Starting /dee2/code/volunteer_pipeline.sh ERR5052696 current disk space = 1525927575552 free memory = 1558374248 ERR5052696 SRAfilesize 2b7c74628441eb7e28130fcd55194cf8 ERR5052696.sra ERR5052696.sra file validated ERR5052696 is paired end ERR5052696 is conventional basespace ERR5052696 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052696_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.41525 35.0 35.0 35.0 35.0 35.0 2 34.58875 35.0 35.0 35.0 34.0 35.0 3 34.58625 35.0 35.0 35.0 34.0 35.0 4 34.562 35.0 35.0 35.0 34.0 35.0 5 34.58375 35.0 35.0 35.0 34.0 35.0 6 39.37225 40.0 40.0 40.0 39.0 40.0 7 39.32225 40.0 40.0 40.0 39.0 40.0 8 39.31275 40.0 40.0 40.0 39.0 40.0 9 39.3845 40.0 40.0 40.0 39.0 40.0 10 39.35975 40.0 40.0 40.0 39.0 40.0 11 39.31325 40.0 40.0 40.0 39.0 40.0 12 39.317 40.0 40.0 40.0 39.0 40.0 13 39.3555 40.0 40.0 40.0 39.0 40.0 14 39.3105 40.0 40.0 40.0 39.0 40.0 15 39.305 40.0 40.0 40.0 39.0 40.0 16 39.3035 40.0 40.0 40.0 39.0 40.0 17 39.227 40.0 40.0 40.0 39.0 40.0 18 39.33475 40.0 40.0 40.0 39.0 40.0 19 39.29525 40.0 40.0 40.0 39.0 40.0 20 39.29 40.0 40.0 40.0 39.0 40.0 21 39.3105 40.0 40.0 40.0 39.0 40.0 22 39.26875 40.0 40.0 40.0 39.0 40.0 23 39.25325 40.0 40.0 40.0 39.0 40.0 24 39.23625 40.0 40.0 40.0 39.0 40.0 25 39.33175 40.0 40.0 40.0 39.0 40.0 26 39.22725 40.0 40.0 40.0 39.0 40.0 27 39.24625 40.0 40.0 40.0 39.0 40.0 28 39.30375 40.0 40.0 40.0 39.0 40.0 29 39.22825 40.0 40.0 40.0 39.0 40.0 30 39.27825 40.0 40.0 40.0 39.0 40.0 31 39.255 40.0 40.0 40.0 39.0 40.0 32 39.2705 40.0 40.0 40.0 39.0 40.0 33 39.22425 40.0 40.0 40.0 39.0 40.0 34 39.2135 40.0 40.0 40.0 39.0 40.0 35 39.20125 40.0 40.0 40.0 39.0 40.0 36 39.231 40.0 40.0 40.0 39.0 40.0 37 39.2605 40.0 40.0 40.0 39.0 40.0 38 39.25175 40.0 40.0 40.0 39.0 40.0 39 39.229 40.0 40.0 40.0 39.0 40.0 40 39.25375 40.0 40.0 40.0 39.0 40.0 41 39.173 40.0 40.0 40.0 39.0 40.0 42 39.20675 40.0 40.0 40.0 39.0 40.0 43 39.2595 40.0 40.0 40.0 39.0 40.0 44 39.2715 40.0 40.0 40.0 39.0 40.0 45 39.19075 40.0 40.0 40.0 39.0 40.0 46 39.273 40.0 40.0 40.0 39.0 40.0 47 39.25975 40.0 40.0 40.0 39.0 40.0 48 39.249 40.0 40.0 40.0 39.0 40.0 49 39.214 40.0 40.0 40.0 39.0 40.0 50 39.2785 40.0 40.0 40.0 39.0 40.0 51 39.2045 40.0 40.0 40.0 39.0 40.0 52 39.18325 40.0 40.0 40.0 39.0 40.0 53 39.24275 40.0 40.0 40.0 39.0 40.0 54 39.18 40.0 40.0 40.0 39.0 40.0 55 39.244 40.0 40.0 40.0 39.0 40.0 56 39.2565 40.0 40.0 40.0 39.0 40.0 57 39.26025 40.0 40.0 40.0 39.0 40.0 58 39.202 40.0 40.0 40.0 39.0 40.0 59 39.1545 40.0 40.0 40.0 39.0 40.0 60 39.14975 40.0 40.0 40.0 39.0 40.0 61 39.04425 40.0 40.0 40.0 39.0 40.0 62 39.09025 40.0 40.0 40.0 38.0 40.0 63 39.18075 40.0 40.0 40.0 39.0 40.0 64 39.197 40.0 40.0 40.0 39.0 40.0 65 39.1365 40.0 40.0 40.0 39.0 40.0 66 39.1735 40.0 40.0 40.0 39.0 40.0 67 39.16725 40.0 40.0 40.0 39.0 40.0 68 39.1665 40.0 40.0 40.0 39.0 40.0 69 39.1275 40.0 40.0 40.0 39.0 40.0 70 39.11275 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 1.0 26 4.0 27 7.0 28 20.0 29 12.0 30 25.0 31 34.0 32 25.0 33 46.0 34 48.0 35 52.0 36 81.0 37 111.0 38 259.0 39 3272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.191735953640716 12.043335852859663 14.310909549004789 42.45401864449484 2 20.3 14.825 30.85 34.025 3 20.375 20.150000000000002 24.224999999999998 35.25 4 25.6 24.25 23.05 27.1 5 24.9 30.4 24.85 19.85 6 20.599999999999998 28.375 27.725 23.3 7 20.724999999999998 22.625 34.9 21.75 8 19.45 21.95 31.8 26.8 9 18.925 24.85 33.15 23.075000000000003 10 23.849999999999998 29.775000000000002 22.0 24.375 11 23.799999999999997 24.125 24.099999999999998 27.975 12 21.925 22.925 27.3 27.85 13 22.625 24.125 27.275 25.974999999999998 14 22.25 26.5 26.150000000000002 25.1 15 23.1 25.525 26.575 24.8 16 24.175 24.325 25.525 25.974999999999998 17 22.425 26.25 25.7 25.624999999999996 18 22.975 25.074999999999996 26.200000000000003 25.75 19 23.1 24.95 25.174999999999997 26.775 20 23.125 25.900000000000002 25.3 25.674999999999997 21 23.549999999999997 24.425 25.424999999999997 26.6 22 22.2 26.05 24.8 26.950000000000003 23 22.125 26.650000000000002 25.174999999999997 26.05 24 23.225 23.925 25.825 27.025 25 23.3 26.0 24.925 25.775 26 23.425 25.6 25.85 25.124999999999996 27 22.125 24.275 25.624999999999996 27.975 28 24.125 25.575 25.624999999999996 24.675 29 22.3 26.85 26.5 24.349999999999998 30 22.5 24.7 24.875 27.925 31 23.549999999999997 26.6 24.224999999999998 25.624999999999996 32 23.400000000000002 26.150000000000002 25.575 24.875 33 23.549999999999997 24.5 25.974999999999998 25.974999999999998 34 23.05 25.525 24.075 27.35 35 22.95 26.075 25.650000000000002 25.324999999999996 36 22.650000000000002 25.474999999999998 25.15 26.724999999999998 37 24.725 25.074999999999996 24.15 26.05 38 23.9 24.9 26.400000000000002 24.8 39 22.825 23.974999999999998 25.575 27.625 40 25.374999999999996 25.025 24.025 25.575 41 22.625 25.025 24.7 27.650000000000002 42 23.0 25.474999999999998 24.825 26.700000000000003 43 22.55 26.174999999999997 24.55 26.724999999999998 44 23.05 25.3 26.35 25.3 45 21.425 26.075 24.925 27.575 46 24.275 24.474999999999998 24.7 26.55 47 23.125 25.2 25.8 25.874999999999996 48 22.875 25.424999999999997 24.224999999999998 27.474999999999998 49 23.75 26.3 24.125 25.825 50 22.875 25.35 25.775 26.0 51 23.35 25.25 25.3 26.1 52 22.85 24.275 25.95 26.924999999999997 53 24.175 24.349999999999998 25.525 25.95 54 22.375 24.55 24.85 28.225 55 24.125 24.975 25.224999999999998 25.674999999999997 56 24.15 25.275 25.124999999999996 25.45 57 23.974999999999998 24.3 25.174999999999997 26.55 58 25.074999999999996 24.6 25.0 25.324999999999996 59 23.25 25.074999999999996 24.85 26.825 60 23.674999999999997 24.7 25.05 26.575 61 24.05 25.15 24.925 25.874999999999996 62 23.825 26.025 23.849999999999998 26.3 63 22.8 25.6 24.825 26.775 64 24.349999999999998 25.374999999999996 23.724999999999998 26.55 65 23.275000000000002 26.05 24.95 25.724999999999998 66 23.510265398097147 24.261392088132197 24.2864296444667 27.94191286930396 67 22.686116700201207 24.748490945674046 25.15090543259557 27.414486921529175 68 22.864450127877237 23.70843989769821 26.41943734015345 27.007672634271103 69 22.872777017783857 19.042407660738714 29.466484268125853 28.618331053351575 70 25.595892922625595 0.0 35.16685001833517 39.23725705903924 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 4.5 29 10.5 30 14.0 31 17.5 32 33.0 33 45.0 34 52.0 35 65.5 36 85.0 37 98.0 38 113.5 39 145.5 40 162.0 41 192.0 42 243.0 43 264.0 44 265.0 45 271.5 46 278.5 47 280.0 48 276.0 49 246.5 50 221.0 51 210.0 52 196.5 53 194.0 54 185.5 55 161.5 56 138.5 57 131.0 58 122.5 59 103.5 60 93.0 61 95.0 62 90.0 63 83.0 64 78.5 65 71.5 66 63.5 67 58.0 68 55.0 69 44.0 70 36.0 71 32.5 72 21.0 73 13.0 74 12.5 75 8.5 76 4.0 77 3.0 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.15 67 0.6 68 2.25 69 8.625 70 31.825 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052696 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052696_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.14825 35.0 35.0 35.0 33.0 35.0 2 34.114 35.0 35.0 35.0 33.0 35.0 3 33.876 35.0 35.0 35.0 32.0 35.0 4 33.73075 35.0 35.0 35.0 31.0 35.0 5 33.83775 35.0 35.0 35.0 32.0 35.0 6 38.2935 40.0 40.0 40.0 36.0 40.0 7 38.1375 40.0 39.0 40.0 35.0 40.0 8 38.1775 40.0 39.0 40.0 35.0 40.0 9 38.27475 40.0 40.0 40.0 36.0 40.0 10 38.35825 40.0 40.0 40.0 36.0 40.0 11 38.22525 40.0 40.0 40.0 35.0 40.0 12 38.28925 40.0 40.0 40.0 36.0 40.0 13 38.37775 40.0 40.0 40.0 36.0 40.0 14 38.3385 40.0 40.0 40.0 36.0 40.0 15 38.3375 40.0 40.0 40.0 36.0 40.0 16 38.34975 40.0 40.0 40.0 36.0 40.0 17 38.30825 40.0 40.0 40.0 36.0 40.0 18 38.34975 40.0 40.0 40.0 36.0 40.0 19 38.3155 40.0 40.0 40.0 36.0 40.0 20 38.3355 40.0 40.0 40.0 36.0 40.0 21 38.25175 40.0 40.0 40.0 36.0 40.0 22 38.293 40.0 40.0 40.0 36.0 40.0 23 38.34175 40.0 40.0 40.0 36.0 40.0 24 38.26375 40.0 40.0 40.0 36.0 40.0 25 38.286 40.0 40.0 40.0 36.0 40.0 26 38.357 40.0 40.0 40.0 36.0 40.0 27 38.30125 40.0 40.0 40.0 36.0 40.0 28 38.31075 40.0 40.0 40.0 36.0 40.0 29 38.24675 40.0 40.0 40.0 36.0 40.0 30 38.2875 40.0 40.0 40.0 36.0 40.0 31 38.23575 40.0 40.0 40.0 36.0 40.0 32 38.3105 40.0 40.0 40.0 36.0 40.0 33 38.4 40.0 40.0 40.0 36.0 40.0 34 38.27425 40.0 40.0 40.0 36.0 40.0 35 38.28775 40.0 40.0 40.0 36.0 40.0 36 38.27375 40.0 40.0 40.0 35.0 40.0 37 38.26875 40.0 40.0 40.0 36.0 40.0 38 38.249 40.0 40.0 40.0 35.0 40.0 39 38.193 40.0 40.0 40.0 35.0 40.0 40 38.20375 40.0 40.0 40.0 35.0 40.0 41 38.16075 40.0 40.0 40.0 36.0 40.0 42 38.2465 40.0 40.0 40.0 36.0 40.0 43 38.28525 40.0 39.0 40.0 35.0 40.0 44 38.252 40.0 40.0 40.0 35.0 40.0 45 38.23425 40.0 40.0 40.0 35.0 40.0 46 38.308 40.0 40.0 40.0 36.0 40.0 47 38.16425 40.0 39.0 40.0 35.0 40.0 48 38.145 40.0 39.0 40.0 35.0 40.0 49 38.2745 40.0 39.0 40.0 36.0 40.0 50 38.2135 40.0 39.0 40.0 35.0 40.0 51 38.2315 40.0 39.0 40.0 36.0 40.0 52 38.0585 40.0 39.0 40.0 34.0 40.0 53 38.14875 40.0 39.0 40.0 35.0 40.0 54 38.07575 40.0 39.0 40.0 34.0 40.0 55 38.23825 40.0 39.0 40.0 35.0 40.0 56 38.123 40.0 39.0 40.0 35.0 40.0 57 38.15725 40.0 39.0 40.0 35.0 40.0 58 38.1205 40.0 39.0 40.0 35.0 40.0 59 38.17175 40.0 39.0 40.0 35.0 40.0 60 38.191 40.0 39.0 40.0 35.0 40.0 61 38.1255 40.0 39.0 40.0 35.0 40.0 62 38.10425 40.0 39.0 40.0 35.0 40.0 63 38.0245 40.0 39.0 40.0 34.0 40.0 64 38.13 40.0 39.0 40.0 35.0 40.0 65 38.14025 40.0 39.0 40.0 35.0 40.0 66 38.062 40.0 39.0 40.0 34.0 40.0 67 38.1865 40.0 39.0 40.0 35.0 40.0 68 38.0265 40.0 39.0 40.0 34.0 40.0 69 38.1025 40.0 39.0 40.0 34.0 40.0 70 38.094 40.0 39.0 40.0 35.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 7.0 18 9.0 19 21.0 20 24.0 21 31.0 22 27.0 23 22.0 24 32.0 25 25.0 26 27.0 27 30.0 28 17.0 29 27.0 30 29.0 31 35.0 32 29.0 33 27.0 34 36.0 35 55.0 36 62.0 37 98.0 38 244.0 39 3086.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.925000000000004 19.650000000000002 18.5 30.925000000000004 2 29.65 25.0 23.875 21.475 3 20.75 26.575 27.250000000000004 25.424999999999997 4 26.05 29.875 21.45 22.625 5 27.0 32.975 20.8 19.225 6 21.925 30.575000000000003 24.9 22.6 7 24.75 19.25 31.45 24.55 8 23.150000000000002 21.825 26.3 28.725 9 22.125 25.474999999999998 27.900000000000002 24.5 10 25.575 28.325 21.825 24.275 11 29.349999999999998 22.55 21.775 26.325 12 25.224999999999998 22.675 23.549999999999997 28.549999999999997 13 26.424999999999997 24.725 24.075 24.775 14 26.025 24.275 24.3 25.4 15 25.3 25.25 24.25 25.2 16 26.650000000000002 23.7 23.175 26.474999999999998 17 25.724999999999998 25.7 24.775 23.799999999999997 18 25.825 25.025 23.9 25.25 19 27.625 24.75 22.650000000000002 24.975 20 24.75 25.4 23.25 26.6 21 25.674999999999997 25.174999999999997 23.575 25.575 22 26.275 25.7 23.65 24.375 23 25.8 26.5 24.55 23.150000000000002 24 24.975 25.8 25.35 23.875 25 26.6 24.6 24.525 24.275 26 27.175 25.25 24.275 23.3 27 25.85 24.925 24.075 25.15 28 27.0 24.25 23.549999999999997 25.2 29 25.15 25.900000000000002 24.65 24.3 30 25.55 25.074999999999996 24.2 25.174999999999997 31 26.950000000000003 23.3 24.0 25.75 32 26.575 24.425 24.975 24.025 33 25.8 23.674999999999997 24.75 25.775 34 26.3 24.4 24.275 25.025 35 25.974999999999998 26.275 23.95 23.799999999999997 36 25.15 25.074999999999996 24.8 24.975 37 26.924999999999997 23.474999999999998 25.174999999999997 24.425 38 26.125 24.575 24.175 25.124999999999996 39 26.35 24.95 24.925 23.775 40 26.8 24.95 23.575 24.675 41 26.85 26.174999999999997 22.85 24.125 42 25.424999999999997 26.474999999999998 24.5 23.599999999999998 43 27.35 24.95 23.225 24.474999999999998 44 26.400000000000002 26.200000000000003 23.7 23.7 45 25.424999999999997 25.474999999999998 24.6 24.5 46 27.500000000000004 24.425 24.3 23.775 47 25.474999999999998 25.724999999999998 24.7 24.099999999999998 48 26.200000000000003 25.224999999999998 24.5 24.075 49 26.625 25.874999999999996 24.725 22.775000000000002 50 26.875 24.675 24.525 23.925 51 25.1 25.55 24.325 25.025 52 28.125 25.324999999999996 23.599999999999998 22.95 53 27.200000000000003 25.724999999999998 23.95 23.125 54 25.374999999999996 25.6 25.025 24.0 55 27.075 24.4 24.525 24.0 56 26.25 25.025 24.85 23.875 57 27.250000000000004 23.974999999999998 23.575 25.2 58 26.674999999999997 25.275 23.45 24.6 59 26.700000000000003 25.424999999999997 23.75 24.125 60 24.925 25.75 24.375 24.95 61 27.175 25.3 24.0 23.525 62 25.75 26.025 23.849999999999998 24.375 63 25.724999999999998 23.575 25.45 25.25 64 24.85 25.75 23.724999999999998 25.674999999999997 65 26.456614153538382 26.806701675418854 24.006001500375092 22.73068267066767 66 25.63267351540967 25.331996993234778 24.50513655725382 24.53019293410173 67 27.061790668348046 24.08575031525851 24.539722572509458 24.312736443883985 68 26.74748516894506 24.4003095176683 24.529275212793397 24.322930100593243 69 26.015121814617753 19.182301876225146 27.30327639316718 27.499299915989916 70 29.25170068027211 0.0 34.73167044595616 36.01662887377174 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.0 21 2.0 22 2.5 23 3.0 24 2.0 25 3.5 26 8.5 27 11.0 28 7.5 29 7.5 30 11.0 31 13.0 32 18.5 33 22.0 34 32.0 35 52.5 36 77.0 37 91.0 38 103.5 39 131.0 40 146.0 41 177.5 42 211.5 43 214.0 44 230.5 45 246.5 46 277.5 47 309.0 48 283.0 49 233.5 50 210.0 51 220.0 52 196.5 53 163.0 54 170.5 55 169.5 56 141.5 57 122.0 58 130.5 59 127.0 60 115.0 61 121.0 62 112.5 63 98.0 64 102.5 65 88.0 66 65.5 67 62.0 68 62.0 69 54.5 70 47.0 71 39.5 72 27.5 73 23.0 74 17.5 75 11.0 76 7.0 77 4.0 78 3.0 79 3.0 80 4.0 81 2.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.025 66 0.22499999999999998 67 0.8750000000000001 68 3.075 69 10.725 70 33.85 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187004 spots for ERR5052696.sra Written 187004 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra Read 187001 spots for ERR5052696.sra Written 187001 spots for ERR5052696.sra SRR ids: ['ERR5052696.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4dovc6gr ERR5052696.sra spots: 3740023 blocks: [[1, 187001], [187002, 374002], [374003, 561003], [561004, 748004], [748005, 935005], [935006, 1122006], [1122007, 1309007], [1309008, 1496008], [1496009, 1683009], [1683010, 1870010], [1870011, 2057011], [2057012, 2244012], [2244013, 2431013], [2431014, 2618014], [2618015, 2805015], [2805016, 2992016], [2992017, 3179017], [3179018, 3366018], [3366019, 3553019], [3553020, 3740023]] ERR5052696 file size 662561 ERR5052696 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052696 ERR5052696_1.fastq ERR5052696_2.fastq Input file: ERR5052696_1.fastq Paired file: ERR5052696_2.fastq trimmed: ERR5052696-trimmed-pair1.fastq, ERR5052696-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:37:42 2024 >> started Tue Dec 10 05:37:46 2024 >> done (4.001s) 3740023 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 46 ( 0.00%) empty read pairs filtered out after trimming by size control 3739977 (100.00%) read pairs available; of these: 17 ( 0.00%) trimmed read pairs available after processing 3739960 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 1 0.00% 52 1 0.00% 53 2 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 1 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 11 0.00% 70 3739960 100.00% 3739977 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=37 prefix-density=0.09 prefix-fanout=2.9 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=820.16 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=21.0 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=28 prefix-density=0.14 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=387.97 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=16.9 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCT ERR5052696 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:38:19 Started mapping on | Dec 10 05:38:19 Finished on | Dec 10 05:38:32 Mapping speed, Million of reads per hour | 1035.69 Number of input reads | 3739977 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3563156 Uniquely mapped reads % | 95.27% Average mapped length | 138.70 Number of splices: Total | 1803121 Number of splices: Annotated (sjdb) | 1710176 Number of splices: GT/AG | 1777224 Number of splices: GC/AG | 23008 Number of splices: AT/AC | 1257 Number of splices: Non-canonical | 1632 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 50334 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 5025 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 126487 126487 126487 N_multimapping 50334 50334 50334 N_noFeature 92167 3481286 112197 N_ambiguous 69794 335 8063 UnstrandedReadsAssigned:3401195 PositiveStrandReadsAssigned:81535 NegativeStrandReadsAssigned:3442896 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052696 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052696-trimmed-pair1.fastq ERR5052696-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,739,977 reads, 3,544,521 reads pseudoaligned [quant] estimated average fragment length: 204.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 ERR5052696.ke.tsv 35125 ERR5052696.se.tsv 88098 total ==> ERR5052696.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.788 26.4335 15.087 PNS24247 1044 840.499 13.0055 6.47166 PNS24249 1928 1724.5 19.599 4.75333 PNS24246 1044 840.499 13.0055 6.47166 PNS24248 1044 840.499 13.0055 6.47166 PNS24244 1471 1267.5 15.9511 5.26342 PNS24243 293 114.187 0 0 KQK14069 1603 1399.5 2248.63 672.004 KQK14071 474 275.191 37.4321 56.89 ==> ERR5052696.se.tsv <== BRADI_1g14170v3 2442 BRADI_1g53295v3 13 BRADI_1g59795v3 55 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 240 BRADI_1g74790v3 30 BRADI_1g09890v3 0 BRADI_1g77505v3 33 BRADI_1g48960v3 0 ERR5052696 completed mapping pipeline successfully