Starting /dee2/code/volunteer_pipeline.sh ERR5052691 current disk space = 1526767284224 free memory = 1515864944 ERR5052691 SRAfilesize 2bec115e5cf39cef7c4c4147df36d38a ERR5052691.sra ERR5052691.sra file validated ERR5052691 is paired end ERR5052691 is conventional basespace ERR5052691 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052691_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.26775 35.0 35.0 35.0 35.0 35.0 2 34.658 35.0 35.0 35.0 35.0 35.0 3 34.6965 35.0 35.0 35.0 35.0 35.0 4 34.7195 35.0 35.0 35.0 35.0 35.0 5 34.74275 35.0 35.0 35.0 35.0 35.0 6 39.56325 40.0 40.0 40.0 39.0 40.0 7 39.57375 40.0 40.0 40.0 39.0 40.0 8 39.50175 40.0 40.0 40.0 39.0 40.0 9 39.54275 40.0 40.0 40.0 39.0 40.0 10 39.53125 40.0 40.0 40.0 39.0 40.0 11 39.46525 40.0 40.0 40.0 39.0 40.0 12 39.469 40.0 40.0 40.0 39.0 40.0 13 39.49725 40.0 40.0 40.0 39.0 40.0 14 39.4935 40.0 40.0 40.0 39.0 40.0 15 39.447 40.0 40.0 40.0 39.0 40.0 16 39.445 40.0 40.0 40.0 39.0 40.0 17 39.43375 40.0 40.0 40.0 39.0 40.0 18 39.44525 40.0 40.0 40.0 39.0 40.0 19 39.47875 40.0 40.0 40.0 39.0 40.0 20 39.471 40.0 40.0 40.0 39.0 40.0 21 39.49025 40.0 40.0 40.0 39.0 40.0 22 39.40325 40.0 40.0 40.0 39.0 40.0 23 39.42575 40.0 40.0 40.0 39.0 40.0 24 39.388 40.0 40.0 40.0 39.0 40.0 25 39.42425 40.0 40.0 40.0 39.0 40.0 26 39.4425 40.0 40.0 40.0 39.0 40.0 27 39.39425 40.0 40.0 40.0 39.0 40.0 28 39.42575 40.0 40.0 40.0 39.0 40.0 29 39.32875 40.0 40.0 40.0 39.0 40.0 30 39.4205 40.0 40.0 40.0 39.0 40.0 31 39.4045 40.0 40.0 40.0 39.0 40.0 32 39.42025 40.0 40.0 40.0 39.0 40.0 33 39.41525 40.0 40.0 40.0 39.0 40.0 34 39.4165 40.0 40.0 40.0 39.0 40.0 35 39.42475 40.0 40.0 40.0 39.0 40.0 36 39.462 40.0 40.0 40.0 39.0 40.0 37 39.43525 40.0 40.0 40.0 39.0 40.0 38 39.39125 40.0 40.0 40.0 39.0 40.0 39 39.4095 40.0 40.0 40.0 39.0 40.0 40 39.42 40.0 40.0 40.0 39.0 40.0 41 39.36025 40.0 40.0 40.0 39.0 40.0 42 39.32375 40.0 40.0 40.0 39.0 40.0 43 39.36475 40.0 40.0 40.0 39.0 40.0 44 39.40075 40.0 40.0 40.0 39.0 40.0 45 39.4025 40.0 40.0 40.0 39.0 40.0 46 39.3895 40.0 40.0 40.0 39.0 40.0 47 39.35 40.0 40.0 40.0 39.0 40.0 48 39.38375 40.0 40.0 40.0 39.0 40.0 49 39.43775 40.0 40.0 40.0 39.0 40.0 50 39.46475 40.0 40.0 40.0 39.0 40.0 51 39.40775 40.0 40.0 40.0 39.0 40.0 52 39.37675 40.0 40.0 40.0 39.0 40.0 53 39.34425 40.0 40.0 40.0 39.0 40.0 54 39.378 40.0 40.0 40.0 39.0 40.0 55 39.3755 40.0 40.0 40.0 39.0 40.0 56 39.39175 40.0 40.0 40.0 39.0 40.0 57 39.32775 40.0 40.0 40.0 39.0 40.0 58 39.32825 40.0 40.0 40.0 39.0 40.0 59 39.37 40.0 40.0 40.0 39.0 40.0 60 39.3925 40.0 40.0 40.0 39.0 40.0 61 39.36825 40.0 40.0 40.0 39.0 40.0 62 39.36875 40.0 40.0 40.0 39.0 40.0 63 39.349 40.0 40.0 40.0 39.0 40.0 64 39.3185 40.0 40.0 40.0 39.0 40.0 65 39.3465 40.0 40.0 40.0 39.0 40.0 66 39.3845 40.0 40.0 40.0 39.0 40.0 67 39.328 40.0 40.0 40.0 39.0 40.0 68 39.3605 40.0 40.0 40.0 39.0 40.0 69 39.39775 40.0 40.0 40.0 39.0 40.0 70 39.3445 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 7.0 27 5.0 28 12.0 29 8.0 30 14.0 31 18.0 32 29.0 33 26.0 34 40.0 35 42.0 36 65.0 37 95.0 38 221.0 39 3416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.11752786220871 9.219858156028367 8.713272543059777 49.949341438703144 2 22.175 12.55 36.075 29.2 3 20.200000000000003 16.35 23.775 39.675 4 27.750000000000004 22.875 20.925 28.449999999999996 5 26.85 29.025000000000002 23.05 21.075 6 22.650000000000002 30.425 25.324999999999996 21.6 7 19.0 23.849999999999998 38.125 19.025 8 18.675 23.65 32.475 25.2 9 19.1 20.9 34.725 25.275 10 21.7 32.925 25.1 20.275000000000002 11 23.775 25.224999999999998 23.575 27.425 12 22.25 22.725 27.125 27.900000000000002 13 22.400000000000002 24.2 27.3 26.1 14 22.225 23.45 28.825 25.5 15 22.15 24.6 25.825 27.425 16 22.95 25.674999999999997 24.55 26.825 17 22.35 24.875 26.424999999999997 26.35 18 23.474999999999998 23.95 25.974999999999998 26.6 19 23.599999999999998 25.374999999999996 25.924999999999997 25.1 20 23.25 25.05 26.150000000000002 25.55 21 24.05 24.175 26.35 25.424999999999997 22 22.5 25.224999999999998 26.325 25.95 23 22.725 25.074999999999996 26.924999999999997 25.275 24 22.5 25.724999999999998 25.874999999999996 25.900000000000002 25 23.175 24.575 26.6 25.650000000000002 26 23.5 24.85 26.150000000000002 25.5 27 23.45 25.074999999999996 25.4 26.075 28 23.175 24.85 25.5 26.474999999999998 29 22.3 25.95 27.05 24.7 30 22.725 25.275 25.8 26.200000000000003 31 23.674999999999997 25.674999999999997 24.375 26.275 32 23.575 26.075 25.05 25.3 33 22.225 25.025 25.650000000000002 27.1 34 22.975 25.275 25.674999999999997 26.075 35 22.6 25.374999999999996 26.724999999999998 25.3 36 22.400000000000002 24.825 26.35 26.424999999999997 37 23.425 25.55 25.674999999999997 25.35 38 21.525 26.174999999999997 26.400000000000002 25.900000000000002 39 22.45 25.474999999999998 25.95 26.125 40 23.150000000000002 24.349999999999998 24.75 27.750000000000004 41 23.5 25.6 26.1 24.8 42 23.400000000000002 24.3 25.924999999999997 26.375 43 22.650000000000002 24.425 27.250000000000004 25.674999999999997 44 23.275000000000002 24.6 25.900000000000002 26.224999999999998 45 23.05 24.45 25.775 26.724999999999998 46 23.075000000000003 26.200000000000003 24.725 26.0 47 24.175 24.65 25.35 25.825 48 24.075 23.9 25.25 26.775 49 22.35 25.7 25.874999999999996 26.075 50 23.825 23.95 26.174999999999997 26.05 51 22.1 24.725 25.45 27.725 52 22.375 25.35 26.450000000000003 25.825 53 23.1 24.85 26.674999999999997 25.374999999999996 54 22.725 24.474999999999998 25.45 27.35 55 22.925 26.325 25.025 25.724999999999998 56 23.275000000000002 25.825 25.05 25.85 57 22.95 26.224999999999998 25.224999999999998 25.6 58 24.0 25.224999999999998 24.95 25.825 59 23.125 25.85 26.075 24.95 60 22.48062015503876 24.981245311327832 26.331582895723933 26.206551637909474 61 23.40585146286572 24.056014003500874 26.131532883220803 26.406601650412604 62 22.680670167541887 26.056514128532132 26.30657664416104 24.956239059764943 63 22.930732683170792 24.731182795698924 25.30632658164541 27.031757939484873 64 24.518388791593697 25.369026770077557 24.36827620715537 25.74430823117338 65 23.617713284963724 25.143857893420062 25.494120590442833 25.74430823117338 66 24.63078848560701 25.131414267834796 25.256570713391742 24.98122653316646 67 22.409456740442657 25.32696177062374 25.67907444668008 26.58450704225352 68 23.518850987432675 25.05770710438574 25.18594511413183 26.237496794049758 69 24.176728869374315 19.237102085620197 27.799121844127335 28.787047200878156 70 25.95978062157221 0.0 35.6855575868373 38.354661791590495 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.5 26 2.5 27 1.0 28 4.5 29 10.0 30 12.0 31 15.5 32 27.5 33 36.0 34 45.0 35 60.5 36 91.0 37 115.0 38 144.0 39 174.5 40 176.0 41 214.0 42 257.0 43 262.0 44 279.0 45 281.0 46 268.5 47 271.0 48 266.5 49 244.5 50 227.0 51 226.0 52 193.5 53 162.0 54 157.0 55 137.5 56 114.0 57 105.0 58 103.0 59 91.5 60 82.0 61 83.5 62 79.0 63 73.0 64 72.5 65 78.0 66 65.5 67 47.0 68 49.0 69 47.0 70 43.0 71 39.0 72 26.5 73 18.0 74 18.0 75 12.0 76 7.5 77 9.0 78 5.0 79 2.0 80 3.0 81 2.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.025 62 0.025 63 0.025 64 0.075 65 0.075 66 0.125 67 0.6 68 2.5250000000000004 69 8.9 70 31.624999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052691 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052691_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.55925 35.0 35.0 35.0 35.0 35.0 2 34.55775 35.0 35.0 35.0 35.0 35.0 3 34.44475 35.0 35.0 35.0 34.0 35.0 4 34.46725 35.0 35.0 35.0 34.0 35.0 5 34.49075 35.0 35.0 35.0 35.0 35.0 6 39.24775 40.0 40.0 40.0 39.0 40.0 7 39.30375 40.0 40.0 40.0 39.0 40.0 8 39.18475 40.0 40.0 40.0 39.0 40.0 9 39.1795 40.0 40.0 40.0 39.0 40.0 10 39.262 40.0 40.0 40.0 39.0 40.0 11 39.24725 40.0 40.0 40.0 39.0 40.0 12 39.29225 40.0 40.0 40.0 39.0 40.0 13 39.2645 40.0 40.0 40.0 39.0 40.0 14 39.2485 40.0 40.0 40.0 39.0 40.0 15 39.2515 40.0 40.0 40.0 39.0 40.0 16 39.266 40.0 40.0 40.0 39.0 40.0 17 39.19025 40.0 40.0 40.0 39.0 40.0 18 39.21325 40.0 40.0 40.0 39.0 40.0 19 39.30575 40.0 40.0 40.0 39.0 40.0 20 39.3555 40.0 40.0 40.0 39.0 40.0 21 39.2355 40.0 40.0 40.0 39.0 40.0 22 39.26725 40.0 40.0 40.0 39.0 40.0 23 39.2855 40.0 40.0 40.0 39.0 40.0 24 39.26375 40.0 40.0 40.0 39.0 40.0 25 39.26175 40.0 40.0 40.0 39.0 40.0 26 39.2715 40.0 40.0 40.0 39.0 40.0 27 39.26625 40.0 40.0 40.0 39.0 40.0 28 39.23175 40.0 40.0 40.0 39.0 40.0 29 39.24925 40.0 40.0 40.0 39.0 40.0 30 39.27525 40.0 40.0 40.0 39.0 40.0 31 39.266 40.0 40.0 40.0 39.0 40.0 32 39.257 40.0 40.0 40.0 39.0 40.0 33 39.3055 40.0 40.0 40.0 39.0 40.0 34 39.263 40.0 40.0 40.0 39.0 40.0 35 39.2305 40.0 40.0 40.0 39.0 40.0 36 39.2185 40.0 40.0 40.0 39.0 40.0 37 39.2305 40.0 40.0 40.0 39.0 40.0 38 39.28125 40.0 40.0 40.0 39.0 40.0 39 39.26125 40.0 40.0 40.0 39.0 40.0 40 39.27325 40.0 40.0 40.0 39.0 40.0 41 39.21975 40.0 40.0 40.0 39.0 40.0 42 39.22825 40.0 40.0 40.0 39.0 40.0 43 39.1635 40.0 40.0 40.0 39.0 40.0 44 39.184 40.0 40.0 40.0 39.0 40.0 45 39.2325 40.0 40.0 40.0 39.0 40.0 46 39.29175 40.0 40.0 40.0 39.0 40.0 47 39.195 40.0 40.0 40.0 39.0 40.0 48 39.2195 40.0 40.0 40.0 39.0 40.0 49 39.21375 40.0 40.0 40.0 39.0 40.0 50 39.15075 40.0 40.0 40.0 39.0 40.0 51 39.2 40.0 40.0 40.0 39.0 40.0 52 39.134 40.0 40.0 40.0 39.0 40.0 53 39.266 40.0 40.0 40.0 39.0 40.0 54 39.1875 40.0 40.0 40.0 39.0 40.0 55 39.174 40.0 40.0 40.0 39.0 40.0 56 39.148 40.0 40.0 40.0 39.0 40.0 57 39.16625 40.0 40.0 40.0 39.0 40.0 58 39.20325 40.0 40.0 40.0 39.0 40.0 59 39.14425 40.0 40.0 40.0 39.0 40.0 60 39.19875 40.0 40.0 40.0 39.0 40.0 61 39.14525 40.0 40.0 40.0 39.0 40.0 62 39.199 40.0 40.0 40.0 39.0 40.0 63 39.15025 40.0 40.0 40.0 39.0 40.0 64 39.11025 40.0 40.0 40.0 39.0 40.0 65 39.11075 40.0 40.0 40.0 39.0 40.0 66 39.04975 40.0 40.0 40.0 39.0 40.0 67 39.10375 40.0 40.0 40.0 39.0 40.0 68 39.14975 40.0 40.0 40.0 39.0 40.0 69 39.15825 40.0 40.0 40.0 39.0 40.0 70 39.14575 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 2.0 20 8.0 21 4.0 22 9.0 23 13.0 24 10.0 25 5.0 26 4.0 27 11.0 28 11.0 29 12.0 30 16.0 31 14.0 32 16.0 33 21.0 34 31.0 35 52.0 36 57.0 37 103.0 38 189.0 39 3409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.725 16.675 12.675 39.925 2 27.325 23.7 30.275000000000002 18.7 3 21.375 25.7 26.25 26.674999999999997 4 25.474999999999998 30.95 21.325 22.25 5 27.400000000000002 32.9 20.849999999999998 18.85 6 22.15 34.275 21.65 21.925 7 22.575 17.825 35.375 24.224999999999998 8 22.925 22.875 26.424999999999997 27.775 9 23.175 22.8 27.575 26.450000000000003 10 24.0 31.324999999999996 23.724999999999998 20.95 11 27.125 23.9 22.175 26.8 12 25.650000000000002 22.400000000000002 25.7 26.25 13 24.8 23.599999999999998 25.224999999999998 26.375 14 25.224999999999998 25.575 24.575 24.625 15 23.925 26.125 25.874999999999996 24.075 16 26.85 25.1 24.2 23.849999999999998 17 26.25 25.424999999999997 22.650000000000002 25.674999999999997 18 25.900000000000002 24.625 24.5 24.975 19 24.45 25.05 25.0 25.5 20 27.725 25.95 22.875 23.45 21 24.5 25.1 25.825 24.575 22 25.35 25.2 24.8 24.65 23 26.174999999999997 25.95 23.95 23.925 24 24.8 25.55 24.825 24.825 25 25.825 24.925 24.825 24.425 26 26.150000000000002 25.25 23.425 25.174999999999997 27 24.55 26.075 25.224999999999998 24.15 28 25.624999999999996 24.75 24.275 25.35 29 25.424999999999997 25.825 23.925 24.825 30 26.375 25.45 23.799999999999997 24.375 31 25.674999999999997 24.425 26.3 23.599999999999998 32 25.900000000000002 25.900000000000002 24.45 23.75 33 24.575 26.525 25.424999999999997 23.474999999999998 34 25.374999999999996 25.374999999999996 25.75 23.5 35 26.05 26.075 23.925 23.95 36 25.6 25.974999999999998 25.5 22.925 37 27.175 24.8 24.175 23.849999999999998 38 25.95 25.224999999999998 24.4 24.425 39 26.450000000000003 25.650000000000002 24.675 23.225 40 27.325 23.95 22.875 25.85 41 26.375 25.374999999999996 23.974999999999998 24.275 42 25.424999999999997 25.650000000000002 24.825 24.099999999999998 43 26.424999999999997 25.275 24.95 23.35 44 25.924999999999997 26.1 23.5 24.474999999999998 45 26.5 23.825 25.174999999999997 24.5 46 25.074999999999996 24.6 25.95 24.375 47 26.275 25.874999999999996 24.099999999999998 23.75 48 26.075 24.349999999999998 25.624999999999996 23.95 49 25.900000000000002 25.45 24.325 24.325 50 25.6 24.875 25.124999999999996 24.4 51 25.674999999999997 25.6 25.35 23.375 52 25.575 24.05 26.450000000000003 23.925 53 26.8 26.0 23.9 23.3 54 25.6 25.525 25.174999999999997 23.7 55 26.825 24.55 24.775 23.849999999999998 56 26.575 25.85 23.400000000000002 24.175 57 24.75 26.625 25.0 23.625 58 25.85 24.975 24.45 24.725 59 26.700000000000003 24.85 24.099999999999998 24.349999999999998 60 24.23711855927964 26.43821910955478 25.312656328164078 24.012006003001503 61 25.619214410808105 25.21891418563923 24.843632724543408 24.31823867900926 62 27.695771828871653 25.41906429822367 24.64348261195897 22.241681260945708 63 26.945208906680012 25.444083062296723 24.34325744308231 23.267450587940957 64 25.45045045045045 25.575575575575577 24.5995995995996 24.374374374374376 65 26.9837296620776 24.80600750938673 24.705882352941178 23.504380475594495 66 27.83763467802556 24.40491104986219 24.53019293410173 23.227261338010525 67 26.008064516129032 24.949596774193548 25.50403225806452 23.538306451612904 68 27.12215320910973 23.86128364389234 24.948240165631468 24.06832298136646 69 25.499445061043286 20.39400665926748 27.27524972253052 26.83129855715871 70 27.663551401869157 0.0 36.52336448598131 35.81308411214953 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 2.5 26 4.5 27 4.0 28 4.5 29 10.0 30 15.0 31 17.0 32 22.5 33 26.0 34 39.5 35 71.0 36 100.0 37 111.0 38 139.0 39 170.5 40 174.0 41 188.0 42 226.0 43 250.0 44 258.0 45 274.0 46 270.0 47 258.0 48 256.5 49 220.5 50 186.0 51 189.5 52 183.0 53 173.0 54 171.0 55 154.0 56 124.5 57 110.0 58 108.5 59 107.5 60 108.0 61 103.0 62 88.5 63 79.0 64 83.0 65 78.5 66 67.5 67 65.0 68 67.5 69 58.5 70 47.0 71 41.0 72 31.5 73 28.0 74 22.5 75 16.5 76 12.5 77 9.0 78 6.0 79 3.0 80 3.0 81 3.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.05 61 0.075 62 0.075 63 0.075 64 0.1 65 0.125 66 0.22499999999999998 67 0.8 68 3.4000000000000004 69 9.9 70 33.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.5032712632108707 1.0 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413254 spots for ERR5052691.sra Written 413254 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra Read 413244 spots for ERR5052691.sra Written 413244 spots for ERR5052691.sra SRR ids: ['ERR5052691.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j2t36u6i ERR5052691.sra spots: 8264890 blocks: [[1, 413244], [413245, 826488], [826489, 1239732], [1239733, 1652976], [1652977, 2066220], [2066221, 2479464], [2479465, 2892708], [2892709, 3305952], [3305953, 3719196], [3719197, 4132440], [4132441, 4545684], [4545685, 4958928], [4958929, 5372172], [5372173, 5785416], [5785417, 6198660], [6198661, 6611904], [6611905, 7025148], [7025149, 7438392], [7438393, 7851636], [7851637, 8264890]] ERR5052691 file size 1466785 ERR5052691 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052691 ERR5052691_1.fastq ERR5052691_2.fastq Input file: ERR5052691_1.fastq Paired file: ERR5052691_2.fastq trimmed: ERR5052691-trimmed-pair1.fastq, ERR5052691-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:29:02 2024 >> started Tue Dec 10 08:33:21 2024 >> done (258.955s) 8264890 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 2455 ( 0.03%) empty read pairs filtered out after trimming by size control 8262435 (99.97%) read pairs available; of these: 42 ( 0.00%) trimmed read pairs available after processing 8262393 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 36 0.00% 70 8262393 100.00% 8262435 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=16 prefix-density=0.16 prefix-fanout=2.3 sequence=CAAGTTCATCATGATTAATGGACTAACAGTTACAAGGGTTGCACTTGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=212.66 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=23.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=2.0 sequence=GAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAGAAACAGGAGCAGTTCGAGATGGCCGGCGTGTCCGGCGAAGGGTGCAGCTGCGGCGACAACTGCAAGTGCAACCCTTGTAACTGTTAGTCCATTAATCATGATGAACTTGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=228.80 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=20.6 sequence=CGCCGCCGCCGA ERR5052691 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:40:16 Started mapping on | Dec 10 08:40:16 Finished on | Dec 10 08:44:36 Mapping speed, Million of reads per hour | 114.40 Number of input reads | 8262435 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 7958595 Uniquely mapped reads % | 96.32% Average mapped length | 138.74 Number of splices: Total | 4053783 Number of splices: Annotated (sjdb) | 3854611 Number of splices: GT/AG | 4000873 Number of splices: GC/AG | 46843 Number of splices: AT/AC | 2124 Number of splices: Non-canonical | 3943 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 131131 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 21404 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 172709 172709 172709 N_multimapping 131131 131131 131131 N_noFeature 284162 7768112 334302 N_ambiguous 165602 687 25574 UnstrandedReadsAssigned:7508831 PositiveStrandReadsAssigned:189796 NegativeStrandReadsAssigned:7598719 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052691 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052691-trimmed-pair1.fastq ERR5052691-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,262,435 reads, 7,707,743 reads pseudoaligned [quant] estimated average fragment length: 184.33 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 ERR5052691.ke.tsv 35125 ERR5052691.se.tsv 88098 total ==> ERR5052691.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.969 5.52771e-06 1.47403e-06 PNS24247 1044 860.67 33.5415 7.82499 PNS24249 1928 1744.67 42.6088 4.9037 PNS24246 1044 860.67 33.5415 7.82499 PNS24248 1044 860.67 33.5415 7.82499 PNS24244 1471 1287.67 32.7666 5.10934 PNS24243 293 126.383 0 0 KQK14069 1603 1419.67 8371.78 1184.04 KQK14071 474 293.954 279.058 190.613 ==> ERR5052691.se.tsv <== BRADI_1g14170v3 9512 BRADI_1g53295v3 70 BRADI_1g59795v3 369 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 395 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 248 BRADI_1g48960v3 0 ERR5052691 completed mapping pipeline successfully