Starting /dee2/code/volunteer_pipeline.sh ERR5052689 current disk space = 1525885288448 free memory = 1602342508 ERR5052689 SRAfilesize ca3f096b0ea346adc15e321d1cf6c400 ERR5052689.sra ERR5052689.sra file validated ERR5052689 is paired end ERR5052689 is conventional basespace ERR5052689 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052689_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.46 35.0 35.0 35.0 34.0 35.0 2 34.67975 35.0 35.0 35.0 35.0 35.0 3 34.656 35.0 35.0 35.0 35.0 35.0 4 34.672 35.0 35.0 35.0 35.0 35.0 5 34.6685 35.0 35.0 35.0 35.0 35.0 6 39.47925 40.0 40.0 40.0 39.0 40.0 7 39.43725 40.0 40.0 40.0 39.0 40.0 8 39.425 40.0 40.0 40.0 39.0 40.0 9 39.46475 40.0 40.0 40.0 39.0 40.0 10 39.45875 40.0 40.0 40.0 39.0 40.0 11 39.3995 40.0 40.0 40.0 39.0 40.0 12 39.4665 40.0 40.0 40.0 39.0 40.0 13 39.433 40.0 40.0 40.0 39.0 40.0 14 39.40275 40.0 40.0 40.0 39.0 40.0 15 39.3915 40.0 40.0 40.0 39.0 40.0 16 39.38175 40.0 40.0 40.0 39.0 40.0 17 39.38475 40.0 40.0 40.0 39.0 40.0 18 39.37075 40.0 40.0 40.0 39.0 40.0 19 39.41075 40.0 40.0 40.0 39.0 40.0 20 39.4315 40.0 40.0 40.0 39.0 40.0 21 39.392 40.0 40.0 40.0 39.0 40.0 22 39.3415 40.0 40.0 40.0 39.0 40.0 23 39.327 40.0 40.0 40.0 39.0 40.0 24 39.38275 40.0 40.0 40.0 39.0 40.0 25 39.37875 40.0 40.0 40.0 39.0 40.0 26 39.31775 40.0 40.0 40.0 39.0 40.0 27 39.3445 40.0 40.0 40.0 39.0 40.0 28 39.362 40.0 40.0 40.0 39.0 40.0 29 39.28775 40.0 40.0 40.0 39.0 40.0 30 39.3505 40.0 40.0 40.0 39.0 40.0 31 39.304 40.0 40.0 40.0 39.0 40.0 32 39.33775 40.0 40.0 40.0 39.0 40.0 33 39.3315 40.0 40.0 40.0 39.0 40.0 34 39.33225 40.0 40.0 40.0 39.0 40.0 35 39.33275 40.0 40.0 40.0 39.0 40.0 36 39.36225 40.0 40.0 40.0 39.0 40.0 37 39.34875 40.0 40.0 40.0 39.0 40.0 38 39.32525 40.0 40.0 40.0 39.0 40.0 39 39.31425 40.0 40.0 40.0 39.0 40.0 40 39.33975 40.0 40.0 40.0 39.0 40.0 41 39.26125 40.0 40.0 40.0 39.0 40.0 42 39.319 40.0 40.0 40.0 39.0 40.0 43 39.3965 40.0 40.0 40.0 39.0 40.0 44 39.27625 40.0 40.0 40.0 39.0 40.0 45 39.31725 40.0 40.0 40.0 39.0 40.0 46 39.3425 40.0 40.0 40.0 39.0 40.0 47 39.2535 40.0 40.0 40.0 39.0 40.0 48 39.32525 40.0 40.0 40.0 39.0 40.0 49 39.312 40.0 40.0 40.0 39.0 40.0 50 39.36175 40.0 40.0 40.0 39.0 40.0 51 39.35175 40.0 40.0 40.0 39.0 40.0 52 39.303 40.0 40.0 40.0 39.0 40.0 53 39.36325 40.0 40.0 40.0 39.0 40.0 54 39.33975 40.0 40.0 40.0 39.0 40.0 55 39.35175 40.0 40.0 40.0 39.0 40.0 56 39.2895 40.0 40.0 40.0 39.0 40.0 57 39.204 40.0 40.0 40.0 39.0 40.0 58 39.2525 40.0 40.0 40.0 39.0 40.0 59 39.26825 40.0 40.0 40.0 39.0 40.0 60 39.31775 40.0 40.0 40.0 39.0 40.0 61 39.28075 40.0 40.0 40.0 39.0 40.0 62 39.32575 40.0 40.0 40.0 39.0 40.0 63 39.2885 40.0 40.0 40.0 39.0 40.0 64 39.2565 40.0 40.0 40.0 39.0 40.0 65 39.30325 40.0 40.0 40.0 39.0 40.0 66 39.3025 40.0 40.0 40.0 39.0 40.0 67 39.26925 40.0 40.0 40.0 39.0 40.0 68 39.289 40.0 40.0 40.0 39.0 40.0 69 39.251 40.0 40.0 40.0 39.0 40.0 70 39.27875 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 1.0 27 6.0 28 13.0 29 18.0 30 17.0 31 21.0 32 27.0 33 42.0 34 39.0 35 50.0 36 82.0 37 105.0 38 212.0 39 3365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.889447236180903 9.72361809045226 8.241206030150753 54.14572864321608 2 20.25 13.05 39.4 27.3 3 21.099999999999998 14.975 23.724999999999998 40.2 4 26.55 23.3 21.25 28.9 5 26.025 28.775000000000002 23.849999999999998 21.349999999999998 6 21.5 31.075000000000003 25.624999999999996 21.8 7 17.8 23.775 39.074999999999996 19.35 8 19.175 22.400000000000002 33.475 24.95 9 18.3 20.875 36.55 24.275 10 20.549999999999997 33.7 26.525 19.225 11 25.174999999999997 24.9 23.25 26.674999999999997 12 22.475 23.575 27.500000000000004 26.450000000000003 13 22.5 24.65 27.55 25.3 14 22.325 24.725 26.0 26.950000000000003 15 22.05 25.05 25.974999999999998 26.924999999999997 16 22.8 25.0 26.174999999999997 26.025 17 22.5 25.174999999999997 27.1 25.224999999999998 18 22.400000000000002 24.55 27.700000000000003 25.35 19 23.35 25.1 25.624999999999996 25.924999999999997 20 22.875 26.05 26.25 24.825 21 22.825 24.75 26.525 25.900000000000002 22 22.5 25.4 25.8 26.3 23 22.575 26.25 25.924999999999997 25.25 24 21.6 24.7 25.924999999999997 27.775 25 22.725 25.15 25.55 26.575 26 23.05 25.0 25.624999999999996 26.325 27 22.75 23.775 28.225 25.25 28 23.025000000000002 26.075 25.35 25.55 29 22.475 27.250000000000004 24.975 25.3 30 22.125 25.6 24.9 27.375 31 22.775000000000002 24.8 26.525 25.900000000000002 32 23.75 24.65 26.400000000000002 25.2 33 23.025000000000002 25.900000000000002 24.675 26.400000000000002 34 22.900000000000002 25.55 24.474999999999998 27.075 35 22.575 25.624999999999996 26.05 25.75 36 21.75 25.224999999999998 25.55 27.474999999999998 37 23.325000000000003 24.525 25.724999999999998 26.424999999999997 38 23.025000000000002 25.55 26.6 24.825 39 24.925 25.15 24.3 25.624999999999996 40 23.05 25.924999999999997 25.825 25.2 41 22.175 25.6 26.825 25.4 42 21.525 24.224999999999998 27.250000000000004 27.0 43 22.3 25.374999999999996 26.200000000000003 26.125 44 23.0 25.424999999999997 26.424999999999997 25.15 45 22.825 24.875 26.424999999999997 25.874999999999996 46 23.35 25.275 25.3 26.075 47 24.474999999999998 24.75 25.575 25.2 48 22.625 25.35 27.05 24.975 49 23.75 25.1 25.825 25.324999999999996 50 23.275000000000002 24.2 26.1 26.424999999999997 51 22.475 24.075 26.025 27.425 52 24.0 24.875 25.575 25.55 53 23.799999999999997 24.95 26.125 25.124999999999996 54 22.2 24.525 25.724999999999998 27.55 55 22.625 26.674999999999997 25.074999999999996 25.624999999999996 56 22.325 25.650000000000002 26.174999999999997 25.85 57 23.974999999999998 25.0 25.25 25.775 58 22.625 26.025 25.324999999999996 26.025 59 23.225 24.8 26.375 25.6 60 22.400000000000002 25.650000000000002 25.074999999999996 26.875 61 23.53088272068017 24.50612653163291 25.206301575393848 26.756689172293076 62 22.330582645661416 26.081520380095025 26.006501625406354 25.581395348837212 63 23.20580145036259 23.455863965991497 26.60665166291573 26.731682920730183 64 23.13078269567392 25.881470367591895 24.63115778944736 26.356589147286826 65 23.492619464598448 25.193895421566175 26.244683512634477 25.068801601200903 66 23.308270676691727 24.260651629072683 26.240601503759397 26.190476190476193 67 23.72327044025157 24.855345911949687 26.037735849056602 25.38364779874214 68 23.552024602767812 23.398257303946693 25.986673500768838 27.06304459251666 69 24.648469809760133 19.65811965811966 26.38544251447477 29.307968017645436 70 24.67580585402001 0.0 36.34679510929974 38.97739903668025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 4.0 27 5.0 28 5.5 29 8.5 30 11.0 31 15.5 32 32.0 33 44.0 34 46.0 35 65.0 36 107.0 37 132.0 38 147.5 39 177.0 40 191.0 41 209.5 42 242.5 43 257.0 44 259.5 45 273.5 46 280.0 47 275.0 48 258.5 49 235.0 50 228.0 51 222.5 52 208.0 53 199.0 54 186.5 55 155.0 56 122.5 57 109.0 58 104.0 59 101.0 60 103.0 61 94.5 62 81.5 63 77.0 64 70.5 65 62.5 66 63.0 67 65.0 68 54.5 69 36.0 70 28.0 71 26.0 72 18.5 73 13.0 74 10.5 75 6.5 76 4.5 77 4.0 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.075 66 0.25 67 0.625 68 2.45 69 9.325 70 32.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052689 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052689_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.38875 35.0 35.0 35.0 33.0 35.0 2 34.28175 35.0 35.0 35.0 33.0 35.0 3 34.408 35.0 35.0 35.0 33.0 35.0 4 34.4175 35.0 35.0 35.0 34.0 35.0 5 34.3365 35.0 35.0 35.0 33.0 35.0 6 39.128 40.0 40.0 40.0 39.0 40.0 7 39.23025 40.0 40.0 40.0 39.0 40.0 8 39.03125 40.0 40.0 40.0 39.0 40.0 9 39.15075 40.0 40.0 40.0 39.0 40.0 10 39.12125 40.0 40.0 40.0 39.0 40.0 11 39.1115 40.0 40.0 40.0 39.0 40.0 12 39.1245 40.0 40.0 40.0 39.0 40.0 13 39.1355 40.0 40.0 40.0 39.0 40.0 14 39.1885 40.0 40.0 40.0 39.0 40.0 15 39.223 40.0 40.0 40.0 39.0 40.0 16 39.1785 40.0 40.0 40.0 39.0 40.0 17 39.13225 40.0 40.0 40.0 39.0 40.0 18 39.13675 40.0 40.0 40.0 39.0 40.0 19 39.10925 40.0 40.0 40.0 39.0 40.0 20 39.1635 40.0 40.0 40.0 39.0 40.0 21 39.1745 40.0 40.0 40.0 39.0 40.0 22 39.18825 40.0 40.0 40.0 39.0 40.0 23 39.1725 40.0 40.0 40.0 39.0 40.0 24 39.11075 40.0 40.0 40.0 39.0 40.0 25 39.182 40.0 40.0 40.0 39.0 40.0 26 39.18625 40.0 40.0 40.0 39.0 40.0 27 39.11575 40.0 40.0 40.0 39.0 40.0 28 39.14175 40.0 40.0 40.0 39.0 40.0 29 39.20175 40.0 40.0 40.0 39.0 40.0 30 39.1935 40.0 40.0 40.0 39.0 40.0 31 39.17075 40.0 40.0 40.0 39.0 40.0 32 39.13875 40.0 40.0 40.0 39.0 40.0 33 39.2055 40.0 40.0 40.0 39.0 40.0 34 39.13875 40.0 40.0 40.0 39.0 40.0 35 39.1585 40.0 40.0 40.0 39.0 40.0 36 39.13775 40.0 40.0 40.0 39.0 40.0 37 39.07375 40.0 40.0 40.0 39.0 40.0 38 39.13225 40.0 40.0 40.0 39.0 40.0 39 39.0985 40.0 40.0 40.0 39.0 40.0 40 39.211 40.0 40.0 40.0 39.0 40.0 41 39.1275 40.0 40.0 40.0 39.0 40.0 42 39.16025 40.0 40.0 40.0 39.0 40.0 43 39.1235 40.0 40.0 40.0 39.0 40.0 44 39.143 40.0 40.0 40.0 39.0 40.0 45 39.16225 40.0 40.0 40.0 39.0 40.0 46 39.15075 40.0 40.0 40.0 39.0 40.0 47 39.08175 40.0 40.0 40.0 39.0 40.0 48 39.05675 40.0 40.0 40.0 39.0 40.0 49 39.1535 40.0 40.0 40.0 39.0 40.0 50 39.101 40.0 40.0 40.0 39.0 40.0 51 39.06275 40.0 40.0 40.0 39.0 40.0 52 39.039 40.0 40.0 40.0 39.0 40.0 53 39.04075 40.0 40.0 40.0 39.0 40.0 54 39.0845 40.0 40.0 40.0 39.0 40.0 55 39.13075 40.0 40.0 40.0 39.0 40.0 56 39.042 40.0 40.0 40.0 39.0 40.0 57 39.12075 40.0 40.0 40.0 39.0 40.0 58 39.0965 40.0 40.0 40.0 39.0 40.0 59 39.14175 40.0 40.0 40.0 39.0 40.0 60 39.144 40.0 40.0 40.0 39.0 40.0 61 39.0645 40.0 40.0 40.0 39.0 40.0 62 39.106 40.0 40.0 40.0 39.0 40.0 63 39.026 40.0 40.0 40.0 39.0 40.0 64 39.03025 40.0 40.0 40.0 39.0 40.0 65 39.00225 40.0 40.0 40.0 39.0 40.0 66 39.04025 40.0 40.0 40.0 39.0 40.0 67 39.01975 40.0 40.0 40.0 39.0 40.0 68 39.095 40.0 40.0 40.0 39.0 40.0 69 39.0545 40.0 40.0 40.0 39.0 40.0 70 39.06925 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 4.0 19 2.0 20 6.0 21 8.0 22 2.0 23 7.0 24 8.0 25 13.0 26 8.0 27 18.0 28 9.0 29 14.0 30 13.0 31 20.0 32 26.0 33 28.0 34 37.0 35 62.0 36 66.0 37 94.0 38 223.0 39 3331.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.35 16.925 13.075000000000001 42.65 2 28.349999999999998 22.3 30.275000000000002 19.075 3 20.25 25.85 28.175 25.724999999999998 4 25.224999999999998 30.2 21.05 23.525 5 27.900000000000002 32.175 21.099999999999998 18.825 6 21.3 34.599999999999994 22.45 21.65 7 23.525 17.424999999999997 35.5 23.549999999999997 8 22.025 21.05 28.449999999999996 28.475 9 23.05 21.15 29.075 26.724999999999998 10 24.325 31.324999999999996 23.75 20.599999999999998 11 27.775 24.05 21.55 26.625 12 25.624999999999996 22.85 25.224999999999998 26.3 13 25.2 25.3 24.575 24.925 14 25.124999999999996 25.775 24.349999999999998 24.75 15 25.174999999999997 26.35 25.05 23.425 16 25.974999999999998 25.7 24.425 23.9 17 27.500000000000004 25.7 23.0 23.799999999999997 18 25.25 26.400000000000002 24.2 24.15 19 26.05 24.025 24.85 25.074999999999996 20 26.5 25.124999999999996 23.474999999999998 24.9 21 26.125 25.35 25.324999999999996 23.200000000000003 22 26.450000000000003 24.7 23.875 24.975 23 26.125 25.825 24.025 24.025 24 23.799999999999997 26.700000000000003 25.85 23.65 25 25.924999999999997 26.075 23.549999999999997 24.45 26 26.75 25.3 24.099999999999998 23.849999999999998 27 24.275 25.624999999999996 25.624999999999996 24.474999999999998 28 25.3 25.35 24.7 24.65 29 25.074999999999996 26.25 24.575 24.099999999999998 30 25.275 24.474999999999998 25.474999999999998 24.775 31 25.5 25.7 23.825 24.975 32 27.325 25.324999999999996 24.474999999999998 22.875 33 24.75 26.025 24.775 24.45 34 25.900000000000002 24.099999999999998 25.974999999999998 24.025 35 26.450000000000003 24.9 24.474999999999998 24.175 36 25.275 26.200000000000003 24.375 24.15 37 26.700000000000003 24.875 24.05 24.375 38 26.1 26.174999999999997 23.825 23.9 39 24.7 26.325 25.650000000000002 23.325000000000003 40 25.224999999999998 25.074999999999996 25.525 24.175 41 26.25 25.825 24.625 23.3 42 26.3 25.05 25.650000000000002 23.0 43 24.474999999999998 26.5 24.349999999999998 24.675 44 24.75 25.1 25.8 24.349999999999998 45 24.725 26.55 25.2 23.525 46 26.474999999999998 25.5 24.224999999999998 23.799999999999997 47 25.025 26.0 25.124999999999996 23.849999999999998 48 25.1 26.650000000000002 24.575 23.674999999999997 49 25.7 25.35 25.1 23.849999999999998 50 26.525 25.85 23.65 23.974999999999998 51 26.1 24.95 24.925 24.025 52 25.85 26.224999999999998 24.125 23.799999999999997 53 26.174999999999997 25.25 24.975 23.599999999999998 54 25.575 25.124999999999996 25.05 24.25 55 25.825 26.125 23.825 24.224999999999998 56 26.125 25.900000000000002 24.675 23.3 57 25.2 26.150000000000002 25.4 23.25 58 26.1 25.6 24.575 23.724999999999998 59 26.474999999999998 24.55 24.85 24.125 60 25.7 25.6 25.924999999999997 22.775000000000002 61 27.28182045511378 25.156289072268066 23.905976494123532 23.655913978494624 62 25.731432858214554 25.331332833208304 25.78144536134033 23.15578894723681 63 25.056264066016503 24.956239059764943 26.756689172293076 23.23080770192548 64 26.356589147286826 26.406601650412604 23.40585146286572 23.830957739434858 65 26.863431715857928 25.18759379689845 24.137068534267133 23.81190595297649 66 25.7450538442274 27.473077886301027 24.94365138993238 21.838216879539193 67 27.713276123170118 23.775870772337203 24.86118122160525 23.64967188288743 68 26.65806451612903 24.696774193548386 24.309677419354838 24.335483870967742 69 26.9907795473596 20.676166526962838 26.879016485051686 25.45403744062587 70 28.03490136570562 0.0 37.670713201820945 34.29438543247345 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 3.5 27 4.0 28 9.5 29 11.5 30 8.0 31 19.5 32 35.0 33 39.0 34 50.0 35 71.0 36 94.5 37 108.0 38 132.5 39 170.0 40 183.0 41 202.5 42 233.0 43 244.0 44 254.0 45 260.5 46 263.5 47 270.0 48 261.0 49 225.0 50 198.0 51 203.5 52 187.0 53 165.0 54 152.5 55 129.0 56 127.5 57 137.0 58 126.0 59 116.0 60 117.0 61 113.5 62 100.5 63 91.0 64 88.0 65 73.5 66 61.5 67 61.0 68 61.0 69 53.5 70 46.0 71 39.0 72 27.5 73 23.0 74 17.5 75 10.5 76 6.0 77 3.0 78 2.5 79 2.5 80 3.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.17500000000000002 67 0.95 68 3.125 69 10.525 70 34.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200218 spots for ERR5052689.sra Written 200218 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra Read 200207 spots for ERR5052689.sra Written 200207 spots for ERR5052689.sra SRR ids: ['ERR5052689.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s8b_mso4 ERR5052689.sra spots: 4004151 blocks: [[1, 200207], [200208, 400414], [400415, 600621], [600622, 800828], [800829, 1001035], [1001036, 1201242], [1201243, 1401449], [1401450, 1601656], [1601657, 1801863], [1801864, 2002070], [2002071, 2202277], [2202278, 2402484], [2402485, 2602691], [2602692, 2802898], [2802899, 3003105], [3003106, 3203312], [3203313, 3403519], [3403520, 3603726], [3603727, 3803933], [3803934, 4004151]] ERR5052689 file size 709506 ERR5052689 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052689 ERR5052689_1.fastq ERR5052689_2.fastq Input file: ERR5052689_1.fastq Paired file: ERR5052689_2.fastq trimmed: ERR5052689-trimmed-pair1.fastq, ERR5052689-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:32:37 2024 >> started Tue Dec 10 05:32:41 2024 >> done (4.076s) 4004151 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 91 ( 0.00%) empty read pairs filtered out after trimming by size control 4004059 (100.00%) read pairs available; of these: 21 ( 0.00%) trimmed read pairs available after processing 4004038 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 39 2 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 17 0.00% 70 4004038 100.00% 4004059 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.1 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=269.66 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=25.7 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=31 prefix-density=0.30 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=865.90 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=14.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR5052689 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:33:16 Started mapping on | Dec 10 05:33:17 Finished on | Dec 10 05:33:28 Mapping speed, Million of reads per hour | 1310.42 Number of input reads | 4004059 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3875716 Uniquely mapped reads % | 96.79% Average mapped length | 138.73 Number of splices: Total | 2018998 Number of splices: Annotated (sjdb) | 1919063 Number of splices: GT/AG | 1992741 Number of splices: GC/AG | 23241 Number of splices: AT/AC | 1094 Number of splices: Non-canonical | 1922 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 60212 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 7621 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 68131 68131 68131 N_multimapping 60212 60212 60212 N_noFeature 133019 3786139 157002 N_ambiguous 78082 350 12626 UnstrandedReadsAssigned:3664615 PositiveStrandReadsAssigned:89227 NegativeStrandReadsAssigned:3706088 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052689 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052689-trimmed-pair1.fastq ERR5052689-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,004,059 reads, 3,756,027 reads pseudoaligned [quant] estimated average fragment length: 188.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52973 ERR5052689.ke.tsv 35125 ERR5052689.se.tsv 88098 total ==> ERR5052689.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.773 0.029349 0.0161604 PNS24247 1044 856.421 14.4641 6.96326 PNS24249 1928 1740.42 32.6039 7.7237 PNS24246 1044 856.421 14.4641 6.96326 PNS24248 1044 856.421 14.4641 6.96326 PNS24244 1471 1283.42 20.9745 6.73802 PNS24243 293 126.305 0 0 KQK14069 1603 1415.42 4271.58 1244.27 KQK14071 474 290.874 144.887 205.368 ==> ERR5052689.se.tsv <== BRADI_1g14170v3 4939 BRADI_1g53295v3 36 BRADI_1g59795v3 175 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 281 BRADI_1g74790v3 63 BRADI_1g09890v3 0 BRADI_1g77505v3 143 BRADI_1g48960v3 0 ERR5052689 completed mapping pipeline successfully