Starting /dee2/code/volunteer_pipeline.sh ERR5052688 current disk space = 1525901221888 free memory = 1602356988 ERR5052688 SRAfilesize 9604b080c00d6ec4e9f30123abd5ac37 ERR5052688.sra ERR5052688.sra file validated ERR5052688 is paired end ERR5052688 is conventional basespace ERR5052688 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052688_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.33075 35.0 35.0 35.0 34.0 35.0 2 34.595 35.0 35.0 35.0 35.0 35.0 3 34.6225 35.0 35.0 35.0 35.0 35.0 4 34.71525 35.0 35.0 35.0 35.0 35.0 5 34.707 35.0 35.0 35.0 35.0 35.0 6 39.47525 40.0 40.0 40.0 39.0 40.0 7 39.5015 40.0 40.0 40.0 39.0 40.0 8 39.48325 40.0 40.0 40.0 39.0 40.0 9 39.49925 40.0 40.0 40.0 39.0 40.0 10 39.494 40.0 40.0 40.0 39.0 40.0 11 39.4715 40.0 40.0 40.0 39.0 40.0 12 39.448 40.0 40.0 40.0 39.0 40.0 13 39.48825 40.0 40.0 40.0 39.0 40.0 14 39.49875 40.0 40.0 40.0 39.0 40.0 15 39.4645 40.0 40.0 40.0 39.0 40.0 16 39.4605 40.0 40.0 40.0 39.0 40.0 17 39.45675 40.0 40.0 40.0 39.0 40.0 18 39.424 40.0 40.0 40.0 39.0 40.0 19 39.439 40.0 40.0 40.0 39.0 40.0 20 39.45975 40.0 40.0 40.0 39.0 40.0 21 39.464 40.0 40.0 40.0 39.0 40.0 22 39.455 40.0 40.0 40.0 39.0 40.0 23 39.44575 40.0 40.0 40.0 39.0 40.0 24 39.384 40.0 40.0 40.0 39.0 40.0 25 39.40525 40.0 40.0 40.0 39.0 40.0 26 39.37425 40.0 40.0 40.0 39.0 40.0 27 39.42375 40.0 40.0 40.0 39.0 40.0 28 39.41275 40.0 40.0 40.0 39.0 40.0 29 39.467 40.0 40.0 40.0 39.0 40.0 30 39.46875 40.0 40.0 40.0 39.0 40.0 31 39.433 40.0 40.0 40.0 39.0 40.0 32 39.398 40.0 40.0 40.0 39.0 40.0 33 39.4515 40.0 40.0 40.0 39.0 40.0 34 39.36575 40.0 40.0 40.0 39.0 40.0 35 39.402 40.0 40.0 40.0 39.0 40.0 36 39.4305 40.0 40.0 40.0 39.0 40.0 37 39.4055 40.0 40.0 40.0 39.0 40.0 38 39.40775 40.0 40.0 40.0 39.0 40.0 39 39.44825 40.0 40.0 40.0 39.0 40.0 40 39.422 40.0 40.0 40.0 39.0 40.0 41 39.39525 40.0 40.0 40.0 39.0 40.0 42 39.377 40.0 40.0 40.0 39.0 40.0 43 39.433 40.0 40.0 40.0 39.0 40.0 44 39.429 40.0 40.0 40.0 39.0 40.0 45 39.4495 40.0 40.0 40.0 39.0 40.0 46 39.434 40.0 40.0 40.0 39.0 40.0 47 39.4455 40.0 40.0 40.0 39.0 40.0 48 39.394 40.0 40.0 40.0 39.0 40.0 49 39.47425 40.0 40.0 40.0 39.0 40.0 50 39.42075 40.0 40.0 40.0 39.0 40.0 51 39.405 40.0 40.0 40.0 39.0 40.0 52 39.4535 40.0 40.0 40.0 39.0 40.0 53 39.46475 40.0 40.0 40.0 39.0 40.0 54 39.42675 40.0 40.0 40.0 39.0 40.0 55 39.39075 40.0 40.0 40.0 39.0 40.0 56 39.417 40.0 40.0 40.0 39.0 40.0 57 39.41875 40.0 40.0 40.0 39.0 40.0 58 39.34425 40.0 40.0 40.0 39.0 40.0 59 39.34225 40.0 40.0 40.0 39.0 40.0 60 39.352 40.0 40.0 40.0 39.0 40.0 61 39.3185 40.0 40.0 40.0 39.0 40.0 62 39.34325 40.0 40.0 40.0 39.0 40.0 63 39.394 40.0 40.0 40.0 39.0 40.0 64 39.371 40.0 40.0 40.0 39.0 40.0 65 39.35075 40.0 40.0 40.0 39.0 40.0 66 39.351 40.0 40.0 40.0 39.0 40.0 67 39.37775 40.0 40.0 40.0 39.0 40.0 68 39.3985 40.0 40.0 40.0 39.0 40.0 69 39.33425 40.0 40.0 40.0 39.0 40.0 70 39.34775 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 7.0 27 8.0 28 5.0 29 9.0 30 16.0 31 18.0 32 25.0 33 28.0 34 32.0 35 51.0 36 58.0 37 86.0 38 228.0 39 3424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.318675764468033 8.819812989638615 8.238564569118019 55.62294667677533 2 18.125 13.175 39.975 28.725 3 20.125 14.399999999999999 23.375 42.1 4 25.4 23.5 20.724999999999998 30.375000000000004 5 25.924999999999997 26.900000000000002 25.025 22.15 6 20.849999999999998 30.675 26.8 21.675 7 17.224999999999998 23.125 40.575 19.075 8 20.150000000000002 21.825 32.225 25.8 9 18.375 22.0 34.5 25.124999999999996 10 20.925 33.324999999999996 25.1 20.65 11 25.45 24.099999999999998 23.575 26.875 12 22.6 23.075000000000003 27.3 27.025 13 22.900000000000002 23.65 28.275 25.174999999999997 14 21.925 25.575 27.6 24.9 15 21.725 24.525 27.825 25.924999999999997 16 22.85 25.25 24.725 27.175 17 22.5 25.424999999999997 26.1 25.974999999999998 18 22.7 24.625 26.875 25.8 19 23.0 25.724999999999998 25.124999999999996 26.150000000000002 20 23.25 26.075 26.224999999999998 24.45 21 23.025000000000002 26.275 25.624999999999996 25.074999999999996 22 23.0 26.474999999999998 24.575 25.95 23 22.575 26.424999999999997 26.25 24.75 24 21.675 25.25 28.125 24.95 25 23.075000000000003 26.025 24.15 26.75 26 22.975 25.575 26.025 25.424999999999997 27 22.55 24.675 26.6 26.174999999999997 28 23.474999999999998 25.05 25.074999999999996 26.400000000000002 29 23.075000000000003 25.924999999999997 26.424999999999997 24.575 30 22.15 24.175 26.924999999999997 26.75 31 22.5 25.75 24.925 26.825 32 23.7 25.05 25.525 25.724999999999998 33 22.8 24.349999999999998 26.150000000000002 26.700000000000003 34 22.975 26.700000000000003 25.0 25.324999999999996 35 23.375 24.825 25.45 26.35 36 22.675 23.875 26.375 27.075 37 22.275 26.0 24.4 27.325 38 22.675 26.825 26.825 23.674999999999997 39 22.175 24.65 26.775 26.400000000000002 40 22.875 25.874999999999996 25.525 25.724999999999998 41 22.3 25.8 26.450000000000003 25.45 42 22.7 24.2 27.6 25.5 43 22.125 26.224999999999998 25.05 26.6 44 22.85 24.625 27.275 25.25 45 22.475 26.3 26.575 24.65 46 22.6 25.85 25.75 25.8 47 21.45 27.275 25.8 25.474999999999998 48 22.85 24.875 26.924999999999997 25.35 49 23.474999999999998 25.974999999999998 24.65 25.900000000000002 50 22.650000000000002 27.3 24.975 25.074999999999996 51 23.549999999999997 24.85 26.525 25.074999999999996 52 22.400000000000002 24.875 25.874999999999996 26.85 53 22.2 26.375 26.150000000000002 25.275 54 23.375 22.8 27.0 26.825 55 22.825 25.424999999999997 24.6 27.150000000000002 56 22.525000000000002 26.200000000000003 26.424999999999997 24.85 57 22.425 24.85 26.75 25.974999999999998 58 22.7 25.7 25.324999999999996 26.275 59 23.25 25.624999999999996 25.3 25.825 60 22.95 25.025 25.575 26.450000000000003 61 21.375 26.825 25.724999999999998 26.075 62 22.225 26.825 25.275 25.674999999999997 63 22.625 25.074999999999996 26.05 26.25 64 23.200000000000003 24.474999999999998 24.875 27.450000000000003 65 23.992994746059544 25.01876407305479 25.494120590442833 25.494120590442833 66 21.59318637274549 25.0751503006012 27.47995991983968 25.851703406813627 67 23.154193872425914 24.91210447011552 24.711200401808135 27.222501255650428 68 23.4375 23.668032786885245 26.946721311475407 25.947745901639347 69 24.079164376030786 19.928532160527762 27.32270478284772 28.669598680593733 70 24.00889218228974 0.0 36.754353464246016 39.23675435346425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 4.0 27 6.0 28 5.5 29 12.5 30 20.0 31 22.5 32 23.5 33 22.0 34 39.0 35 65.0 36 101.0 37 128.0 38 146.5 39 189.0 40 213.0 41 221.0 42 242.0 43 255.0 44 275.0 45 301.5 46 293.0 47 278.0 48 269.5 49 244.0 50 227.0 51 216.5 52 190.5 53 175.0 54 167.0 55 143.0 56 120.0 57 113.0 58 105.5 59 94.0 60 90.0 61 83.5 62 74.0 63 71.0 64 67.5 65 58.5 66 52.0 67 51.0 68 46.0 69 34.5 70 28.0 71 25.5 72 21.0 73 19.0 74 15.0 75 8.0 76 5.0 77 5.0 78 7.5 79 6.0 80 2.0 81 1.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.075 66 0.2 67 0.44999999999999996 68 2.4 69 9.049999999999999 70 32.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052688 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052688_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3695 35.0 35.0 35.0 33.0 35.0 2 34.2745 35.0 35.0 35.0 33.0 35.0 3 34.3885 35.0 35.0 35.0 34.0 35.0 4 34.45375 35.0 35.0 35.0 34.0 35.0 5 34.3985 35.0 35.0 35.0 33.0 35.0 6 39.2565 40.0 40.0 40.0 39.0 40.0 7 39.2085 40.0 40.0 40.0 39.0 40.0 8 39.1995 40.0 40.0 40.0 39.0 40.0 9 39.187 40.0 40.0 40.0 39.0 40.0 10 39.17075 40.0 40.0 40.0 39.0 40.0 11 39.20475 40.0 40.0 40.0 39.0 40.0 12 39.195 40.0 40.0 40.0 39.0 40.0 13 39.16475 40.0 40.0 40.0 39.0 40.0 14 39.17775 40.0 40.0 40.0 39.0 40.0 15 39.16975 40.0 40.0 40.0 39.0 40.0 16 39.20925 40.0 40.0 40.0 39.0 40.0 17 39.2605 40.0 40.0 40.0 39.0 40.0 18 39.2235 40.0 40.0 40.0 39.0 40.0 19 39.21925 40.0 40.0 40.0 39.0 40.0 20 39.22825 40.0 40.0 40.0 39.0 40.0 21 39.2035 40.0 40.0 40.0 39.0 40.0 22 39.2005 40.0 40.0 40.0 39.0 40.0 23 39.16225 40.0 40.0 40.0 39.0 40.0 24 39.19875 40.0 40.0 40.0 39.0 40.0 25 39.218 40.0 40.0 40.0 39.0 40.0 26 39.241 40.0 40.0 40.0 39.0 40.0 27 39.20075 40.0 40.0 40.0 39.0 40.0 28 39.22075 40.0 40.0 40.0 39.0 40.0 29 39.20175 40.0 40.0 40.0 39.0 40.0 30 39.26575 40.0 40.0 40.0 39.0 40.0 31 39.19775 40.0 40.0 40.0 39.0 40.0 32 39.23925 40.0 40.0 40.0 39.0 40.0 33 39.2325 40.0 40.0 40.0 39.0 40.0 34 39.21875 40.0 40.0 40.0 39.0 40.0 35 39.1945 40.0 40.0 40.0 39.0 40.0 36 39.21375 40.0 40.0 40.0 39.0 40.0 37 39.17625 40.0 40.0 40.0 39.0 40.0 38 39.19875 40.0 40.0 40.0 39.0 40.0 39 39.136 40.0 40.0 40.0 39.0 40.0 40 39.1975 40.0 40.0 40.0 39.0 40.0 41 39.14575 40.0 40.0 40.0 39.0 40.0 42 39.18075 40.0 40.0 40.0 39.0 40.0 43 39.209 40.0 40.0 40.0 39.0 40.0 44 39.20675 40.0 40.0 40.0 39.0 40.0 45 39.18375 40.0 40.0 40.0 39.0 40.0 46 39.224 40.0 40.0 40.0 39.0 40.0 47 39.14325 40.0 40.0 40.0 39.0 40.0 48 39.10225 40.0 40.0 40.0 39.0 40.0 49 39.12 40.0 40.0 40.0 39.0 40.0 50 39.14 40.0 40.0 40.0 39.0 40.0 51 39.1295 40.0 40.0 40.0 39.0 40.0 52 39.0395 40.0 40.0 40.0 39.0 40.0 53 39.00175 40.0 40.0 40.0 39.0 40.0 54 39.05775 40.0 40.0 40.0 39.0 40.0 55 39.15175 40.0 40.0 40.0 39.0 40.0 56 39.0805 40.0 40.0 40.0 39.0 40.0 57 39.13475 40.0 40.0 40.0 39.0 40.0 58 39.177 40.0 40.0 40.0 39.0 40.0 59 39.09475 40.0 40.0 40.0 39.0 40.0 60 39.19075 40.0 40.0 40.0 39.0 40.0 61 39.0965 40.0 40.0 40.0 39.0 40.0 62 39.1175 40.0 40.0 40.0 39.0 40.0 63 39.0065 40.0 40.0 40.0 39.0 40.0 64 39.0475 40.0 40.0 40.0 39.0 40.0 65 39.10675 40.0 40.0 40.0 39.0 40.0 66 39.024 40.0 40.0 40.0 39.0 40.0 67 39.04725 40.0 40.0 40.0 39.0 40.0 68 39.02725 40.0 40.0 40.0 39.0 40.0 69 39.085 40.0 40.0 40.0 39.0 40.0 70 39.01175 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 2.0 19 4.0 20 5.0 21 8.0 22 6.0 23 10.0 24 9.0 25 11.0 26 4.0 27 9.0 28 18.0 29 12.0 30 11.0 31 13.0 32 17.0 33 31.0 34 39.0 35 40.0 36 63.0 37 91.0 38 246.0 39 3347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.200000000000003 16.85 13.725000000000001 43.225 2 28.349999999999998 22.775000000000002 31.424999999999997 17.45 3 20.625 25.900000000000002 27.525 25.95 4 25.15 30.25 20.075000000000003 24.525 5 28.575 30.85 22.025 18.55 6 20.9 36.25 21.85 21.0 7 22.05 18.75 36.325 22.875 8 23.5 21.25 27.125 28.125 9 24.2 21.95 28.849999999999998 25.0 10 23.575 32.525 22.525000000000002 21.375 11 29.099999999999998 24.25 20.724999999999998 25.924999999999997 12 26.6 22.175 24.8 26.424999999999997 13 23.7 23.7 26.525 26.075 14 25.4 24.575 25.674999999999997 24.349999999999998 15 24.175 26.075 25.7 24.05 16 26.85 23.7 24.175 25.275 17 26.575 24.575 24.6 24.25 18 26.775 24.725 24.3 24.2 19 25.45 24.925 25.474999999999998 24.15 20 28.050000000000004 24.5 23.175 24.275 21 25.624999999999996 25.15 25.124999999999996 24.099999999999998 22 25.85 24.6 25.074999999999996 24.474999999999998 23 27.35 24.725 24.4 23.525 24 25.15 25.324999999999996 25.624999999999996 23.9 25 25.424999999999997 24.65 25.45 24.474999999999998 26 26.424999999999997 26.0 24.525 23.05 27 25.45 26.150000000000002 24.6 23.799999999999997 28 26.025 25.45 24.075 24.45 29 25.6 27.250000000000004 23.400000000000002 23.75 30 25.174999999999997 24.95 26.05 23.825 31 26.325 24.675 25.1 23.9 32 27.125 25.424999999999997 23.474999999999998 23.974999999999998 33 26.025 25.3 25.374999999999996 23.3 34 25.974999999999998 24.125 24.725 25.174999999999997 35 26.025 25.074999999999996 25.275 23.625 36 25.025 25.674999999999997 24.9 24.4 37 26.75 23.65 25.324999999999996 24.275 38 27.450000000000003 25.124999999999996 24.15 23.275000000000002 39 23.925 27.450000000000003 24.675 23.95 40 25.825 25.0 24.875 24.3 41 26.650000000000002 26.924999999999997 23.425 23.0 42 25.15 27.375 24.125 23.35 43 25.575 25.025 25.5 23.9 44 25.924999999999997 25.674999999999997 25.374999999999996 23.025000000000002 45 25.624999999999996 25.874999999999996 24.175 24.325 46 27.075 25.0 23.825 24.099999999999998 47 26.424999999999997 24.8 25.1 23.674999999999997 48 24.075 26.375 25.874999999999996 23.674999999999997 49 25.324999999999996 24.65 25.724999999999998 24.3 50 26.924999999999997 26.650000000000002 23.474999999999998 22.95 51 25.724999999999998 25.374999999999996 26.025 22.875 52 25.874999999999996 25.124999999999996 25.025 23.974999999999998 53 26.05 26.025 24.7 23.225 54 26.200000000000003 27.425 24.2 22.175 55 26.075 25.75 24.05 24.125 56 24.4 26.85 26.85 21.9 57 25.0 26.424999999999997 24.625 23.95 58 26.674999999999997 24.25 25.674999999999997 23.400000000000002 59 27.375 24.6 23.849999999999998 24.175 60 25.474999999999998 26.85 24.625 23.05 61 26.275 24.85 25.374999999999996 23.5 62 27.275 26.575 24.224999999999998 21.925 63 25.924999999999997 26.525 25.1 22.45 64 26.1 25.75 24.8 23.35 65 27.131782945736433 25.28132033008252 25.03125781445361 22.55563890972743 66 24.32364729458918 28.0811623246493 24.39879759519038 23.196392785571142 67 26.347607052896727 24.65994962216625 25.66750629722922 23.324937027707808 68 25.71502190157176 24.813192476165938 25.380056686421028 24.091728935841278 69 26.326074818537133 20.603015075376884 28.33612506979341 24.734785036292575 70 28.566037735849058 0.0 36.60377358490566 34.83018867924528 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.5 23 3.0 24 3.5 25 4.0 26 4.0 27 4.0 28 6.5 29 9.0 30 9.0 31 14.0 32 30.5 33 42.0 34 47.5 35 65.0 36 91.0 37 105.0 38 131.5 39 179.5 40 201.0 41 207.5 42 236.0 43 258.0 44 250.5 45 270.0 46 284.5 47 272.0 48 253.0 49 233.0 50 232.0 51 199.0 52 168.5 53 171.0 54 159.0 55 145.0 56 132.5 57 122.0 58 121.5 59 105.5 60 90.0 61 101.0 62 98.0 63 84.0 64 85.5 65 76.5 66 73.0 67 80.0 68 63.0 69 44.5 70 43.0 71 37.0 72 24.0 73 17.0 74 16.0 75 10.0 76 6.0 77 7.0 78 4.5 79 2.0 80 2.0 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.025 66 0.2 67 0.75 68 2.9749999999999996 69 10.45 70 33.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195107 spots for ERR5052688.sra Written 195107 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra Read 195105 spots for ERR5052688.sra Written 195105 spots for ERR5052688.sra SRR ids: ['ERR5052688.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_courj_5o ERR5052688.sra spots: 3902102 blocks: [[1, 195105], [195106, 390210], [390211, 585315], [585316, 780420], [780421, 975525], [975526, 1170630], [1170631, 1365735], [1365736, 1560840], [1560841, 1755945], [1755946, 1951050], [1951051, 2146155], [2146156, 2341260], [2341261, 2536365], [2536366, 2731470], [2731471, 2926575], [2926576, 3121680], [3121681, 3316785], [3316786, 3511890], [3511891, 3706995], [3706996, 3902102]] ERR5052688 file size 691368 ERR5052688 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052688 ERR5052688_1.fastq ERR5052688_2.fastq Input file: ERR5052688_1.fastq Paired file: ERR5052688_2.fastq trimmed: ERR5052688-trimmed-pair1.fastq, ERR5052688-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:31:44 2024 >> started Tue Dec 10 05:31:48 2024 >> done (4.286s) 3902102 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 93 ( 0.00%) empty read pairs filtered out after trimming by size control 3902008 (100.00%) read pairs available; of these: 11 ( 0.00%) trimmed read pairs available after processing 3901997 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 2 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 5 0.00% 70 3901997 100.00% 3902008 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=2.0 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=7 fanout-score=306.38 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=26.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=908.90 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=14.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR5052688 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:32:19 Started mapping on | Dec 10 05:32:19 Finished on | Dec 10 05:32:30 Mapping speed, Million of reads per hour | 1277.02 Number of input reads | 3902008 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3777546 Uniquely mapped reads % | 96.81% Average mapped length | 138.74 Number of splices: Total | 1965304 Number of splices: Annotated (sjdb) | 1867434 Number of splices: GT/AG | 1939507 Number of splices: GC/AG | 22768 Number of splices: AT/AC | 1079 Number of splices: Non-canonical | 1950 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.89 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 58173 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 7370 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 66289 66289 66289 N_multimapping 58173 58173 58173 N_noFeature 129429 3690457 152485 N_ambiguous 76182 361 12246 UnstrandedReadsAssigned:3571935 PositiveStrandReadsAssigned:86728 NegativeStrandReadsAssigned:3612815 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052688 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052688-trimmed-pair1.fastq ERR5052688-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,902,008 reads, 3,659,944 reads pseudoaligned [quant] estimated average fragment length: 187.65 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52973 ERR5052688.ke.tsv 35125 ERR5052688.se.tsv 88098 total ==> ERR5052688.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.622 11.2382 6.34804 PNS24247 1044 857.35 13.2642 6.55099 PNS24249 1928 1741.35 29.018 7.05609 PNS24246 1044 857.35 13.2642 6.55099 PNS24248 1044 857.35 13.2642 6.55099 PNS24244 1471 1284.35 17.9512 5.91824 PNS24243 293 126.25 0 0 KQK14069 1603 1416.35 4390.48 1312.58 KQK14071 474 291.271 121.114 176.068 ==> ERR5052688.se.tsv <== BRADI_1g14170v3 5022 BRADI_1g53295v3 27 BRADI_1g59795v3 164 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 266 BRADI_1g74790v3 66 BRADI_1g09890v3 0 BRADI_1g77505v3 125 BRADI_1g48960v3 0 ERR5052688 completed mapping pipeline successfully