.0 40.0 39.0 40.0 30 39.29125 40.0 40.0 40.0 39.0 40.0 31 39.26475 40.0 40.0 40.0 39.0 40.0 32 39.2635 40.0 40.0 40.0 39.0 40.0 33 39.2495 40.0 40.0 40.0 39.0 40.0 34 39.23875 40.0 40.0 40.0 39.0 40.0 35 39.24025 40.0 40.0 40.0 39.0 40.0 36 39.2325 40.0 40.0 40.0 39.0 40.0 37 39.2805 40.0 40.0 40.0 39.0 40.0 38 39.2095 40.0 40.0 40.0 39.0 40.0 39 39.2715 40.0 40.0 40.0 39.0 40.0 40 39.2845 40.0 40.0 40.0 39.0 40.0 41 39.22775 40.0 40.0 40.0 39.0 40.0 42 39.277 40.0 40.0 40.0 39.0 40.0 43 39.27625 40.0 40.0 40.0 39.0 40.0 44 39.30425 40.0 40.0 40.0 39.0 40.0 45 39.34125 40.0 40.0 40.0 39.0 40.0 46 39.31225 40.0 40.0 40.0 39.0 40.0 47 39.30125 40.0 40.0 40.0 39.0 40.0 48 39.29825 40.0 40.0 40.0 39.0 40.0 49 39.29575 40.0 40.0 40.0 39.0 40.0 50 39.25525 40.0 40.0 40.0 39.0 40.0 51 39.28175 40.0 40.0 40.0 39.0 40.0 52 39.27875 40.0 40.0 40.0 39.0 40.0 53 39.282 40.0 40.0 40.0 39.0 40.0 54 39.18675 40.0 40.0 40.0 39.0 40.0 55 39.258 40.0 40.0 40.0 39.0 40.0 56 39.27825 40.0 40.0 40.0 39.0 40.0 57 39.29475 40.0 40.0 40.0 39.0 40.0 58 39.145 40.0 40.0 40.0 39.0 40.0 59 39.09025 40.0 40.0 40.0 39.0 40.0 60 39.23925 40.0 40.0 40.0 39.0 40.0 61 39.18825 40.0 40.0 40.0 39.0 40.0 62 39.21725 40.0 40.0 40.0 39.0 40.0 63 39.25575 40.0 40.0 40.0 39.0 40.0 64 39.2575 40.0 40.0 40.0 39.0 40.0 65 39.26425 40.0 40.0 40.0 39.0 40.0 66 39.222 40.0 40.0 40.0 39.0 40.0 67 39.248 40.0 40.0 40.0 39.0 40.0 68 39.266 40.0 40.0 40.0 39.0 40.0 69 39.26825 40.0 40.0 40.0 39.0 40.0 70 39.215 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 4.0 27 7.0 28 14.0 29 18.0 30 24.0 31 21.0 32 31.0 33 31.0 34 45.0 35 65.0 36 65.0 37 120.0 38 229.0 39 3322.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.36554515557804 11.9908929926638 11.9908929926638 40.65266885909436 2 22.825 15.225 30.375000000000004 31.574999999999996 3 21.05 19.950000000000003 24.375 34.625 4 26.1 26.1 20.825 26.974999999999998 5 24.4 31.3 23.1 21.2 6 21.125 28.825 26.8 23.25 7 18.175 23.549999999999997 36.449999999999996 21.825 8 20.025000000000002 22.35 31.474999999999998 26.150000000000002 9 20.25 23.400000000000002 31.3 25.05 10 23.0 31.874999999999996 22.1 23.025000000000002 11 25.05 23.425 22.5 29.025000000000002 12 23.400000000000002 22.650000000000002 26.375 27.575 13 22.875 24.2 27.375 25.55 14 22.3 24.125 27.275 26.3 15 23.025000000000002 24.675 24.5 27.800000000000004 16 23.799999999999997 24.55 25.8 25.85 17 24.725 23.95 24.625 26.700000000000003 18 24.175 23.549999999999997 25.7 26.575 19 24.15 25.825 24.45 25.575 20 23.225 25.424999999999997 25.974999999999998 25.374999999999996 21 23.275000000000002 25.174999999999997 26.224999999999998 25.324999999999996 22 23.575 24.9 25.424999999999997 26.1 23 23.674999999999997 24.375 25.275 26.674999999999997 24 22.8 25.924999999999997 25.95 25.324999999999996 25 24.125 24.275 24.45 27.150000000000002 26 22.475 26.700000000000003 24.575 26.25 27 22.825 24.55 25.474999999999998 27.150000000000002 28 25.124999999999996 24.224999999999998 24.75 25.900000000000002 29 22.675 25.2 25.45 26.674999999999997 30 24.275 24.6 25.374999999999996 25.75 31 22.75 25.25 25.224999999999998 26.775 32 23.7 26.35 25.624999999999996 24.325 33 23.599999999999998 24.05 25.35 27.0 34 23.974999999999998 23.425 26.55 26.05 35 23.825 24.474999999999998 25.474999999999998 26.224999999999998 36 23.125 24.349999999999998 25.275 27.250000000000004 37 23.9 25.8 24.525 25.775 38 22.925 26.05 25.4 25.624999999999996 39 23.325000000000003 25.8 24.7 26.174999999999997 40 24.425 24.075 24.975 26.525 41 23.225 25.0 25.775 26.0 42 23.375 25.974999999999998 24.375 26.275 43 24.349999999999998 24.5 23.45 27.700000000000003 44 23.474999999999998 25.324999999999996 24.725 26.474999999999998 45 23.1 24.4 25.724999999999998 26.775 46 24.05 25.575 23.7 26.674999999999997 47 22.400000000000002 24.75 26.674999999999997 26.174999999999997 48 23.775 24.7 25.650000000000002 25.874999999999996 49 24.425 23.849999999999998 24.9 26.825 50 24.474999999999998 25.650000000000002 24.825 25.05 51 22.875 25.05 25.4 26.674999999999997 52 23.80595148787197 25.28132033008252 24.981245311327832 25.93148287071768 53 24.281070267566893 25.28132033008252 24.15603900975244 26.281570392598148 54 23.20580145036259 24.256064016004 25.30632658164541 27.231807951987996 55 24.706176544136035 24.706176544136035 24.406101525381345 26.18154538634659 56 24.15603900975244 24.256064016004 25.55638909727432 26.03150787696924 57 24.10602650662666 24.10602650662666 25.256314078519633 26.531632908227053 58 23.030757689422355 25.78144536134033 24.131032758189548 27.056764191047762 59 22.980745186296573 25.056264066016503 24.8062015503876 27.156789197299325 60 23.95598899724931 25.55638909727432 24.731182795698924 25.756439109777446 61 24.16208104052026 25.46273136568284 23.761880940470235 26.613306653326664 62 23.736868434217108 24.562281140570285 25.56278139069535 26.138069034517258 63 23.23661830915458 23.81190595297649 25.812906453226613 27.138569284642323 64 23.81190595297649 24.787393696848426 25.41270635317659 25.987993996998497 65 24.23711855927964 24.96248124062031 24.662331165582792 26.138069034517258 66 24.01101652478718 25.237856785177765 24.812218327491237 25.938908362543817 67 23.907584128578605 25.18834756403817 25.26368658965344 25.64038171772978 68 23.395551009971875 23.242137560726157 25.97801073894145 27.38430069036052 69 23.698630136986303 20.191780821917806 27.36986301369863 28.73972602739726 70 25.82417582417583 0.0 35.714285714285715 38.46153846153847 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 0.5 26 4.5 27 8.0 28 9.0 29 10.0 30 10.0 31 20.0 32 34.5 33 39.0 34 44.5 35 66.5 36 96.0 37 109.0 38 116.5 39 156.5 40 189.0 41 193.5 42 224.5 43 251.0 44 249.0 45 264.0 46 272.0 47 263.0 48 260.5 49 226.5 50 195.0 51 200.0 52 197.0 53 189.0 54 176.5 55 152.0 56 128.0 57 116.0 58 113.5 59 98.0 60 85.0 61 95.0 62 95.5 63 86.0 64 85.0 65 80.5 66 75.5 67 74.0 68 66.5 69 50.5 70 42.0 71 40.0 72 32.0 73 26.0 74 23.0 75 16.0 76 8.0 77 4.0 78 6.0 79 5.0 80 2.0 81 3.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.05 62 0.05 63 0.05 64 0.05 65 0.05 66 0.15 67 0.44999999999999996 68 2.225 69 8.75 70 31.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052686 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052686_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.25375 35.0 35.0 35.0 33.0 35.0 2 34.0355 35.0 35.0 35.0 32.0 35.0 3 34.201 35.0 35.0 35.0 33.0 35.0 4 34.209 35.0 35.0 35.0 33.0 35.0 5 34.1755 35.0 35.0 35.0 33.0 35.0 6 38.90175 40.0 40.0 40.0 38.0 40.0 7 38.81825 40.0 40.0 40.0 38.0 40.0 8 38.8265 40.0 40.0 40.0 38.0 40.0 9 38.825 40.0 40.0 40.0 38.0 40.0 10 38.85975 40.0 40.0 40.0 38.0 40.0 11 38.842 40.0 40.0 40.0 38.0 40.0 12 38.93 40.0 40.0 40.0 38.0 40.0 13 38.884 40.0 40.0 40.0 39.0 40.0 14 38.82825 40.0 40.0 40.0 38.0 40.0 15 38.80875 40.0 40.0 40.0 38.0 40.0 16 38.8925 40.0 40.0 40.0 38.0 40.0 17 38.82525 40.0 40.0 40.0 39.0 40.0 18 38.927 40.0 40.0 40.0 39.0 40.0 19 38.872 40.0 40.0 40.0 39.0 40.0 20 38.85425 40.0 40.0 40.0 38.0 40.0 21 38.85275 40.0 40.0 40.0 38.0 40.0 22 38.8595 40.0 40.0 40.0 38.0 40.0 23 38.90025 40.0 40.0 40.0 38.0 40.0 24 38.9175 40.0 40.0 40.0 38.0 40.0 25 38.87275 40.0 40.0 40.0 38.0 40.0 26 38.86475 40.0 40.0 40.0 38.0 40.0 27 38.8905 40.0 40.0 40.0 39.0 40.0 28 38.939 40.0 40.0 40.0 38.0 40.0 29 38.909 40.0 40.0 40.0 38.0 40.0 30 38.842 40.0 40.0 40.0 38.0 40.0 31 38.8445 40.0 40.0 40.0 38.0 40.0 32 38.84625 40.0 40.0 40.0 38.0 40.0 33 38.9355 40.0 40.0 40.0 38.0 40.0 34 38.87275 40.0 40.0 40.0 38.0 40.0 35 38.83925 40.0 40.0 40.0 38.0 40.0 36 38.7905 40.0 40.0 40.0 38.0 40.0 37 38.80625 40.0 40.0 40.0 38.0 40.0 38 38.8065 40.0 40.0 40.0 38.0 40.0 39 38.749 40.0 40.0 40.0 38.0 40.0 40 38.767 40.0 40.0 40.0 38.0 40.0 41 38.74975 40.0 40.0 40.0 38.0 40.0 42 38.82975 40.0 40.0 40.0 38.0 40.0 43 38.79625 40.0 40.0 40.0 38.0 40.0 44 38.803 40.0 40.0 40.0 38.0 40.0 45 38.87025 40.0 40.0 40.0 38.0 40.0 46 38.81575 40.0 40.0 40.0 38.0 40.0 47 38.77975 40.0 40.0 40.0 38.0 40.0 48 38.72 40.0 40.0 40.0 38.0 40.0 49 38.76075 40.0 40.0 40.0 38.0 40.0 50 38.8325 40.0 40.0 40.0 38.0 40.0 51 38.73825 40.0 40.0 40.0 38.0 40.0 52 38.58425 40.0 40.0 40.0 37.0 40.0 53 38.70775 40.0 40.0 40.0 37.0 40.0 54 38.70075 40.0 40.0 40.0 37.0 40.0 55 38.7885 40.0 40.0 40.0 38.0 40.0 56 38.69675 40.0 40.0 40.0 38.0 40.0 57 38.69625 40.0 40.0 40.0 37.0 40.0 58 38.76975 40.0 40.0 40.0 38.0 40.0 59 38.757 40.0 40.0 40.0 37.0 40.0 60 38.74175 40.0 40.0 40.0 38.0 40.0 61 38.761 40.0 40.0 40.0 38.0 40.0 62 38.762 40.0 40.0 40.0 38.0 40.0 63 38.6375 40.0 40.0 40.0 37.0 40.0 64 38.65275 40.0 40.0 40.0 37.0 40.0 65 38.7475 40.0 40.0 40.0 37.0 40.0 66 38.61875 40.0 40.0 40.0 37.0 40.0 67 38.65825 40.0 40.0 40.0 37.0 40.0 68 38.62525 40.0 40.0 40.0 37.0 40.0 69 38.7795 40.0 40.0 40.0 38.0 40.0 70 38.61175 40.0 40.0 40.0 37.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 7.0 19 13.0 20 13.0 21 7.0 22 18.0 23 12.0 24 18.0 25 11.0 26 15.0 27 16.0 28 16.0 29 17.0 30 21.0 31 23.0 32 15.0 33 36.0 34 44.0 35 58.0 36 63.0 37 120.0 38 248.0 39 3206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15 18.125 15.225 31.5 2 30.425 24.675 24.025 20.875 3 23.325000000000003 24.7 27.975 24.0 4 27.675 29.15 20.525 22.650000000000002 5 27.800000000000004 33.35 19.875 18.975 6 23.05 32.25 22.7 22.0 7 23.35 19.175 32.6 24.875 8 25.85 21.05 24.5 28.599999999999998 9 24.425 22.925 26.25 26.400000000000002 10 25.1 29.45 22.15 23.3 11 28.749999999999996 23.025000000000002 20.7 27.525 12 26.424999999999997 22.1 25.650000000000002 25.825 13 25.674999999999997 23.375 25.4 25.55 14 25.974999999999998 24.7 23.35 25.974999999999998 15 25.45 25.474999999999998 24.775 24.3 16 26.974999999999998 24.275 24.4 24.349999999999998 17 25.775 25.974999999999998 24.15 24.099999999999998 18 26.1 25.674999999999997 23.7 24.525 19 26.075 24.8 22.95 26.174999999999997 20 26.674999999999997 24.7 24.9 23.724999999999998 21 25.0 25.025 24.425 25.55 22 25.074999999999996 25.6 24.7 24.625 23 27.675 25.45 23.95 22.925 24 25.124999999999996 24.05 25.525 25.3 25 25.525 25.074999999999996 25.074999999999996 24.325 26 25.75 25.624999999999996 24.65 23.974999999999998 27 25.275 24.6 24.8 25.324999999999996 28 26.325 24.95 25.4 23.325000000000003 29 26.025 25.650000000000002 23.724999999999998 24.6 30 25.224999999999998 26.400000000000002 24.825 23.549999999999997 31 26.325 24.075 24.775 24.825 32 27.05 24.925 23.65 24.375 33 25.2 24.925 24.075 25.8 34 26.700000000000003 24.3 24.099999999999998 24.9 35 26.8 26.025 22.825 24.349999999999998 36 25.45 26.025 25.5 23.025000000000002 37 26.950000000000003 24.3 23.925 24.825 38 26.125 24.725 24.05 25.1 39 25.474999999999998 25.525 24.95 24.05 40 25.575 24.175 24.275 25.974999999999998 41 26.375 25.275 23.65 24.7 42 24.825 26.625 23.875 24.675 43 26.974999999999998 24.3 24.725 24.0 44 26.224999999999998 26.25 22.875 24.65 45 25.95 24.875 24.275 24.9 46 27.55 25.224999999999998 23.625 23.599999999999998 47 26.775 25.624999999999996 24.15 23.45 48 24.975 24.55 25.474999999999998 25.0 49 27.05 23.575 25.775 23.599999999999998 50 26.55 25.35 24.125 23.974999999999998 51 26.375 24.5 25.324999999999996 23.799999999999997 52 27.156789197299325 22.58064516129032 25.10627656914228 25.156289072268066 53 26.831707926981746 23.78094523630908 25.93148287071768 23.455863965991497 54 26.056514128532132 24.58114528632158 25.431357839459867 23.93098274568642 55 26.881720430107524 24.981245311327832 23.755938984746187 24.381095273818453 56 25.881470367591895 26.106526631657918 24.20605151287822 23.80595148787197 57 25.156289072268066 24.681170292573142 25.23130782695674 24.93123280820205 58 26.806701675418854 24.131032758189548 25.03125781445361 24.031007751937985 59 27.131782945736433 23.605901475368842 25.156289072268066 24.10602650662666 60 25.656414103525883 25.156289072268066 25.506376594148538 23.680920230057513 61 26.638319159579787 24.712356178089045 23.43671835917959 25.212606303151574 62 26.76338169084542 23.88694347173587 25.162581290645324 24.187093546773387 63 25.48774387193597 24.23711855927964 25.437718859429715 24.83741870935468 64 26.663331665832917 23.986993496748372 24.287143571785894 25.062531265632813 65 27.688844422211105 24.212106053026513 24.23711855927964 23.861930965482742 66 25.231771485843147 24.129290904535207 26.48459032823854 24.154347281383114 67 27.368951612903224 23.538306451612904 25.327620967741936 23.765120967741936 68 26.606683804627252 24.344473007712082 25.809768637532134 23.239074550128535 69 26.003877042370533 18.582110218775963 27.88701190805871 27.527000830794794 70 29.71976401179941 0.0 35.91445427728613 34.365781710914455 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 1.5 20 2.0 21 1.0 22 2.0 23 4.0 24 3.0 25 2.0 26 3.5 27 5.0 28 4.0 29 8.0 30 13.0 31 16.0 32 20.0 33 21.0 34 33.0 35 63.0 36 92.5 37 104.0 38 121.5 39 147.0 40 155.0 41 186.5 42 222.5 43 227.0 44 229.0 45 245.5 46 248.5 47 237.0 48 252.5 49 256.0 50 244.0 51 208.0 52 168.5 53 165.0 54 172.5 55 158.5 56 132.0 57 127.0 58 124.0 59 113.5 60 106.0 61 110.0 62 98.5 63 83.0 64 87.5 65 91.0 66 84.0 67 78.0 68 67.5 69 51.0 70 45.0 71 41.0 72 37.0 73 37.0 74 34.0 75 21.5 76 14.0 77 16.0 78 11.5 79 7.0 80 7.0 81 4.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.05 62 0.05 63 0.05 64 0.05 65 0.05 66 0.22499999999999998 67 0.8 68 2.75 69 9.725 70 32.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39516129032258 98.6 2 0.5040322580645161 1.0 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217507 spots for ERR5052686.sra Written 217507 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra Read 217491 spots for ERR5052686.sra Written 217491 spots for ERR5052686.sra SRR ids: ['ERR5052686.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uvwxdufq ERR5052686.sra spots: 4349836 blocks: [[1, 217491], [217492, 434982], [434983, 652473], [652474, 869964], [869965, 1087455], [1087456, 1304946], [1304947, 1522437], [1522438, 1739928], [1739929, 1957419], [1957420, 2174910], [2174911, 2392401], [2392402, 2609892], [2609893, 2827383], [2827384, 3044874], [3044875, 3262365], [3262366, 3479856], [3479857, 3697347], [3697348, 3914838], [3914839, 4132329], [4132330, 4349836]] ERR5052686 file size 770946 ERR5052686 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052686 ERR5052686_1.fastq ERR5052686_2.fastq Input file: ERR5052686_1.fastq Paired file: ERR5052686_2.fastq trimmed: ERR5052686-trimmed-pair1.fastq, ERR5052686-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:29:08 2024 >> started Tue Dec 10 05:29:12 2024 >> done (3.909s) 4349836 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 28 ( 0.00%) empty read pairs filtered out after trimming by size control 4349808 (100.00%) read pairs available; of these: 11 ( 0.00%) trimmed read pairs available after processing 4349797 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 53 1 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 9 0.00% 70 4349797 100.00% 4349808 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=26 prefix-density=0.17 prefix-fanout=2.1 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=284.46 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=25.7 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=28 prefix-density=0.30 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=270.52 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=20.3 sequence=CGCCGCCGCCTCC ERR5052686 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:29:43 Started mapping on | Dec 10 05:29:43 Finished on | Dec 10 05:29:56 Mapping speed, Million of reads per hour | 1204.56 Number of input reads | 4349808 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4148680 Uniquely mapped reads % | 95.38% Average mapped length | 138.75 Number of splices: Total | 2053721 Number of splices: Annotated (sjdb) | 1956508 Number of splices: GT/AG | 2026873 Number of splices: GC/AG | 23776 Number of splices: AT/AC | 1066 Number of splices: Non-canonical | 2006 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 61434 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 9121 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 139694 139694 139694 N_multimapping 61434 61434 61434 N_noFeature 112799 4051423 137487 N_ambiguous 86347 334 13880 UnstrandedReadsAssigned:3949534 PositiveStrandReadsAssigned:96923 NegativeStrandReadsAssigned:3997313 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052686 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052686-trimmed-pair1.fastq ERR5052686-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,349,808 reads, 4,087,594 reads pseudoaligned [quant] estimated average fragment length: 185.038 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 980 rounds 52973 ERR5052686.ke.tsv 35125 ERR5052686.se.tsv 88098 total ==> ERR5052686.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.277 17.7143 8.58449 PNS24247 1044 859.962 10.2952 4.36441 PNS24249 1928 1743.96 34.5961 7.23201 PNS24246 1044 859.962 10.2952 4.36441 PNS24248 1044 859.962 10.2952 4.36441 PNS24244 1471 1286.96 34.8039 9.85894 PNS24243 293 123.156 0 0 KQK14069 1603 1418.96 6036.74 1550.96 KQK14071 474 292.615 160.039 199.387 ==> ERR5052686.se.tsv <== BRADI_1g14170v3 6616 BRADI_1g53295v3 36 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 220 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 104 BRADI_1g48960v3 0 ERR5052686 completed mapping pipeline successfully