Starting /dee2/code/volunteer_pipeline.sh ERR5052692 current disk space = 1526796001280 free memory = 1592342488 ERR5052692 SRAfilesize e76781dc10ee7f1c4b826d442a6b22af ERR5052692.sra ERR5052692.sra file validated ERR5052692 is paired end ERR5052692 is conventional basespace ERR5052692 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052692_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.13975 35.0 35.0 35.0 34.0 35.0 2 34.543 35.0 35.0 35.0 34.0 35.0 3 34.6355 35.0 35.0 35.0 35.0 35.0 4 34.69875 35.0 35.0 35.0 35.0 35.0 5 34.6765 35.0 35.0 35.0 35.0 35.0 6 39.4565 40.0 40.0 40.0 39.0 40.0 7 39.48075 40.0 40.0 40.0 39.0 40.0 8 39.45325 40.0 40.0 40.0 39.0 40.0 9 39.40825 40.0 40.0 40.0 39.0 40.0 10 39.4485 40.0 40.0 40.0 39.0 40.0 11 39.46075 40.0 40.0 40.0 39.0 40.0 12 39.412 40.0 40.0 40.0 39.0 40.0 13 39.43125 40.0 40.0 40.0 39.0 40.0 14 39.41025 40.0 40.0 40.0 39.0 40.0 15 39.37925 40.0 40.0 40.0 39.0 40.0 16 39.39275 40.0 40.0 40.0 39.0 40.0 17 39.38425 40.0 40.0 40.0 39.0 40.0 18 39.43025 40.0 40.0 40.0 39.0 40.0 19 39.41975 40.0 40.0 40.0 39.0 40.0 20 39.41025 40.0 40.0 40.0 39.0 40.0 21 39.37675 40.0 40.0 40.0 39.0 40.0 22 39.356 40.0 40.0 40.0 39.0 40.0 23 39.3285 40.0 40.0 40.0 39.0 40.0 24 39.2775 40.0 40.0 40.0 39.0 40.0 25 39.34825 40.0 40.0 40.0 39.0 40.0 26 39.318 40.0 40.0 40.0 39.0 40.0 27 39.40875 40.0 40.0 40.0 39.0 40.0 28 39.311 40.0 40.0 40.0 39.0 40.0 29 39.37125 40.0 40.0 40.0 39.0 40.0 30 39.308 40.0 40.0 40.0 39.0 40.0 31 39.3225 40.0 40.0 40.0 39.0 40.0 32 39.33425 40.0 40.0 40.0 39.0 40.0 33 39.359 40.0 40.0 40.0 39.0 40.0 34 39.371 40.0 40.0 40.0 39.0 40.0 35 39.361 40.0 40.0 40.0 39.0 40.0 36 39.33275 40.0 40.0 40.0 39.0 40.0 37 39.3875 40.0 40.0 40.0 39.0 40.0 38 39.318 40.0 40.0 40.0 39.0 40.0 39 39.368 40.0 40.0 40.0 39.0 40.0 40 39.377 40.0 40.0 40.0 39.0 40.0 41 39.25375 40.0 40.0 40.0 39.0 40.0 42 39.27025 40.0 40.0 40.0 39.0 40.0 43 39.31975 40.0 40.0 40.0 39.0 40.0 44 39.31675 40.0 40.0 40.0 39.0 40.0 45 39.33475 40.0 40.0 40.0 39.0 40.0 46 39.36725 40.0 40.0 40.0 39.0 40.0 47 39.2675 40.0 40.0 40.0 39.0 40.0 48 39.244 40.0 40.0 40.0 39.0 40.0 49 39.26925 40.0 40.0 40.0 39.0 40.0 50 39.285 40.0 40.0 40.0 39.0 40.0 51 39.3415 40.0 40.0 40.0 39.0 40.0 52 39.29175 40.0 40.0 40.0 39.0 40.0 53 39.334 40.0 40.0 40.0 39.0 40.0 54 39.25825 40.0 40.0 40.0 39.0 40.0 55 39.30475 40.0 40.0 40.0 39.0 40.0 56 39.3295 40.0 40.0 40.0 39.0 40.0 57 39.34275 40.0 40.0 40.0 39.0 40.0 58 39.261 40.0 40.0 40.0 39.0 40.0 59 39.26625 40.0 40.0 40.0 39.0 40.0 60 39.31175 40.0 40.0 40.0 39.0 40.0 61 39.2435 40.0 40.0 40.0 39.0 40.0 62 39.26875 40.0 40.0 40.0 39.0 40.0 63 39.29225 40.0 40.0 40.0 39.0 40.0 64 39.2655 40.0 40.0 40.0 39.0 40.0 65 39.29275 40.0 40.0 40.0 39.0 40.0 66 39.34925 40.0 40.0 40.0 39.0 40.0 67 39.28925 40.0 40.0 40.0 39.0 40.0 68 39.328 40.0 40.0 40.0 39.0 40.0 69 39.24575 40.0 40.0 40.0 39.0 40.0 70 39.22675 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 5.0 27 6.0 28 4.0 29 18.0 30 17.0 31 23.0 32 22.0 33 27.0 34 50.0 35 60.0 36 84.0 37 105.0 38 258.0 39 3317.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.48614289346555 12.382405288583778 11.416221713704552 39.715230104246125 2 24.65 14.85 30.55 29.95 3 23.075000000000003 21.3 23.724999999999998 31.900000000000002 4 27.250000000000004 27.200000000000003 20.65 24.9 5 25.374999999999996 30.9 22.475 21.25 6 21.675 30.599999999999998 25.974999999999998 21.75 7 18.325 22.650000000000002 35.825 23.200000000000003 8 20.775 22.6 28.7 27.925 9 19.650000000000002 22.75 33.050000000000004 24.55 10 23.35 31.3 22.400000000000002 22.95 11 26.625 22.825 20.474999999999998 30.075000000000003 12 23.175 21.875 26.275 28.675 13 23.974999999999998 23.799999999999997 26.775 25.45 14 22.75 25.624999999999996 26.0 25.624999999999996 15 21.975 24.25 27.250000000000004 26.525 16 23.925 25.15 25.2 25.724999999999998 17 24.2 25.025 25.4 25.374999999999996 18 23.849999999999998 24.7 24.925 26.525 19 23.599999999999998 26.200000000000003 25.85 24.349999999999998 20 23.25 25.25 25.35 26.150000000000002 21 23.200000000000003 25.85 24.65 26.3 22 24.775 24.775 24.025 26.424999999999997 23 23.575 24.675 25.025 26.724999999999998 24 22.875 24.575 25.45 27.1 25 24.175 24.65 24.0 27.175 26 23.05 26.325 25.0 25.624999999999996 27 23.1 26.224999999999998 24.725 25.95 28 23.150000000000002 24.875 25.35 26.625 29 24.05 24.15 25.575 26.224999999999998 30 23.275000000000002 24.825 25.8 26.1 31 24.349999999999998 25.15 24.125 26.375 32 24.4 24.25 24.5 26.85 33 22.05 25.924999999999997 24.7 27.325 34 24.65 23.625 25.2 26.525 35 24.125 25.174999999999997 25.15 25.55 36 23.3 24.6 24.95 27.150000000000002 37 23.625 24.425 24.45 27.500000000000004 38 22.8 25.45 24.349999999999998 27.400000000000002 39 23.65 24.825 24.325 27.200000000000003 40 24.224999999999998 25.275 24.725 25.775 41 24.725 23.674999999999997 25.124999999999996 26.474999999999998 42 21.975 24.675 27.0 26.35 43 23.825 25.05 25.15 25.974999999999998 44 23.825 24.375 25.95 25.85 45 24.05 23.75 25.124999999999996 27.075 46 23.775 24.725 25.025 26.474999999999998 47 22.975 24.875 25.324999999999996 26.825 48 24.4 23.599999999999998 25.6 26.400000000000002 49 24.25 25.2 24.775 25.775 50 23.825 25.525 25.224999999999998 25.424999999999997 51 23.525 24.775 24.825 26.875 52 24.05 25.874999999999996 24.65 25.424999999999997 53 22.15 24.575 26.125 27.150000000000002 54 24.6 23.674999999999997 24.725 27.0 55 24.6 24.125 24.125 27.150000000000002 56 23.799999999999997 26.0 24.65 25.55 57 22.775000000000002 26.075 25.0 26.150000000000002 58 25.224999999999998 24.425 25.374999999999996 24.975 59 23.330832708177045 25.78144536134033 24.85621405351338 26.03150787696924 60 23.10577644411103 23.85596399099775 26.131532883220803 26.906726681670417 61 24.50612653163291 25.85646411602901 23.93098274568642 25.70642660665166 62 23.53088272068017 23.93098274568642 26.081520380095025 26.456614153538382 63 24.012006003001503 24.112056028014006 26.313156578289142 25.56278139069535 64 24.562281140570285 24.662331165582792 24.81240620310155 25.962981490745374 65 24.055068836045056 23.729662077597 25.982478097622025 26.23279098873592 66 22.89942312515676 24.454477050413846 24.931025833960373 27.715073990469026 67 23.953605648008068 24.43267776096823 25.693393847705497 25.920322743318202 68 24.377726456248396 23.325635103926096 25.429817808570693 26.86682063125481 69 23.81213952210931 19.417742378467455 27.822026915682507 28.948091183740733 70 25.972582437939977 0.0 35.05001852537977 38.97739903668025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 2.0 26 3.5 27 5.0 28 10.5 29 14.5 30 13.0 31 16.5 32 28.5 33 37.0 34 37.5 35 59.0 36 95.0 37 110.0 38 138.5 39 162.0 40 157.0 41 181.0 42 209.0 43 213.0 44 235.0 45 270.5 46 272.0 47 260.0 48 254.0 49 239.5 50 231.0 51 221.0 52 186.0 53 161.0 54 160.5 55 146.0 56 122.5 57 113.0 58 106.5 59 98.0 60 96.0 61 111.0 62 114.0 63 102.0 64 93.0 65 80.5 66 77.5 67 78.0 68 69.0 69 55.0 70 50.0 71 35.5 72 26.0 73 31.0 74 26.5 75 16.0 76 9.0 77 8.0 78 7.0 79 4.5 80 3.0 81 2.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.025 60 0.025 61 0.025 62 0.025 63 0.05 64 0.05 65 0.125 66 0.325 67 0.8500000000000001 68 2.5749999999999997 69 8.975 70 32.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49647532729104 98.8 2 0.3776435045317221 0.75 3 0.0755287009063444 0.22499999999999998 4 0.025176233635448138 0.1 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052692 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052692_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.416 35.0 35.0 35.0 33.0 35.0 2 34.34075 35.0 35.0 35.0 33.0 35.0 3 34.272 35.0 35.0 35.0 33.0 35.0 4 34.25025 35.0 35.0 35.0 33.0 35.0 5 34.21625 35.0 35.0 35.0 33.0 35.0 6 38.84675 40.0 40.0 40.0 39.0 40.0 7 38.85825 40.0 40.0 40.0 38.0 40.0 8 38.88675 40.0 40.0 40.0 39.0 40.0 9 38.89525 40.0 40.0 40.0 39.0 40.0 10 38.98625 40.0 40.0 40.0 39.0 40.0 11 38.966 40.0 40.0 40.0 39.0 40.0 12 38.98275 40.0 40.0 40.0 39.0 40.0 13 38.92775 40.0 40.0 40.0 39.0 40.0 14 38.969 40.0 40.0 40.0 39.0 40.0 15 38.8825 40.0 40.0 40.0 39.0 40.0 16 38.927 40.0 40.0 40.0 38.0 40.0 17 38.96125 40.0 40.0 40.0 39.0 40.0 18 38.97575 40.0 40.0 40.0 39.0 40.0 19 39.01625 40.0 40.0 40.0 39.0 40.0 20 38.97875 40.0 40.0 40.0 39.0 40.0 21 38.88225 40.0 40.0 40.0 38.0 40.0 22 38.8165 40.0 40.0 40.0 38.0 40.0 23 38.89125 40.0 40.0 40.0 39.0 40.0 24 38.9565 40.0 40.0 40.0 39.0 40.0 25 38.9255 40.0 40.0 40.0 39.0 40.0 26 38.95825 40.0 40.0 40.0 39.0 40.0 27 38.9515 40.0 40.0 40.0 39.0 40.0 28 38.886 40.0 40.0 40.0 39.0 40.0 29 38.93425 40.0 40.0 40.0 39.0 40.0 30 38.94525 40.0 40.0 40.0 39.0 40.0 31 38.92425 40.0 40.0 40.0 39.0 40.0 32 38.89725 40.0 40.0 40.0 39.0 40.0 33 38.90175 40.0 40.0 40.0 38.0 40.0 34 38.965 40.0 40.0 40.0 39.0 40.0 35 38.91375 40.0 40.0 40.0 39.0 40.0 36 38.906 40.0 40.0 40.0 39.0 40.0 37 38.85175 40.0 40.0 40.0 38.0 40.0 38 38.87475 40.0 40.0 40.0 38.0 40.0 39 38.80775 40.0 40.0 40.0 38.0 40.0 40 38.8555 40.0 40.0 40.0 38.0 40.0 41 38.84975 40.0 40.0 40.0 38.0 40.0 42 38.8755 40.0 40.0 40.0 38.0 40.0 43 38.927 40.0 40.0 40.0 38.0 40.0 44 38.90675 40.0 40.0 40.0 38.0 40.0 45 38.8975 40.0 40.0 40.0 39.0 40.0 46 38.8685 40.0 40.0 40.0 39.0 40.0 47 38.88 40.0 40.0 40.0 38.0 40.0 48 38.885 40.0 40.0 40.0 38.0 40.0 49 38.8205 40.0 40.0 40.0 38.0 40.0 50 38.94375 40.0 40.0 40.0 38.0 40.0 51 38.88025 40.0 40.0 40.0 38.0 40.0 52 38.652 40.0 40.0 40.0 37.0 40.0 53 38.82825 40.0 40.0 40.0 38.0 40.0 54 38.77225 40.0 40.0 40.0 38.0 40.0 55 38.79225 40.0 40.0 40.0 38.0 40.0 56 38.844 40.0 40.0 40.0 38.0 40.0 57 38.81775 40.0 40.0 40.0 38.0 40.0 58 38.825 40.0 40.0 40.0 38.0 40.0 59 38.84275 40.0 40.0 40.0 38.0 40.0 60 38.86525 40.0 40.0 40.0 38.0 40.0 61 38.78375 40.0 40.0 40.0 38.0 40.0 62 38.8845 40.0 40.0 40.0 38.0 40.0 63 38.73425 40.0 40.0 40.0 38.0 40.0 64 38.81 40.0 40.0 40.0 38.0 40.0 65 38.77575 40.0 40.0 40.0 38.0 40.0 66 38.75475 40.0 40.0 40.0 38.0 40.0 67 38.82275 40.0 40.0 40.0 38.0 40.0 68 38.7155 40.0 40.0 40.0 37.0 40.0 69 38.8235 40.0 40.0 40.0 38.0 40.0 70 38.67225 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 3.0 18 3.0 19 14.0 20 16.0 21 12.0 22 9.0 23 13.0 24 9.0 25 17.0 26 12.0 27 15.0 28 18.0 29 20.0 30 12.0 31 12.0 32 22.0 33 29.0 34 48.0 35 43.0 36 78.0 37 92.0 38 258.0 39 3243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.6 16.950000000000003 16.675 30.775000000000002 2 30.349999999999998 23.150000000000002 24.975 21.525 3 22.425 25.924999999999997 27.925 23.724999999999998 4 26.125 30.525000000000002 19.775000000000002 23.575 5 28.925 31.874999999999996 18.825 20.375 6 23.025000000000002 31.2 23.25 22.525000000000002 7 23.05 18.65 33.25 25.05 8 24.6 21.775 23.65 29.975 9 21.95 25.15 26.424999999999997 26.474999999999998 10 24.925 29.975 20.349999999999998 24.75 11 29.575000000000003 20.875 21.5 28.050000000000004 12 27.175 20.925 25.4 26.5 13 24.6 24.025 24.725 26.650000000000002 14 25.55 24.0 25.624999999999996 24.825 15 25.224999999999998 24.525 24.3 25.95 16 27.800000000000004 23.0 24.15 25.05 17 26.275 25.0 24.0 24.725 18 25.624999999999996 25.124999999999996 23.875 25.374999999999996 19 27.400000000000002 24.15 23.625 24.825 20 26.025 26.0 24.075 23.9 21 25.924999999999997 24.675 23.625 25.775 22 26.3 24.5 23.35 25.85 23 25.55 24.775 24.825 24.85 24 26.150000000000002 25.5 23.75 24.6 25 27.275 24.125 24.25 24.349999999999998 26 26.575 24.925 23.5 25.0 27 26.25 24.975 24.224999999999998 24.55 28 25.275 24.825 24.25 25.650000000000002 29 26.3 25.324999999999996 23.65 24.725 30 26.450000000000003 24.325 24.725 24.5 31 25.7 24.95 23.825 25.525 32 25.7 24.6 24.075 25.624999999999996 33 26.775 23.775 24.825 24.625 34 25.474999999999998 24.875 23.5 26.150000000000002 35 26.375 25.5 23.200000000000003 24.925 36 25.95 24.65 23.799999999999997 25.6 37 26.174999999999997 25.674999999999997 22.875 25.275 38 26.35 24.474999999999998 24.625 24.55 39 26.6 24.725 24.825 23.849999999999998 40 26.55 25.15 23.075000000000003 25.224999999999998 41 27.250000000000004 24.125 25.0 23.625 42 25.224999999999998 25.374999999999996 24.075 25.324999999999996 43 25.874999999999996 24.175 23.925 26.025 44 26.400000000000002 25.124999999999996 23.549999999999997 24.925 45 26.275 24.3 23.875 25.55 46 25.474999999999998 25.55 23.175 25.8 47 27.025 25.0 23.400000000000002 24.575 48 27.075 25.6 23.549999999999997 23.775 49 26.825 24.425 24.15 24.6 50 26.474999999999998 24.075 24.474999999999998 24.975 51 26.450000000000003 25.15 24.275 24.125 52 26.0 24.925 24.075 25.0 53 28.175 24.224999999999998 23.625 23.974999999999998 54 25.55 25.6 25.0 23.849999999999998 55 26.3 24.05 24.725 24.925 56 26.724999999999998 25.025 23.825 24.425 57 25.95 24.55 24.925 24.575 58 26.224999999999998 24.65 24.55 24.575 59 28.732183045761438 24.131032758189548 23.030757689422355 24.10602650662666 60 25.581395348837212 25.081270317579396 24.956239059764943 24.381095273818453 61 26.9567391847962 25.406351587896975 23.055763940985248 24.58114528632158 62 25.806451612903224 24.60615153788447 24.956239059764943 24.63115778944736 63 26.18809404702351 26.388194097048522 24.937468734367183 22.486243121560783 64 26.43821910955478 25.03751875937969 24.58729364682341 23.936968484242122 65 27.920940705529144 25.168876657493122 23.19239429572179 23.71778834125594 66 25.65905096660808 24.22796886768767 26.03565151895556 24.077328646748683 67 25.531376518218625 24.84817813765182 24.84817813765182 24.772267206477732 68 27.31732507100439 23.392718822618125 25.14846372321198 24.141492383165506 69 26.571268237934902 18.995510662177328 27.300785634118967 27.1324354657688 70 28.841072102680254 0.0 33.78633446583616 37.37259343148358 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 1.5 25 3.5 26 3.5 27 3.0 28 3.5 29 5.0 30 6.0 31 12.5 32 25.0 33 31.0 34 37.0 35 57.0 36 86.5 37 102.0 38 108.0 39 136.0 40 158.0 41 173.0 42 219.5 43 251.0 44 237.0 45 240.0 46 255.5 47 254.0 48 245.0 49 232.0 50 228.0 51 207.5 52 184.5 53 182.0 54 171.5 55 158.0 56 136.0 57 117.0 58 121.0 59 121.0 60 117.0 61 122.0 62 109.5 63 92.0 64 85.0 65 83.5 66 88.0 67 87.0 68 78.0 69 63.5 70 58.0 71 56.0 72 40.5 73 27.0 74 25.5 75 19.5 76 17.0 77 19.0 78 13.5 79 4.5 80 1.0 81 2.5 82 2.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.025 60 0.025 61 0.025 62 0.025 63 0.05 64 0.05 65 0.075 66 0.42500000000000004 67 1.2 68 3.175 69 10.9 70 33.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52141057934509 98.775 2 0.30226700251889166 0.6 3 0.10075566750629722 0.3 4 0.05037783375314861 0.2 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGANNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAACC 20 0.0011002042 80.936165 64 >>END_MODULE Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515795 spots for ERR5052692.sra Written 515795 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra Read 515793 spots for ERR5052692.sra Written 515793 spots for ERR5052692.sra SRR ids: ['ERR5052692.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4szy0qd6 ERR5052692.sra spots: 10315862 blocks: [[1, 515793], [515794, 1031586], [1031587, 1547379], [1547380, 2063172], [2063173, 2578965], [2578966, 3094758], [3094759, 3610551], [3610552, 4126344], [4126345, 4642137], [4642138, 5157930], [5157931, 5673723], [5673724, 6189516], [6189517, 6705309], [6705310, 7221102], [7221103, 7736895], [7736896, 8252688], [8252689, 8768481], [8768482, 9284274], [9284275, 9800067], [9800068, 10315862]] ERR5052692 file size 1831931 ERR5052692 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052692 ERR5052692_1.fastq ERR5052692_2.fastq Input file: ERR5052692_1.fastq Paired file: ERR5052692_2.fastq trimmed: ERR5052692-trimmed-pair1.fastq, ERR5052692-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:09:12 2024 >> started Tue Dec 10 08:09:21 2024 >> done (9.356s) 10315862 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 30 ( 0.00%) empty read pairs filtered out after trimming by size control 10315832 (100.00%) read pairs available; of these: 25 ( 0.00%) trimmed read pairs available after processing 10315807 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 4 0.00% 53 0 0.00% 54 2 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 13 0.00% 70 10315807 100.00% 10315832 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=59.22 fanout-score-rank=3 prefix-density=0.27 prefix-fanout=15.4 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=210.47 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=23.6 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=221.47 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=22.4 sequence=CGCCGCCGCCGG ERR5052692 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:09:46 Started mapping on | Dec 10 08:09:46 Finished on | Dec 10 08:10:16 Mapping speed, Million of reads per hour | 1237.90 Number of input reads | 10315832 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 9718823 Uniquely mapped reads % | 94.21% Average mapped length | 138.76 Number of splices: Total | 4790492 Number of splices: Annotated (sjdb) | 4553897 Number of splices: GT/AG | 4728780 Number of splices: GC/AG | 54671 Number of splices: AT/AC | 2275 Number of splices: Non-canonical | 4766 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.90 Insertion rate per base | 0.00% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 183783 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 49679 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 1.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 413226 413226 413226 N_multimapping 183783 183783 183783 N_noFeature 313734 9483410 373335 N_ambiguous 208494 854 33174 UnstrandedReadsAssigned:9196595 PositiveStrandReadsAssigned:234559 NegativeStrandReadsAssigned:9312314 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052692 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052692-trimmed-pair1.fastq ERR5052692-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,315,832 reads, 9,520,757 reads pseudoaligned [quant] estimated average fragment length: 184.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52973 ERR5052692.ke.tsv 35125 ERR5052692.se.tsv 88098 total ==> ERR5052692.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.142 0.069983 0.0144351 PNS24247 1044 860.909 40.66 7.33694 PNS24249 1928 1744.91 93.5979 8.33293 PNS24246 1044 860.909 40.66 7.33694 PNS24248 1044 860.909 40.66 7.33694 PNS24244 1471 1287.91 26.3522 3.1786 PNS24243 293 122.301 0 0 KQK14069 1603 1419.91 12735.1 1393.3 KQK14071 474 293.194 514.45 272.58 ==> ERR5052692.se.tsv <== BRADI_1g14170v3 14089 BRADI_1g53295v3 59 BRADI_1g59795v3 451 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 448 BRADI_1g74790v3 223 BRADI_1g09890v3 2 BRADI_1g77505v3 293 BRADI_1g48960v3 0 ERR5052692 completed mapping pipeline successfully