Starting /dee2/code/volunteer_pipeline.sh ERR5052687 current disk space = 1525906448384 free memory = 1559845736 ERR5052687 SRAfilesize 29a47e931ec23180572f5e45b7cc53bd ERR5052687.sra ERR5052687.sra file validated ERR5052687 is paired end ERR5052687 is conventional basespace ERR5052687 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052687_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.45025 35.0 35.0 35.0 35.0 35.0 2 34.619 35.0 35.0 35.0 35.0 35.0 3 34.66225 35.0 35.0 35.0 35.0 35.0 4 34.6235 35.0 35.0 35.0 35.0 35.0 5 34.67775 35.0 35.0 35.0 35.0 35.0 6 39.41875 40.0 40.0 40.0 39.0 40.0 7 39.4305 40.0 40.0 40.0 39.0 40.0 8 39.39625 40.0 40.0 40.0 39.0 40.0 9 39.36725 40.0 40.0 40.0 39.0 40.0 10 39.396 40.0 40.0 40.0 39.0 40.0 11 39.38625 40.0 40.0 40.0 39.0 40.0 12 39.371 40.0 40.0 40.0 39.0 40.0 13 39.3665 40.0 40.0 40.0 39.0 40.0 14 39.3565 40.0 40.0 40.0 39.0 40.0 15 39.39175 40.0 40.0 40.0 39.0 40.0 16 39.3505 40.0 40.0 40.0 39.0 40.0 17 39.32575 40.0 40.0 40.0 39.0 40.0 18 39.3225 40.0 40.0 40.0 39.0 40.0 19 39.32075 40.0 40.0 40.0 39.0 40.0 20 39.35625 40.0 40.0 40.0 39.0 40.0 21 39.321 40.0 40.0 40.0 39.0 40.0 22 39.34025 40.0 40.0 40.0 39.0 40.0 23 39.2385 40.0 40.0 40.0 39.0 40.0 24 39.327 40.0 40.0 40.0 39.0 40.0 25 39.308 40.0 40.0 40.0 39.0 40.0 26 39.2965 40.0 40.0 40.0 39.0 40.0 27 39.26975 40.0 40.0 40.0 39.0 40.0 28 39.345 40.0 40.0 40.0 39.0 40.0 29 39.26925 40.0 40.0 40.0 39.0 40.0 30 39.34875 40.0 40.0 40.0 39.0 40.0 31 39.27025 40.0 40.0 40.0 39.0 40.0 32 39.3145 40.0 40.0 40.0 39.0 40.0 33 39.27575 40.0 40.0 40.0 39.0 40.0 34 39.37025 40.0 40.0 40.0 39.0 40.0 35 39.274 40.0 40.0 40.0 39.0 40.0 36 39.299 40.0 40.0 40.0 39.0 40.0 37 39.30775 40.0 40.0 40.0 39.0 40.0 38 39.26075 40.0 40.0 40.0 39.0 40.0 39 39.2385 40.0 40.0 40.0 39.0 40.0 40 39.31875 40.0 40.0 40.0 39.0 40.0 41 39.24575 40.0 40.0 40.0 39.0 40.0 42 39.288 40.0 40.0 40.0 39.0 40.0 43 39.34075 40.0 40.0 40.0 39.0 40.0 44 39.28475 40.0 40.0 40.0 39.0 40.0 45 39.2925 40.0 40.0 40.0 39.0 40.0 46 39.26425 40.0 40.0 40.0 39.0 40.0 47 39.2125 40.0 40.0 40.0 39.0 40.0 48 39.2475 40.0 40.0 40.0 39.0 40.0 49 39.2715 40.0 40.0 40.0 39.0 40.0 50 39.302 40.0 40.0 40.0 39.0 40.0 51 39.21875 40.0 40.0 40.0 39.0 40.0 52 39.236 40.0 40.0 40.0 39.0 40.0 53 39.24325 40.0 40.0 40.0 39.0 40.0 54 39.31075 40.0 40.0 40.0 39.0 40.0 55 39.2945 40.0 40.0 40.0 39.0 40.0 56 39.224 40.0 40.0 40.0 39.0 40.0 57 39.1495 40.0 40.0 40.0 39.0 40.0 58 39.13325 40.0 40.0 40.0 39.0 40.0 59 39.218 40.0 40.0 40.0 39.0 40.0 60 39.23025 40.0 40.0 40.0 39.0 40.0 61 39.19725 40.0 40.0 40.0 39.0 40.0 62 39.1925 40.0 40.0 40.0 39.0 40.0 63 39.23075 40.0 40.0 40.0 39.0 40.0 64 39.22175 40.0 40.0 40.0 39.0 40.0 65 39.1845 40.0 40.0 40.0 39.0 40.0 66 39.23775 40.0 40.0 40.0 39.0 40.0 67 39.29775 40.0 40.0 40.0 39.0 40.0 68 39.23975 40.0 40.0 40.0 39.0 40.0 69 39.20775 40.0 40.0 40.0 39.0 40.0 70 39.18625 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 6.0 26 5.0 27 11.0 28 12.0 29 8.0 30 19.0 31 19.0 32 22.0 33 37.0 34 51.0 35 71.0 36 64.0 37 116.0 38 241.0 39 3315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.61732124874119 12.789526686807653 12.613293051359516 39.97985901309164 2 22.75 14.549999999999999 30.325000000000003 32.375 3 21.25 20.974999999999998 23.025000000000002 34.75 4 25.8 26.224999999999998 22.475 25.5 5 25.974999999999998 30.9 22.5 20.625 6 21.625 29.4 26.200000000000003 22.775000000000002 7 17.925 23.175 37.824999999999996 21.075 8 20.3 22.95 28.675 28.075 9 19.400000000000002 23.95 32.05 24.6 10 22.25 31.5 23.225 23.025000000000002 11 24.625 23.549999999999997 22.8 29.025000000000002 12 22.6 21.3 26.724999999999998 29.375 13 23.325000000000003 24.099999999999998 26.775 25.8 14 23.025000000000002 25.1 26.575 25.3 15 21.975 24.4 26.474999999999998 27.150000000000002 16 22.925 24.95 25.45 26.674999999999997 17 22.825 25.025 26.775 25.374999999999996 18 23.525 24.6 24.85 27.025 19 23.849999999999998 25.0 25.674999999999997 25.474999999999998 20 23.5 25.674999999999997 26.1 24.725 21 23.75 25.724999999999998 25.374999999999996 25.15 22 23.125 26.1 25.025 25.75 23 22.575 26.5 25.05 25.874999999999996 24 22.675 25.674999999999997 26.224999999999998 25.424999999999997 25 22.45 24.575 25.95 27.025 26 23.3 25.374999999999996 26.5 24.825 27 23.150000000000002 23.474999999999998 25.474999999999998 27.900000000000002 28 23.674999999999997 25.275 25.3 25.75 29 22.0 25.324999999999996 25.55 27.125 30 23.175 24.349999999999998 25.324999999999996 27.150000000000002 31 23.35 25.4 25.924999999999997 25.324999999999996 32 23.275000000000002 24.65 25.3 26.775 33 22.625 25.775 26.075 25.525 34 24.5 25.2 23.599999999999998 26.700000000000003 35 23.05 25.324999999999996 26.125 25.5 36 22.325 25.3 25.15 27.224999999999998 37 23.9 25.05 24.349999999999998 26.700000000000003 38 22.575 24.325 26.174999999999997 26.924999999999997 39 22.525000000000002 26.0 26.150000000000002 25.324999999999996 40 23.849999999999998 25.324999999999996 23.875 26.950000000000003 41 22.650000000000002 25.85 25.825 25.674999999999997 42 22.975 25.525 25.8 25.7 43 23.05 23.75 25.7 27.500000000000004 44 23.825 23.599999999999998 24.675 27.900000000000002 45 22.650000000000002 25.55 26.075 25.724999999999998 46 24.3 25.374999999999996 24.55 25.775 47 24.95 25.1 24.2 25.75 48 22.75 25.05 26.5 25.7 49 23.95 23.875 26.0 26.174999999999997 50 23.25 24.55 26.150000000000002 26.05 51 23.45 24.025 25.724999999999998 26.8 52 24.95 25.074999999999996 23.925 26.05 53 24.55 24.55 26.174999999999997 24.725 54 24.25 25.174999999999997 24.875 25.7 55 23.474999999999998 26.25 24.725 25.55 56 24.2 24.75 25.45 25.6 57 23.53088272068017 24.981245311327832 25.6064016004001 25.881470367591895 58 23.58089522380595 24.831207801950487 24.981245311327832 26.60665166291573 59 23.080770192548137 25.681420355088775 25.006251562890725 26.231557889472366 60 22.930732683170792 25.18129532383096 25.806451612903224 26.081520380095025 61 24.431107776944234 25.831457864466117 24.006001500375092 25.731432858214554 62 24.706176544136035 24.006001500375092 25.85646411602901 25.431357839459867 63 22.686343171585793 24.512256128064035 25.26263131565783 27.538769384692348 64 23.911955977988995 24.562281140570285 25.587793896948476 25.937968984492244 65 23.1981981981982 24.94994994994995 26.276276276276278 25.575575575575577 66 23.22144288577154 24.19839679358717 25.651302605210418 26.92885771543086 67 24.86118122160525 24.129227662796566 24.785461887935387 26.224129227662797 68 24.427284427284427 25.122265122265127 24.89060489060489 25.559845559845563 69 22.470978441127695 21.006080707573243 27.998894416804866 28.524046434494192 70 25.579683474420317 0.0 36.73168936326831 37.68862716231137 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 3.0 27 5.0 28 6.0 29 8.5 30 10.0 31 16.5 32 33.0 33 43.0 34 56.5 35 75.5 36 98.0 37 115.0 38 126.5 39 157.0 40 176.0 41 216.5 42 238.0 43 219.0 44 231.5 45 275.5 46 277.0 47 247.0 48 237.0 49 233.5 50 240.0 51 223.0 52 196.0 53 186.0 54 171.0 55 149.5 56 130.5 57 118.0 58 104.5 59 94.0 60 97.0 61 95.5 62 84.5 63 75.0 64 77.0 65 78.0 66 73.5 67 70.0 68 60.5 69 46.5 70 42.0 71 39.5 72 29.5 73 22.0 74 16.5 75 11.5 76 7.5 77 3.0 78 5.0 79 7.0 80 7.0 81 4.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.05 64 0.05 65 0.1 66 0.2 67 0.95 68 2.875 69 9.55 70 32.074999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052687 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052687_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.27 35.0 35.0 35.0 33.0 35.0 2 34.088 35.0 35.0 35.0 32.0 35.0 3 34.1295 35.0 35.0 35.0 33.0 35.0 4 34.07325 35.0 35.0 35.0 33.0 35.0 5 34.05925 35.0 35.0 35.0 33.0 35.0 6 38.70575 40.0 40.0 40.0 38.0 40.0 7 38.727 40.0 40.0 40.0 38.0 40.0 8 38.582 40.0 40.0 40.0 36.0 40.0 9 38.6635 40.0 40.0 40.0 37.0 40.0 10 38.70325 40.0 40.0 40.0 37.0 40.0 11 38.712 40.0 40.0 40.0 38.0 40.0 12 38.6525 40.0 40.0 40.0 38.0 40.0 13 38.71525 40.0 40.0 40.0 38.0 40.0 14 38.69675 40.0 40.0 40.0 38.0 40.0 15 38.73625 40.0 40.0 40.0 37.0 40.0 16 38.66575 40.0 40.0 40.0 38.0 40.0 17 38.608 40.0 40.0 40.0 37.0 40.0 18 38.62975 40.0 40.0 40.0 37.0 40.0 19 38.68425 40.0 40.0 40.0 38.0 40.0 20 38.627 40.0 40.0 40.0 37.0 40.0 21 38.71425 40.0 40.0 40.0 37.0 40.0 22 38.7575 40.0 40.0 40.0 38.0 40.0 23 38.73625 40.0 40.0 40.0 38.0 40.0 24 38.753 40.0 40.0 40.0 38.0 40.0 25 38.69175 40.0 40.0 40.0 38.0 40.0 26 38.71525 40.0 40.0 40.0 38.0 40.0 27 38.6745 40.0 40.0 40.0 38.0 40.0 28 38.71475 40.0 40.0 40.0 38.0 40.0 29 38.78375 40.0 40.0 40.0 38.0 40.0 30 38.709 40.0 40.0 40.0 38.0 40.0 31 38.7475 40.0 40.0 40.0 38.0 40.0 32 38.704 40.0 40.0 40.0 38.0 40.0 33 38.7075 40.0 40.0 40.0 38.0 40.0 34 38.72775 40.0 40.0 40.0 38.0 40.0 35 38.69025 40.0 40.0 40.0 38.0 40.0 36 38.764 40.0 40.0 40.0 38.0 40.0 37 38.674 40.0 40.0 40.0 37.0 40.0 38 38.60625 40.0 40.0 40.0 37.0 40.0 39 38.66725 40.0 40.0 40.0 37.0 40.0 40 38.694 40.0 40.0 40.0 38.0 40.0 41 38.639 40.0 40.0 40.0 37.0 40.0 42 38.7135 40.0 40.0 40.0 37.0 40.0 43 38.601 40.0 40.0 40.0 37.0 40.0 44 38.62575 40.0 40.0 40.0 37.0 40.0 45 38.639 40.0 40.0 40.0 37.0 40.0 46 38.6985 40.0 40.0 40.0 37.0 40.0 47 38.63475 40.0 40.0 40.0 37.0 40.0 48 38.60825 40.0 40.0 40.0 37.0 40.0 49 38.6785 40.0 40.0 40.0 37.0 40.0 50 38.644 40.0 40.0 40.0 37.0 40.0 51 38.62975 40.0 40.0 40.0 37.0 40.0 52 38.631 40.0 40.0 40.0 37.0 40.0 53 38.604 40.0 40.0 40.0 37.0 40.0 54 38.66575 40.0 40.0 40.0 37.0 40.0 55 38.56775 40.0 40.0 40.0 36.0 40.0 56 38.58225 40.0 40.0 40.0 36.0 40.0 57 38.58675 40.0 40.0 40.0 37.0 40.0 58 38.57675 40.0 40.0 40.0 37.0 40.0 59 38.576 40.0 40.0 40.0 37.0 40.0 60 38.651 40.0 40.0 40.0 37.0 40.0 61 38.672 40.0 40.0 40.0 37.0 40.0 62 38.6265 40.0 40.0 40.0 37.0 40.0 63 38.624 40.0 40.0 40.0 37.0 40.0 64 38.5915 40.0 40.0 40.0 37.0 40.0 65 38.59775 40.0 40.0 40.0 37.0 40.0 66 38.5875 40.0 40.0 40.0 37.0 40.0 67 38.6485 40.0 40.0 40.0 37.0 40.0 68 38.5615 40.0 40.0 40.0 37.0 40.0 69 38.57075 40.0 40.0 40.0 36.0 40.0 70 38.58325 40.0 40.0 40.0 37.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 5.0 18 15.0 19 14.0 20 22.0 21 19.0 22 14.0 23 13.0 24 17.0 25 14.0 26 13.0 27 21.0 28 10.0 29 12.0 30 21.0 31 22.0 32 20.0 33 32.0 34 44.0 35 60.0 36 70.0 37 109.0 38 258.0 39 3175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.675 18.175 16.125 33.025 2 29.099999999999998 24.125 25.75 21.025 3 23.974999999999998 25.35 26.950000000000003 23.724999999999998 4 26.325 29.599999999999998 21.0 23.075000000000003 5 26.724999999999998 31.1 20.849999999999998 21.325 6 24.099999999999998 29.5 23.95 22.45 7 24.25 18.025 32.85 24.875 8 23.65 22.7 24.9 28.749999999999996 9 24.125 23.225 28.549999999999997 24.099999999999998 10 26.075 30.075000000000003 20.225 23.625 11 28.65 21.75 21.8 27.800000000000004 12 27.750000000000004 22.325 23.974999999999998 25.95 13 26.35 24.025 24.5 25.124999999999996 14 25.174999999999997 24.45 24.775 25.6 15 26.125 24.825 25.1 23.95 16 26.825 24.349999999999998 23.400000000000002 25.424999999999997 17 26.6 24.95 24.025 24.425 18 26.700000000000003 25.724999999999998 23.775 23.799999999999997 19 27.125 23.799999999999997 23.974999999999998 25.1 20 26.724999999999998 25.424999999999997 23.400000000000002 24.45 21 25.424999999999997 25.775 24.099999999999998 24.7 22 25.85 25.05 23.35 25.75 23 24.975 24.7 25.474999999999998 24.85 24 26.224999999999998 24.95 24.5 24.325 25 28.125 23.875 23.825 24.175 26 25.974999999999998 24.4 24.875 24.75 27 25.974999999999998 25.224999999999998 24.099999999999998 24.7 28 25.624999999999996 25.75 24.55 24.075 29 26.1 23.95 25.674999999999997 24.275 30 25.8 24.4 23.849999999999998 25.95 31 25.2 26.375 24.325 24.099999999999998 32 26.700000000000003 25.874999999999996 24.2 23.225 33 25.324999999999996 24.825 25.7 24.15 34 26.075 24.625 23.549999999999997 25.75 35 26.575 24.7 24.8 23.925 36 25.95 23.974999999999998 24.15 25.924999999999997 37 25.85 24.85 25.025 24.275 38 27.400000000000002 26.05 23.075000000000003 23.474999999999998 39 25.0 24.5 24.95 25.55 40 25.650000000000002 25.424999999999997 23.674999999999997 25.25 41 26.174999999999997 25.2 24.425 24.2 42 26.075 24.7 24.7 24.525 43 27.325 23.025000000000002 25.174999999999997 24.474999999999998 44 26.8 24.575 23.95 24.675 45 24.65 25.624999999999996 24.675 25.05 46 26.825 25.45 23.775 23.95 47 25.124999999999996 26.525 23.45 24.9 48 25.974999999999998 25.525 24.474999999999998 24.025 49 27.400000000000002 24.8 23.625 24.175 50 26.325 25.124999999999996 24.55 24.0 51 25.474999999999998 25.95 24.5 24.075 52 26.275 22.975 26.325 24.425 53 26.8 24.575 24.8 23.825 54 26.575 24.55 25.0 23.875 55 26.375 25.174999999999997 23.75 24.7 56 24.8 26.200000000000003 23.9 25.1 57 25.95648912228057 23.63090772693173 25.531382845711427 24.88122030507627 58 25.55638909727432 25.55638909727432 24.55613903475869 24.33108277069267 59 26.70667666916729 25.95648912228057 24.381095273818453 22.95573893473368 60 26.456614153538382 25.581395348837212 24.356089022255563 23.605901475368842 61 26.506626656664167 24.50612653163291 25.006251562890725 23.980995248812203 62 25.831457864466117 24.956239059764943 25.256314078519633 23.95598899724931 63 26.406601650412604 25.23130782695674 24.55613903475869 23.80595148787197 64 26.356589147286826 24.981245311327832 24.081020255063766 24.58114528632158 65 26.21966474856142 24.86865148861646 24.31823867900926 24.59344508381286 66 26.120711244678184 25.068870523415974 25.29426496368645 23.516153268219384 67 27.23823975720789 24.83560950935761 23.950429944360142 23.975720789074355 68 26.45844088797109 23.64481156427465 24.754775425916364 25.14197212183789 69 26.374236535258188 19.51693503609106 26.263187118267627 27.84564131038312 70 28.28996282527881 0.0 36.20817843866171 35.501858736059475 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 3.0 27 5.0 28 5.0 29 9.0 30 13.0 31 15.5 32 23.5 33 29.0 34 40.5 35 60.5 36 87.0 37 105.0 38 125.5 39 156.0 40 166.0 41 183.0 42 211.5 43 223.0 44 241.0 45 271.0 46 263.5 47 244.0 48 231.5 49 213.0 50 207.0 51 188.0 52 177.5 53 186.0 54 186.0 55 163.5 56 140.5 57 140.0 58 133.0 59 120.5 60 115.0 61 101.5 62 92.0 63 96.0 64 93.0 65 83.5 66 72.0 67 67.0 68 65.0 69 69.0 70 75.0 71 60.0 72 36.0 73 27.0 74 24.5 75 21.0 76 14.5 77 9.0 78 7.0 79 2.5 80 0.0 81 0.5 82 3.0 83 5.0 84 2.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.075 66 0.17500000000000002 67 1.15 68 3.15 69 9.950000000000001 70 32.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222394 spots for ERR5052687.sra Written 222394 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra Read 222389 spots for ERR5052687.sra Written 222389 spots for ERR5052687.sra SRR ids: ['ERR5052687.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ovykrmsu ERR5052687.sra spots: 4447785 blocks: [[1, 222389], [222390, 444778], [444779, 667167], [667168, 889556], [889557, 1111945], [1111946, 1334334], [1334335, 1556723], [1556724, 1779112], [1779113, 2001501], [2001502, 2223890], [2223891, 2446279], [2446280, 2668668], [2668669, 2891057], [2891058, 3113446], [3113447, 3335835], [3335836, 3558224], [3558225, 3780613], [3780614, 4003002], [4003003, 4225391], [4225392, 4447785]] ERR5052687 file size 788355 ERR5052687 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052687 ERR5052687_1.fastq ERR5052687_2.fastq Input file: ERR5052687_1.fastq Paired file: ERR5052687_2.fastq trimmed: ERR5052687-trimmed-pair1.fastq, ERR5052687-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:31:24 2024 >> started Tue Dec 10 05:31:28 2024 >> done (4.570s) 4447785 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 32 ( 0.00%) empty read pairs filtered out after trimming by size control 4447753 (100.00%) read pairs available; of these: 27 ( 0.00%) trimmed read pairs available after processing 4447726 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 25 0.00% 70 4447726 100.00% 4447753 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=27 prefix-density=0.18 prefix-fanout=2.1 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=276.60 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=25.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=28 prefix-density=0.31 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=295.85 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=20.8 sequence=CGCCGCCGCCTCC ERR5052687 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:32:01 Started mapping on | Dec 10 05:32:01 Finished on | Dec 10 05:32:13 Mapping speed, Million of reads per hour | 1334.33 Number of input reads | 4447753 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4238362 Uniquely mapped reads % | 95.29% Average mapped length | 138.74 Number of splices: Total | 2099633 Number of splices: Annotated (sjdb) | 2000180 Number of splices: GT/AG | 2072217 Number of splices: GC/AG | 24399 Number of splices: AT/AC | 1048 Number of splices: Non-canonical | 1969 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 63042 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 9290 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 146349 146349 146349 N_multimapping 63042 63042 63042 N_noFeature 116631 4140126 141447 N_ambiguous 87432 359 14130 UnstrandedReadsAssigned:4034299 PositiveStrandReadsAssigned:97877 NegativeStrandReadsAssigned:4082785 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052687 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052687-trimmed-pair1.fastq ERR5052687-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,447,753 reads, 4,178,770 reads pseudoaligned [quant] estimated average fragment length: 185.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52973 ERR5052687.ke.tsv 35125 ERR5052687.se.tsv 88098 total ==> ERR5052687.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.844 3.59439e-08 1.70535e-08 PNS24247 1044 859.499 15.6847 6.50953 PNS24249 1928 1743.5 20.1731 4.12731 PNS24246 1044 859.499 15.6847 6.50953 PNS24248 1044 859.499 15.6847 6.50953 PNS24244 1471 1286.5 34.7727 9.64154 PNS24243 293 122.761 0 0 KQK14069 1603 1418.5 5955.23 1497.57 KQK14071 474 292.5 203.192 247.799 ==> ERR5052687.se.tsv <== BRADI_1g14170v3 6560 BRADI_1g53295v3 30 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 258 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 130 BRADI_1g48960v3 0 ERR5052687 completed mapping pipeline successfully