Starting /dee2/code/volunteer_pipeline.sh ERR5052690 current disk space = 1525885018112 free memory = 1602341780 ERR5052690 SRAfilesize a1af5ebd42dbc162aedf2a1ce27f9310 ERR5052690.sra ERR5052690.sra file validated ERR5052690 is paired end ERR5052690 is conventional basespace ERR5052690 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.14375 35.0 35.0 35.0 35.0 35.0 2 34.5905 35.0 35.0 35.0 35.0 35.0 3 34.682 35.0 35.0 35.0 35.0 35.0 4 34.67775 35.0 35.0 35.0 35.0 35.0 5 34.699 35.0 35.0 35.0 35.0 35.0 6 39.4695 40.0 40.0 40.0 39.0 40.0 7 39.47925 40.0 40.0 40.0 39.0 40.0 8 39.499 40.0 40.0 40.0 39.0 40.0 9 39.465 40.0 40.0 40.0 39.0 40.0 10 39.44625 40.0 40.0 40.0 39.0 40.0 11 39.46975 40.0 40.0 40.0 39.0 40.0 12 39.47 40.0 40.0 40.0 39.0 40.0 13 39.48375 40.0 40.0 40.0 39.0 40.0 14 39.4415 40.0 40.0 40.0 39.0 40.0 15 39.43725 40.0 40.0 40.0 39.0 40.0 16 39.3955 40.0 40.0 40.0 39.0 40.0 17 39.41725 40.0 40.0 40.0 39.0 40.0 18 39.42625 40.0 40.0 40.0 39.0 40.0 19 39.47375 40.0 40.0 40.0 39.0 40.0 20 39.47525 40.0 40.0 40.0 39.0 40.0 21 39.41425 40.0 40.0 40.0 39.0 40.0 22 39.43825 40.0 40.0 40.0 39.0 40.0 23 39.4365 40.0 40.0 40.0 39.0 40.0 24 39.31175 40.0 40.0 40.0 39.0 40.0 25 39.41625 40.0 40.0 40.0 39.0 40.0 26 39.3625 40.0 40.0 40.0 39.0 40.0 27 39.433 40.0 40.0 40.0 39.0 40.0 28 39.4055 40.0 40.0 40.0 39.0 40.0 29 39.4185 40.0 40.0 40.0 39.0 40.0 30 39.4075 40.0 40.0 40.0 39.0 40.0 31 39.39475 40.0 40.0 40.0 39.0 40.0 32 39.42175 40.0 40.0 40.0 39.0 40.0 33 39.43625 40.0 40.0 40.0 39.0 40.0 34 39.401 40.0 40.0 40.0 39.0 40.0 35 39.381 40.0 40.0 40.0 39.0 40.0 36 39.3625 40.0 40.0 40.0 39.0 40.0 37 39.41525 40.0 40.0 40.0 39.0 40.0 38 39.3615 40.0 40.0 40.0 39.0 40.0 39 39.4325 40.0 40.0 40.0 39.0 40.0 40 39.362 40.0 40.0 40.0 39.0 40.0 41 39.3165 40.0 40.0 40.0 39.0 40.0 42 39.37575 40.0 40.0 40.0 39.0 40.0 43 39.32575 40.0 40.0 40.0 39.0 40.0 44 39.3935 40.0 40.0 40.0 39.0 40.0 45 39.413 40.0 40.0 40.0 39.0 40.0 46 39.40725 40.0 40.0 40.0 39.0 40.0 47 39.46025 40.0 40.0 40.0 39.0 40.0 48 39.37525 40.0 40.0 40.0 39.0 40.0 49 39.4015 40.0 40.0 40.0 39.0 40.0 50 39.43225 40.0 40.0 40.0 39.0 40.0 51 39.403 40.0 40.0 40.0 39.0 40.0 52 39.41075 40.0 40.0 40.0 39.0 40.0 53 39.45825 40.0 40.0 40.0 39.0 40.0 54 39.3545 40.0 40.0 40.0 39.0 40.0 55 39.362 40.0 40.0 40.0 39.0 40.0 56 39.39175 40.0 40.0 40.0 39.0 40.0 57 39.39575 40.0 40.0 40.0 39.0 40.0 58 39.397 40.0 40.0 40.0 39.0 40.0 59 39.282 40.0 40.0 40.0 39.0 40.0 60 39.3465 40.0 40.0 40.0 39.0 40.0 61 39.28725 40.0 40.0 40.0 39.0 40.0 62 39.3515 40.0 40.0 40.0 39.0 40.0 63 39.44175 40.0 40.0 40.0 39.0 40.0 64 39.36125 40.0 40.0 40.0 39.0 40.0 65 39.3765 40.0 40.0 40.0 39.0 40.0 66 39.353 40.0 40.0 40.0 39.0 40.0 67 39.30275 40.0 40.0 40.0 39.0 40.0 68 39.34225 40.0 40.0 40.0 39.0 40.0 69 39.286 40.0 40.0 40.0 39.0 40.0 70 39.29525 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 3.0 27 11.0 28 7.0 29 14.0 30 14.0 31 15.0 32 27.0 33 33.0 34 47.0 35 41.0 36 64.0 37 109.0 38 208.0 39 3405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.079308591764104 9.9644128113879 9.20183019827148 48.754448398576514 2 21.25 12.75 35.175 30.825000000000003 3 21.224999999999998 16.925 22.325 39.525 4 25.424999999999997 23.799999999999997 22.95 27.825 5 26.625 27.725 23.974999999999998 21.675 6 20.875 31.175000000000004 26.150000000000002 21.8 7 18.325 22.775000000000002 39.125 19.775000000000002 8 19.925 22.1 31.225 26.75 9 19.675 22.525000000000002 33.225 24.575 10 22.875 32.300000000000004 24.099999999999998 20.724999999999998 11 23.549999999999997 25.674999999999997 22.125 28.65 12 22.675 22.475 26.525 28.325 13 23.3 24.725 27.55 24.425 14 22.2 23.9 27.725 26.174999999999997 15 21.875 24.5 27.025 26.6 16 22.575 24.075 26.875 26.474999999999998 17 23.425 23.625 25.55 27.400000000000002 18 22.325 26.1 25.650000000000002 25.924999999999997 19 23.625 25.55 24.775 26.05 20 24.675 24.85 25.074999999999996 25.4 21 22.625 26.1 24.975 26.3 22 23.575 26.575 25.15 24.7 23 23.974999999999998 25.3 26.025 24.7 24 23.275000000000002 23.775 24.375 28.575 25 22.225 26.575 24.925 26.275 26 23.3 25.3 26.325 25.074999999999996 27 22.425 25.224999999999998 26.125 26.224999999999998 28 24.349999999999998 24.075 24.45 27.125 29 22.475 25.474999999999998 25.424999999999997 26.625 30 23.125 23.9 26.0 26.974999999999998 31 23.150000000000002 26.275 25.45 25.124999999999996 32 23.325000000000003 25.5 25.724999999999998 25.45 33 22.525000000000002 25.275 25.575 26.625 34 23.1 24.3 25.924999999999997 26.674999999999997 35 23.25 26.125 24.675 25.95 36 21.45 25.374999999999996 25.75 27.425 37 22.8 25.424999999999997 26.75 25.025 38 23.599999999999998 25.775 25.55 25.074999999999996 39 23.5 25.224999999999998 25.624999999999996 25.650000000000002 40 22.75 25.55 24.875 26.825 41 23.325000000000003 25.275 25.5 25.900000000000002 42 23.400000000000002 23.9 25.575 27.125 43 23.674999999999997 24.55 25.275 26.5 44 21.925 25.825 26.25 26.0 45 22.45 25.1 25.95 26.5 46 22.875 24.9 25.2 27.025 47 23.125 25.424999999999997 26.125 25.324999999999996 48 22.625 24.05 25.5 27.825 49 21.6 25.974999999999998 26.150000000000002 26.275 50 23.9 24.975 26.1 25.025 51 23.425 23.5 25.474999999999998 27.6 52 23.150000000000002 26.174999999999997 24.325 26.35 53 22.780695173793447 26.481620405101275 24.406101525381345 26.331582895723933 54 22.980745186296573 26.281570392598148 25.081270317579396 25.656414103525883 55 23.980995248812203 25.78144536134033 25.506376594148538 24.731182795698924 56 24.10602650662666 24.681170292573142 24.981245311327832 26.231557889472366 57 23.20580145036259 24.55613903475869 25.156289072268066 27.081770442610654 58 22.18054513628407 25.10627656914228 26.731682920730183 25.98149537384346 59 24.337168584292147 25.03751875937969 24.987493746873437 25.63781890945473 60 23.56178089044522 23.761880940470235 25.912956478239117 26.76338169084542 61 22.861430715357677 25.387693846923458 25.46273136568284 26.28814407203602 62 24.137068534267133 25.26263131565783 24.537268634317158 26.063031515757878 63 23.186593296648326 26.21310655327664 24.662331165582792 25.937968984492244 64 24.16208104052026 24.487243621810904 24.712356178089045 26.638319159579787 65 23.6368184092046 25.512756378189096 25.337668834417208 25.512756378189096 66 23.516153268219384 26.245930378161788 24.392687202604556 25.845229151014276 67 23.825081678813774 24.905755214878113 25.81050515204825 25.458657954259866 68 22.824974411463664 23.56704196519959 27.047082906857728 26.56090071647902 69 24.362139917695476 20.329218106995885 26.117969821673526 29.190672153635116 70 25.435669262143122 0.0 35.85465331850204 38.70967741935484 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 4.0 27 6.0 28 4.5 29 9.0 30 15.0 31 20.5 32 29.0 33 32.0 34 42.5 35 64.5 36 99.5 37 123.0 38 138.5 39 166.5 40 179.0 41 201.5 42 236.0 43 248.0 44 264.0 45 269.0 46 266.5 47 275.0 48 270.0 49 236.0 50 207.0 51 211.5 52 196.0 53 176.0 54 169.0 55 151.5 56 121.5 57 102.0 58 113.5 59 112.5 60 100.0 61 99.5 62 85.0 63 71.0 64 68.5 65 66.0 66 69.5 67 73.0 68 59.5 69 42.5 70 39.0 71 34.5 72 27.0 73 24.0 74 21.0 75 12.5 76 6.0 77 5.0 78 3.5 79 2.5 80 3.0 81 1.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.05 60 0.05 61 0.05 62 0.05 63 0.05 64 0.05 65 0.05 66 0.17500000000000002 67 0.525 68 2.3 69 8.875 70 32.574999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052690 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052690_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5135 35.0 35.0 35.0 35.0 35.0 2 34.53375 35.0 35.0 35.0 34.0 35.0 3 34.507 35.0 35.0 35.0 34.0 35.0 4 34.52 35.0 35.0 35.0 34.0 35.0 5 34.46325 35.0 35.0 35.0 34.0 35.0 6 39.361 40.0 40.0 40.0 39.0 40.0 7 39.2085 40.0 40.0 40.0 39.0 40.0 8 39.235 40.0 40.0 40.0 39.0 40.0 9 39.2635 40.0 40.0 40.0 39.0 40.0 10 39.2635 40.0 40.0 40.0 39.0 40.0 11 39.2975 40.0 40.0 40.0 39.0 40.0 12 39.2765 40.0 40.0 40.0 39.0 40.0 13 39.24875 40.0 40.0 40.0 39.0 40.0 14 39.2955 40.0 40.0 40.0 39.0 40.0 15 39.303 40.0 40.0 40.0 39.0 40.0 16 39.31725 40.0 40.0 40.0 39.0 40.0 17 39.29875 40.0 40.0 40.0 39.0 40.0 18 39.2185 40.0 40.0 40.0 39.0 40.0 19 39.278 40.0 40.0 40.0 39.0 40.0 20 39.29075 40.0 40.0 40.0 39.0 40.0 21 39.2645 40.0 40.0 40.0 39.0 40.0 22 39.2485 40.0 40.0 40.0 39.0 40.0 23 39.25475 40.0 40.0 40.0 39.0 40.0 24 39.29225 40.0 40.0 40.0 39.0 40.0 25 39.25925 40.0 40.0 40.0 39.0 40.0 26 39.267 40.0 40.0 40.0 39.0 40.0 27 39.21075 40.0 40.0 40.0 39.0 40.0 28 39.26725 40.0 40.0 40.0 39.0 40.0 29 39.279 40.0 40.0 40.0 39.0 40.0 30 39.359 40.0 40.0 40.0 39.0 40.0 31 39.26075 40.0 40.0 40.0 39.0 40.0 32 39.35175 40.0 40.0 40.0 39.0 40.0 33 39.278 40.0 40.0 40.0 39.0 40.0 34 39.2945 40.0 40.0 40.0 39.0 40.0 35 39.24 40.0 40.0 40.0 39.0 40.0 36 39.23625 40.0 40.0 40.0 39.0 40.0 37 39.28525 40.0 40.0 40.0 39.0 40.0 38 39.27 40.0 40.0 40.0 39.0 40.0 39 39.19425 40.0 40.0 40.0 39.0 40.0 40 39.2285 40.0 40.0 40.0 39.0 40.0 41 39.20275 40.0 40.0 40.0 39.0 40.0 42 39.29225 40.0 40.0 40.0 39.0 40.0 43 39.18825 40.0 40.0 40.0 39.0 40.0 44 39.1895 40.0 40.0 40.0 39.0 40.0 45 39.2135 40.0 40.0 40.0 39.0 40.0 46 39.287 40.0 40.0 40.0 39.0 40.0 47 39.19675 40.0 40.0 40.0 39.0 40.0 48 39.251 40.0 40.0 40.0 39.0 40.0 49 39.19775 40.0 40.0 40.0 39.0 40.0 50 39.25975 40.0 40.0 40.0 39.0 40.0 51 39.2 40.0 40.0 40.0 39.0 40.0 52 39.0075 40.0 40.0 40.0 39.0 40.0 53 39.15725 40.0 40.0 40.0 39.0 40.0 54 39.1515 40.0 40.0 40.0 39.0 40.0 55 39.19825 40.0 40.0 40.0 39.0 40.0 56 39.13875 40.0 40.0 40.0 39.0 40.0 57 39.2025 40.0 40.0 40.0 39.0 40.0 58 39.16875 40.0 40.0 40.0 39.0 40.0 59 39.1455 40.0 40.0 40.0 39.0 40.0 60 39.16475 40.0 40.0 40.0 39.0 40.0 61 39.09575 40.0 40.0 40.0 39.0 40.0 62 39.16725 40.0 40.0 40.0 39.0 40.0 63 39.06 40.0 40.0 40.0 39.0 40.0 64 39.13775 40.0 40.0 40.0 39.0 40.0 65 39.155 40.0 40.0 40.0 39.0 40.0 66 39.08525 40.0 40.0 40.0 39.0 40.0 67 39.16975 40.0 40.0 40.0 39.0 40.0 68 39.151 40.0 40.0 40.0 39.0 40.0 69 39.17625 40.0 40.0 40.0 39.0 40.0 70 38.97925 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 4.0 20 3.0 21 6.0 22 12.0 23 9.0 24 6.0 25 11.0 26 6.0 27 10.0 28 7.0 29 15.0 30 11.0 31 13.0 32 23.0 33 27.0 34 31.0 35 43.0 36 64.0 37 106.0 38 197.0 39 3396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.4 19.1 12.575 37.925 2 28.199999999999996 23.25 30.025000000000002 18.525 3 20.25 25.724999999999998 27.800000000000004 26.224999999999998 4 24.85 31.025000000000002 20.5 23.625 5 28.349999999999998 31.424999999999997 21.0 19.225 6 22.85 34.050000000000004 21.375 21.725 7 23.025000000000002 18.0 35.175 23.799999999999997 8 22.625 21.875 26.55 28.95 9 24.975 20.95 27.925 26.150000000000002 10 23.825 31.3 23.025000000000002 21.85 11 28.95 23.425 20.424999999999997 27.200000000000003 12 26.875 22.25 23.75 27.125 13 24.875 23.375 25.85 25.900000000000002 14 26.700000000000003 24.825 24.425 24.05 15 25.575 25.525 24.525 24.375 16 27.35 24.25 23.45 24.95 17 26.200000000000003 25.35 23.724999999999998 24.725 18 25.650000000000002 25.324999999999996 24.349999999999998 24.675 19 26.900000000000002 24.375 23.45 25.275 20 27.375 24.2 23.95 24.474999999999998 21 24.775 25.3 24.725 25.2 22 25.674999999999997 24.7 24.425 25.2 23 27.525 23.724999999999998 24.525 24.224999999999998 24 25.45 25.025 25.074999999999996 24.45 25 27.05 23.599999999999998 24.325 25.025 26 26.25 26.700000000000003 23.425 23.625 27 26.025 24.85 24.15 24.975 28 26.900000000000002 25.25 23.3 24.55 29 26.450000000000003 24.675 24.725 24.15 30 25.825 25.4 24.25 24.525 31 26.424999999999997 25.224999999999998 23.625 24.725 32 27.275 25.825 23.674999999999997 23.225 33 24.375 26.125 25.275 24.224999999999998 34 25.55 24.7 24.9 24.85 35 26.150000000000002 24.85 24.875 24.125 36 26.0 24.65 25.674999999999997 23.674999999999997 37 27.200000000000003 24.3 23.150000000000002 25.35 38 27.400000000000002 25.2 24.4 23.0 39 24.825 25.35 25.424999999999997 24.4 40 26.25 25.4 24.625 23.724999999999998 41 26.450000000000003 24.075 24.875 24.6 42 25.85 24.25 25.85 24.05 43 26.474999999999998 24.4 25.474999999999998 23.65 44 27.325 24.45 24.825 23.400000000000002 45 25.525 25.0 25.025 24.45 46 27.0 23.799999999999997 24.725 24.474999999999998 47 26.200000000000003 24.7 24.2 24.9 48 25.55 23.974999999999998 26.325 24.15 49 25.674999999999997 24.3 25.3 24.725 50 27.450000000000003 24.45 23.849999999999998 24.25 51 25.650000000000002 25.224999999999998 24.325 24.8 52 26.35 24.325 25.2 24.125 53 25.081270317579396 25.93148287071768 25.156289072268066 23.830957739434858 54 24.681170292573142 25.731432858214554 25.35633908477119 24.23105776444111 55 27.506876719179797 23.980995248812203 24.731182795698924 23.78094523630908 56 25.906476619154787 26.60665166291573 24.85621405351338 22.630657664416105 57 26.206551637909474 24.63115778944736 25.6064016004001 23.55588897224306 58 27.906976744186046 23.95598899724931 24.20605151287822 23.93098274568642 59 26.9567391847962 25.18129532383096 23.705926481620406 24.15603900975244 60 25.206301575393848 26.30657664416104 24.23105776444111 24.256064016004 61 25.93148287071768 25.55638909727432 24.50612653163291 24.006001500375092 62 27.38184546136534 24.731182795698924 24.656164041010253 23.23080770192548 63 25.85646411602901 26.03150787696924 24.131032758189548 23.980995248812203 64 26.60665166291573 25.406351587896975 24.5311327831958 23.455863965991497 65 27.131782945736433 24.681170292573142 24.88122030507627 23.305826456614152 66 26.803607214428858 26.127254509018037 24.599198396793586 22.46993987975952 67 25.819465456379227 26.021180030257185 24.8613212304589 23.29803328290469 68 26.959896507115133 24.0620957309185 24.553686934023286 24.42432082794308 69 26.882320133853877 20.07808142777468 28.137200223089792 24.90239821528165 70 28.427719821162444 0.0 36.25186289120715 35.3204172876304 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 2.0 25 3.0 26 4.5 27 6.0 28 8.0 29 11.5 30 13.0 31 17.5 32 28.5 33 35.0 34 43.5 35 58.0 36 90.5 37 117.0 38 123.0 39 152.5 40 176.0 41 186.0 42 200.0 43 204.0 44 236.0 45 273.5 46 267.5 47 256.0 48 264.5 49 242.0 50 211.0 51 200.0 52 184.5 53 180.0 54 159.5 55 144.5 56 146.5 57 143.0 58 130.0 59 103.0 60 89.0 61 89.5 62 91.0 63 92.0 64 83.0 65 77.0 66 79.5 67 79.0 68 73.0 69 63.5 70 60.0 71 53.5 72 40.0 73 33.0 74 25.0 75 12.0 76 7.5 77 8.0 78 8.0 79 6.5 80 5.0 81 4.0 82 2.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.2 67 0.8500000000000001 68 3.375 69 10.35 70 32.9 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.5037783375314862 1.0 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGANNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402471 spots for ERR5052690.sra Written 402471 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra Read 402467 spots for ERR5052690.sra Written 402467 spots for ERR5052690.sra SRR ids: ['ERR5052690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__d9oc4ee ERR5052690.sra spots: 8049344 blocks: [[1, 402467], [402468, 804934], [804935, 1207401], [1207402, 1609868], [1609869, 2012335], [2012336, 2414802], [2414803, 2817269], [2817270, 3219736], [3219737, 3622203], [3622204, 4024670], [4024671, 4427137], [4427138, 4829604], [4829605, 5232071], [5232072, 5634538], [5634539, 6037005], [6037006, 6439472], [6439473, 6841939], [6841940, 7244406], [7244407, 7646873], [7646874, 8049344]] ERR5052690 file size 1428475 ERR5052690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052690 ERR5052690_1.fastq ERR5052690_2.fastq Input file: ERR5052690_1.fastq Paired file: ERR5052690_2.fastq trimmed: ERR5052690-trimmed-pair1.fastq, ERR5052690-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:32:34 2024 >> started Tue Dec 10 05:32:41 2024 >> done (6.879s) 8049344 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 2307 ( 0.03%) empty read pairs filtered out after trimming by size control 8047037 (99.97%) read pairs available; of these: 20 ( 0.00%) trimmed read pairs available after processing 8047017 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 42 1 0.00% 43 0 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 2 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 14 0.00% 70 8047017 100.00% 8047037 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=21 prefix-density=0.16 prefix-fanout=2.3 sequence=CAAGTTCATCATGATTAATGGACTAACAGTTACAAGGGTTGCACTTGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=193.52 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=23.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=2.0 sequence=GAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAGAAACAGGAGCAGTTCGAGATGGCCGGCGTGTCCGGCGAAGGGTGCAGCTGCGGCGACAACTGCAAGTGCAACCCTTGTAACTGTTAGTCCATTAATCATGATGAACTTGTGGTTAGTAAATAAGCGCCGAGTCAGAGCGTGTGGTGTGATTGTGTTGTTGTTTACTTGCTCTTAATTGGTGTATCCTTCCTTGTGAGTATGTATGTATCTGTGTGTCTGTGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=229.02 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=20.6 sequence=CGCCGCCGCCGA ERR5052690 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:33:17 Started mapping on | Dec 10 05:33:17 Finished on | Dec 10 05:33:33 Mapping speed, Million of reads per hour | 1810.58 Number of input reads | 8047037 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 7753144 Uniquely mapped reads % | 96.35% Average mapped length | 138.74 Number of splices: Total | 3944365 Number of splices: Annotated (sjdb) | 3750149 Number of splices: GT/AG | 3892878 Number of splices: GC/AG | 45575 Number of splices: AT/AC | 2071 Number of splices: Non-canonical | 3841 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128003 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 20750 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 165890 165890 165890 N_multimapping 128003 128003 128003 N_noFeature 275813 7568340 324398 N_ambiguous 160764 705 24883 UnstrandedReadsAssigned:7316567 PositiveStrandReadsAssigned:184099 NegativeStrandReadsAssigned:7403863 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052690 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052690-trimmed-pair1.fastq ERR5052690-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,047,037 reads, 7,508,618 reads pseudoaligned [quant] estimated average fragment length: 183.335 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52973 ERR5052690.ke.tsv 35125 ERR5052690.se.tsv 88098 total ==> ERR5052690.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 754.037 0 0 PNS24247 1044 861.665 32.3775 7.73418 PNS24249 1928 1745.67 46.5573 5.48955 PNS24246 1044 861.665 32.3775 7.73418 PNS24248 1044 861.665 32.3775 7.73418 PNS24244 1471 1288.67 47.3102 7.55655 PNS24243 293 126.792 0 0 KQK14069 1603 1420.67 8186.92 1186.15 KQK14071 474 295.112 311.708 217.405 ==> ERR5052690.se.tsv <== BRADI_1g14170v3 9305 BRADI_1g53295v3 53 BRADI_1g59795v3 327 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 373 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 265 BRADI_1g48960v3 0 ERR5052690 completed mapping pipeline successfully