Starting /dee2/code/volunteer_pipeline.sh ERR5052695 current disk space = 1525869047808 free memory = 1555341528 ERR5052695 SRAfilesize 3dd38b2d42d06a6ff1b27b5b45bc19be ERR5052695.sra ERR5052695.sra file validated ERR5052695 is paired end ERR5052695 is conventional basespace ERR5052695 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052695_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.30225 35.0 35.0 35.0 35.0 35.0 2 34.555 35.0 35.0 35.0 34.0 35.0 3 34.63275 35.0 35.0 35.0 35.0 35.0 4 34.69975 35.0 35.0 35.0 35.0 35.0 5 34.6695 35.0 35.0 35.0 35.0 35.0 6 39.463 40.0 40.0 40.0 39.0 40.0 7 39.428 40.0 40.0 40.0 39.0 40.0 8 39.4035 40.0 40.0 40.0 39.0 40.0 9 39.42825 40.0 40.0 40.0 39.0 40.0 10 39.39675 40.0 40.0 40.0 39.0 40.0 11 39.41775 40.0 40.0 40.0 39.0 40.0 12 39.382 40.0 40.0 40.0 39.0 40.0 13 39.35025 40.0 40.0 40.0 39.0 40.0 14 39.432 40.0 40.0 40.0 39.0 40.0 15 39.41575 40.0 40.0 40.0 39.0 40.0 16 39.43775 40.0 40.0 40.0 39.0 40.0 17 39.36425 40.0 40.0 40.0 39.0 40.0 18 39.321 40.0 40.0 40.0 39.0 40.0 19 39.39275 40.0 40.0 40.0 39.0 40.0 20 39.4135 40.0 40.0 40.0 39.0 40.0 21 39.385 40.0 40.0 40.0 39.0 40.0 22 39.32625 40.0 40.0 40.0 39.0 40.0 23 39.33775 40.0 40.0 40.0 39.0 40.0 24 39.354 40.0 40.0 40.0 39.0 40.0 25 39.323 40.0 40.0 40.0 39.0 40.0 26 39.304 40.0 40.0 40.0 39.0 40.0 27 39.326 40.0 40.0 40.0 39.0 40.0 28 39.33275 40.0 40.0 40.0 39.0 40.0 29 39.31425 40.0 40.0 40.0 39.0 40.0 30 39.28175 40.0 40.0 40.0 39.0 40.0 31 39.3135 40.0 40.0 40.0 39.0 40.0 32 39.35725 40.0 40.0 40.0 39.0 40.0 33 39.31925 40.0 40.0 40.0 39.0 40.0 34 39.37 40.0 40.0 40.0 39.0 40.0 35 39.363 40.0 40.0 40.0 39.0 40.0 36 39.34175 40.0 40.0 40.0 39.0 40.0 37 39.345 40.0 40.0 40.0 39.0 40.0 38 39.28625 40.0 40.0 40.0 39.0 40.0 39 39.2895 40.0 40.0 40.0 39.0 40.0 40 39.29625 40.0 40.0 40.0 39.0 40.0 41 39.24925 40.0 40.0 40.0 39.0 40.0 42 39.286 40.0 40.0 40.0 39.0 40.0 43 39.37525 40.0 40.0 40.0 39.0 40.0 44 39.3435 40.0 40.0 40.0 39.0 40.0 45 39.2955 40.0 40.0 40.0 39.0 40.0 46 39.284 40.0 40.0 40.0 39.0 40.0 47 39.25 40.0 40.0 40.0 39.0 40.0 48 39.30375 40.0 40.0 40.0 39.0 40.0 49 39.29375 40.0 40.0 40.0 39.0 40.0 50 39.35125 40.0 40.0 40.0 39.0 40.0 51 39.31625 40.0 40.0 40.0 39.0 40.0 52 39.25275 40.0 40.0 40.0 39.0 40.0 53 39.32 40.0 40.0 40.0 39.0 40.0 54 39.29375 40.0 40.0 40.0 39.0 40.0 55 39.2915 40.0 40.0 40.0 39.0 40.0 56 39.346 40.0 40.0 40.0 39.0 40.0 57 39.2105 40.0 40.0 40.0 39.0 40.0 58 39.16825 40.0 40.0 40.0 39.0 40.0 59 39.31325 40.0 40.0 40.0 39.0 40.0 60 39.298 40.0 40.0 40.0 39.0 40.0 61 39.32825 40.0 40.0 40.0 39.0 40.0 62 39.2695 40.0 40.0 40.0 39.0 40.0 63 39.29925 40.0 40.0 40.0 39.0 40.0 64 39.2315 40.0 40.0 40.0 39.0 40.0 65 39.22875 40.0 40.0 40.0 39.0 40.0 66 39.27825 40.0 40.0 40.0 39.0 40.0 67 39.26375 40.0 40.0 40.0 39.0 40.0 68 39.21375 40.0 40.0 40.0 39.0 40.0 69 39.2335 40.0 40.0 40.0 39.0 40.0 70 39.22725 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 6.0 27 6.0 28 11.0 29 13.0 30 18.0 31 28.0 32 27.0 33 36.0 34 46.0 35 58.0 36 55.0 37 130.0 38 238.0 39 3326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.469026548672566 11.327433628318584 11.731984829329962 37.471554993678886 2 23.13078269567392 14.753688422105526 27.93198299574894 34.18354588647162 3 22.175 21.825 23.575 32.425 4 27.6 26.8 20.225 25.374999999999996 5 24.3 31.374999999999996 23.025000000000002 21.3 6 22.275 28.875 26.950000000000003 21.9 7 19.375 21.725 37.425000000000004 21.475 8 20.375 21.65 29.75 28.225 9 21.224999999999998 22.3 31.15 25.324999999999996 10 23.3 30.675 24.4 21.625 11 26.700000000000003 23.375 22.45 27.474999999999998 12 23.724999999999998 21.075 26.700000000000003 28.499999999999996 13 22.45 23.974999999999998 26.724999999999998 26.85 14 22.525000000000002 23.849999999999998 27.200000000000003 26.424999999999997 15 22.175 24.725 26.650000000000002 26.450000000000003 16 24.375 23.5 24.9 27.224999999999998 17 23.775 25.900000000000002 23.724999999999998 26.6 18 24.0 25.275 24.975 25.75 19 24.224999999999998 26.224999999999998 24.775 24.775 20 24.925 25.074999999999996 24.65 25.35 21 23.45 25.1 24.9 26.55 22 22.5 25.025 25.6 26.875 23 23.425 25.25 25.224999999999998 26.1 24 23.1 25.25 25.05 26.6 25 23.925 25.3 25.525 25.25 26 24.25 24.2 26.025 25.525 27 23.65 25.3 24.75 26.3 28 22.775000000000002 24.675 24.875 27.675 29 23.225 24.325 26.200000000000003 26.25 30 23.75 24.825 25.324999999999996 26.1 31 24.15 25.874999999999996 24.25 25.724999999999998 32 23.375 25.224999999999998 26.1 25.3 33 23.175 25.35 25.825 25.650000000000002 34 24.25 25.55 24.8 25.4 35 24.7 23.974999999999998 25.275 26.05 36 22.7 24.775 25.374999999999996 27.150000000000002 37 23.575 25.874999999999996 24.75 25.8 38 23.575 24.55 24.825 27.05 39 22.55 24.9 26.224999999999998 26.325 40 24.075 25.825 23.799999999999997 26.3 41 23.75 24.224999999999998 26.3 25.724999999999998 42 22.8 24.625 26.375 26.200000000000003 43 24.525 24.3 25.35 25.825 44 23.825 23.925 24.8 27.450000000000003 45 22.625 25.424999999999997 24.925 27.025 46 24.8 24.375 25.224999999999998 25.6 47 22.900000000000002 25.45 25.75 25.900000000000002 48 22.45 25.624999999999996 25.2 26.724999999999998 49 24.65 24.325 26.05 24.975 50 24.8 23.75 25.624999999999996 25.825 51 23.799999999999997 24.675 25.374999999999996 26.150000000000002 52 24.2 23.95 26.174999999999997 25.674999999999997 53 24.175 23.200000000000003 25.874999999999996 26.75 54 22.55 23.200000000000003 27.800000000000004 26.450000000000003 55 24.0 24.7 25.525 25.775 56 24.55 24.349999999999998 26.05 25.05 57 23.625 23.9 25.025 27.450000000000003 58 22.5 24.25 26.55 26.700000000000003 59 23.375 25.45 26.025 25.15 60 23.325000000000003 24.975 24.85 26.85 61 24.075 25.874999999999996 24.2 25.85 62 23.5 24.15 25.35 27.0 63 22.875 25.5 25.324999999999996 26.3 64 25.03125781445361 24.656164041010253 24.031007751937985 26.281570392598148 65 23.317488116087066 25.544158118588946 24.143107330497873 26.99524643482612 66 23.414389571321134 24.74304336926548 25.64552519428428 26.197041865129105 67 24.268415741675074 24.72250252270434 24.520686175580224 26.488395560040363 68 24.175257731958762 22.603092783505154 25.309278350515463 27.91237113402062 69 22.702104097452935 19.130675526024362 28.12846068660022 30.03875968992248 70 26.125461254612546 0.0 35.535055350553506 38.33948339483395 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.5 27 7.0 28 9.0 29 12.5 30 14.0 31 20.0 32 34.5 33 43.0 34 41.5 35 63.5 36 98.5 37 110.0 38 120.0 39 153.5 40 177.0 41 192.0 42 213.0 43 219.0 44 245.0 45 272.5 46 271.0 47 268.0 48 250.5 49 229.0 50 225.0 51 206.0 52 189.5 53 192.0 54 173.0 55 151.5 56 134.5 57 120.0 58 118.5 59 115.0 60 113.0 61 106.0 62 94.5 63 90.0 64 82.5 65 73.5 66 64.5 67 57.0 68 60.0 69 53.5 70 44.0 71 41.0 72 32.5 73 27.0 74 25.5 75 18.0 76 9.5 77 7.0 78 5.5 79 4.0 80 4.0 81 3.0 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.125 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.075 66 0.27499999999999997 67 0.8999999999999999 68 3.0 69 9.700000000000001 70 32.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052695 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052695_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4545 35.0 35.0 35.0 34.0 35.0 2 34.296 35.0 35.0 35.0 33.0 35.0 3 34.11575 35.0 35.0 35.0 33.0 35.0 4 34.01975 35.0 35.0 35.0 33.0 35.0 5 34.091 35.0 35.0 35.0 33.0 35.0 6 38.709 40.0 40.0 40.0 38.0 40.0 7 38.66875 40.0 40.0 40.0 38.0 40.0 8 38.6555 40.0 40.0 40.0 37.0 40.0 9 38.711 40.0 40.0 40.0 38.0 40.0 10 38.77675 40.0 40.0 40.0 38.0 40.0 11 38.792 40.0 40.0 40.0 38.0 40.0 12 38.74175 40.0 40.0 40.0 38.0 40.0 13 38.7395 40.0 40.0 40.0 38.0 40.0 14 38.65475 40.0 40.0 40.0 38.0 40.0 15 38.7045 40.0 40.0 40.0 38.0 40.0 16 38.69625 40.0 40.0 40.0 38.0 40.0 17 38.66475 40.0 40.0 40.0 38.0 40.0 18 38.6785 40.0 40.0 40.0 38.0 40.0 19 38.75175 40.0 40.0 40.0 38.0 40.0 20 38.77275 40.0 40.0 40.0 38.0 40.0 21 38.681 40.0 40.0 40.0 38.0 40.0 22 38.6405 40.0 40.0 40.0 38.0 40.0 23 38.73925 40.0 40.0 40.0 38.0 40.0 24 38.71375 40.0 40.0 40.0 38.0 40.0 25 38.69925 40.0 40.0 40.0 38.0 40.0 26 38.70025 40.0 40.0 40.0 38.0 40.0 27 38.6715 40.0 40.0 40.0 38.0 40.0 28 38.656 40.0 40.0 40.0 38.0 40.0 29 38.68275 40.0 40.0 40.0 38.0 40.0 30 38.712 40.0 40.0 40.0 38.0 40.0 31 38.73875 40.0 40.0 40.0 38.0 40.0 32 38.7495 40.0 40.0 40.0 38.0 40.0 33 38.716 40.0 40.0 40.0 38.0 40.0 34 38.71325 40.0 40.0 40.0 38.0 40.0 35 38.65325 40.0 40.0 40.0 37.0 40.0 36 38.61325 40.0 40.0 40.0 38.0 40.0 37 38.63 40.0 40.0 40.0 37.0 40.0 38 38.6705 40.0 40.0 40.0 38.0 40.0 39 38.69175 40.0 40.0 40.0 38.0 40.0 40 38.744 40.0 40.0 40.0 38.0 40.0 41 38.663 40.0 40.0 40.0 38.0 40.0 42 38.6275 40.0 40.0 40.0 38.0 40.0 43 38.6765 40.0 40.0 40.0 38.0 40.0 44 38.60825 40.0 40.0 40.0 37.0 40.0 45 38.6905 40.0 40.0 40.0 38.0 40.0 46 38.69225 40.0 40.0 40.0 38.0 40.0 47 38.634 40.0 40.0 40.0 38.0 40.0 48 38.5935 40.0 40.0 40.0 37.0 40.0 49 38.6455 40.0 40.0 40.0 38.0 40.0 50 38.615 40.0 40.0 40.0 38.0 40.0 51 38.52925 40.0 40.0 40.0 38.0 40.0 52 38.66725 40.0 40.0 40.0 38.0 40.0 53 38.59825 40.0 40.0 40.0 38.0 40.0 54 38.627 40.0 40.0 40.0 38.0 40.0 55 38.661 40.0 40.0 40.0 38.0 40.0 56 38.58125 40.0 40.0 40.0 38.0 40.0 57 38.604 40.0 40.0 40.0 38.0 40.0 58 38.6325 40.0 40.0 40.0 37.0 40.0 59 38.60175 40.0 40.0 40.0 38.0 40.0 60 38.58575 40.0 40.0 40.0 38.0 40.0 61 38.5535 40.0 40.0 40.0 38.0 40.0 62 38.6665 40.0 40.0 40.0 38.0 40.0 63 38.58275 40.0 40.0 40.0 37.0 40.0 64 38.553 40.0 40.0 40.0 37.0 40.0 65 38.5395 40.0 40.0 40.0 38.0 40.0 66 38.54525 40.0 40.0 40.0 37.0 40.0 67 38.563 40.0 40.0 40.0 37.0 40.0 68 38.65775 40.0 40.0 40.0 38.0 40.0 69 38.57425 40.0 40.0 40.0 38.0 40.0 70 38.56425 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 7.0 18 14.0 19 19.0 20 21.0 21 20.0 22 15.0 23 23.0 24 16.0 25 18.0 26 14.0 27 15.0 28 20.0 29 17.0 30 12.0 31 15.0 32 18.0 33 37.0 34 22.0 35 45.0 36 55.0 37 85.0 38 217.0 39 3274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.550000000000004 17.65 15.775 28.025 2 29.25 22.95 24.675 23.125 3 23.45 25.775 26.950000000000003 23.825 4 27.650000000000002 29.2 19.725 23.425 5 27.500000000000004 32.7 19.325 20.474999999999998 6 22.88072018004501 30.657664416104026 23.305826456614152 23.15578894723681 7 23.125 18.7 32.625 25.55 8 23.025000000000002 22.225 25.174999999999997 29.575000000000003 9 23.35 24.95 25.8 25.900000000000002 10 24.7 31.2 20.95 23.150000000000002 11 28.799999999999997 21.85 21.075 28.275 12 25.924999999999997 22.775000000000002 23.674999999999997 27.625 13 25.4 24.15 26.0 24.45 14 25.674999999999997 24.55 24.325 25.45 15 24.7 24.95 25.0 25.35 16 26.450000000000003 24.474999999999998 25.374999999999996 23.7 17 25.900000000000002 23.925 24.55 25.624999999999996 18 25.724999999999998 24.625 26.1 23.549999999999997 19 27.525 24.6 23.875 24.0 20 26.1 25.374999999999996 23.65 24.875 21 25.85 25.2 23.875 25.074999999999996 22 26.85 23.75 24.3 25.1 23 26.625 24.275 23.7 25.4 24 25.874999999999996 25.124999999999996 24.325 24.675 25 24.9 25.4 23.400000000000002 26.3 26 26.575 26.200000000000003 23.400000000000002 23.825 27 26.575 25.35 23.575 24.5 28 27.125 24.625 24.625 23.625 29 25.775 24.6 24.2 25.424999999999997 30 26.275 25.374999999999996 23.775 24.575 31 26.625 24.9 24.224999999999998 24.25 32 26.575 25.174999999999997 23.525 24.725 33 26.25 24.375 24.775 24.6 34 25.974999999999998 25.074999999999996 23.849999999999998 25.1 35 26.650000000000002 24.525 24.45 24.375 36 25.825 24.95 25.224999999999998 24.0 37 26.5 24.575 24.0 24.925 38 25.4 24.15 25.025 25.424999999999997 39 26.3 25.775 23.775 24.15 40 26.025 24.8 24.15 25.025 41 26.6 25.45 23.775 24.175 42 26.05 24.75 24.8 24.4 43 25.900000000000002 24.4 25.05 24.65 44 25.424999999999997 25.05 24.224999999999998 25.3 45 26.575 24.875 25.174999999999997 23.375 46 25.374999999999996 24.75 25.25 24.625 47 28.225 24.425 24.15 23.200000000000003 48 26.35 24.6 25.0 24.05 49 26.525 24.075 24.525 24.875 50 25.85 23.724999999999998 26.075 24.349999999999998 51 25.75 25.85 23.400000000000002 25.0 52 25.650000000000002 24.099999999999998 25.1 25.15 53 26.974999999999998 24.0 24.9 24.125 54 26.5 25.374999999999996 23.1 25.025 55 26.525 24.55 23.974999999999998 24.95 56 26.75 25.174999999999997 24.575 23.5 57 26.700000000000003 24.224999999999998 25.35 23.724999999999998 58 27.250000000000004 24.7 24.175 23.875 59 27.150000000000002 24.7 25.45 22.7 60 25.474999999999998 25.45 25.25 23.825 61 27.05 24.0 24.625 24.325 62 26.3 25.724999999999998 25.174999999999997 22.8 63 27.831957989497376 23.78094523630908 23.93098274568642 24.456114028507127 64 27.93198299574894 24.756189047261813 23.605901475368842 23.705926481620406 65 26.96348174087044 24.512256128064035 24.68734367183592 23.836918459229615 66 25.38847117794486 23.884711779448622 26.516290726817044 24.210526315789473 67 25.196053630154314 23.90589425752593 25.423728813559322 25.47432329876044 68 27.520082923037055 22.622441046903344 24.954651464109872 24.90282456594973 69 26.34965034965035 20.195804195804197 27.076923076923077 26.37762237762238 70 28.27586206896552 0.0 35.440613026819925 36.28352490421456 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.0 25 5.0 26 5.0 27 4.0 28 9.0 29 14.0 30 14.0 31 15.0 32 23.5 33 31.0 34 43.0 35 71.5 36 94.0 37 100.0 38 107.0 39 145.5 40 177.0 41 178.5 42 188.5 43 197.0 44 231.5 45 261.5 46 254.0 47 251.0 48 232.0 49 219.0 50 225.0 51 217.5 52 202.0 53 194.0 54 180.0 55 146.0 56 133.0 57 140.0 58 123.5 59 109.0 60 111.0 61 104.5 62 92.0 63 86.0 64 91.0 65 89.5 66 85.0 67 87.0 68 77.5 69 60.5 70 53.0 71 46.0 72 38.0 73 37.0 74 31.0 75 23.0 76 19.5 77 18.0 78 11.5 79 3.5 80 2.0 81 3.5 82 3.0 83 1.0 84 1.5 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.025 64 0.025 65 0.05 66 0.25 67 1.175 68 3.5249999999999995 69 10.625 70 34.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29310780106034 98.32499999999999 2 0.5806614491290077 1.15 3 0.050492299924261554 0.15 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025246149962130777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGANNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389056 spots for ERR5052695.sra Written 389056 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra Read 389047 spots for ERR5052695.sra Written 389047 spots for ERR5052695.sra SRR ids: ['ERR5052695.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2o7cnjwi ERR5052695.sra spots: 7780949 blocks: [[1, 389047], [389048, 778094], [778095, 1167141], [1167142, 1556188], [1556189, 1945235], [1945236, 2334282], [2334283, 2723329], [2723330, 3112376], [3112377, 3501423], [3501424, 3890470], [3890471, 4279517], [4279518, 4668564], [4668565, 5057611], [5057612, 5446658], [5446659, 5835705], [5835706, 6224752], [6224753, 6613799], [6613800, 7002846], [7002847, 7391893], [7391894, 7780949]] ERR5052695 file size 1380772 ERR5052695 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052695 ERR5052695_1.fastq ERR5052695_2.fastq Input file: ERR5052695_1.fastq Paired file: ERR5052695_2.fastq trimmed: ERR5052695-trimmed-pair1.fastq, ERR5052695-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:33:25 2024 >> started Tue Dec 10 05:33:32 2024 >> done (6.472s) 7780949 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 20 ( 0.00%) empty read pairs filtered out after trimming by size control 7780929 (100.00%) read pairs available; of these: 37 ( 0.00%) trimmed read pairs available after processing 7780892 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 1 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 33 0.00% 70 7780892 100.00% 7780929 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=20 prefix-density=0.13 prefix-fanout=2.9 sequence=GCTGCTGCAGCAACTCTGCCTGGCATCTACTTGGACTGCCTGGTGCTCCAGGAGTAGCCCCAGTATGAGGACGCAGATGATCACACTCTTAATAAGACCATCGTTGCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=5 fanout-score=160.54 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=21.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=204.98 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=21.8 sequence=CGCCGCCGCCGTC ERR5052695 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:34:05 Started mapping on | Dec 10 05:34:05 Finished on | Dec 10 05:34:25 Mapping speed, Million of reads per hour | 1400.57 Number of input reads | 7780929 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 7349653 Uniquely mapped reads % | 94.46% Average mapped length | 138.74 Number of splices: Total | 3569228 Number of splices: Annotated (sjdb) | 3394045 Number of splices: GT/AG | 3523710 Number of splices: GC/AG | 40137 Number of splices: AT/AC | 1695 Number of splices: Non-canonical | 3686 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.89 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 104921 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 14452 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 326355 326355 326355 N_multimapping 104921 104921 104921 N_noFeature 224338 7167392 267930 N_ambiguous 164377 649 26047 UnstrandedReadsAssigned:6960938 PositiveStrandReadsAssigned:181612 NegativeStrandReadsAssigned:7055676 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052695 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052695-trimmed-pair1.fastq ERR5052695-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,780,929 reads, 7,254,606 reads pseudoaligned [quant] estimated average fragment length: 178.64 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52973 ERR5052695.ke.tsv 35125 ERR5052695.se.tsv 88098 total ==> ERR5052695.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.609 0 0 PNS24247 1044 866.36 20.1058 4.66685 PNS24249 1928 1750.36 31.4821 3.61691 PNS24246 1044 866.36 20.1058 4.66685 PNS24248 1044 866.36 20.1058 4.66685 PNS24244 1471 1293.36 50.2005 7.80529 PNS24243 293 124.977 0 0 KQK14069 1603 1425.36 10047 1417.47 KQK14071 474 298.735 417.638 281.135 ==> ERR5052695.se.tsv <== BRADI_1g14170v3 11054 BRADI_1g53295v3 46 BRADI_1g59795v3 359 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 338 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 248 BRADI_1g48960v3 0 ERR5052695 completed mapping pipeline successfully