Starting /dee2/code/volunteer_pipeline.sh ERR5052697 current disk space = 1525893087232 free memory = 1570528496 ERR5052697 SRAfilesize c6d906fc80b269b1fd8191ce639d2dcf ERR5052697.sra ERR5052697.sra file validated ERR5052697 is paired end ERR5052697 is conventional basespace ERR5052697 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.48625 35.0 35.0 35.0 35.0 35.0 2 34.63575 35.0 35.0 35.0 35.0 35.0 3 34.65925 35.0 35.0 35.0 35.0 35.0 4 34.617 35.0 35.0 35.0 35.0 35.0 5 34.62025 35.0 35.0 35.0 35.0 35.0 6 39.33575 40.0 40.0 40.0 39.0 40.0 7 39.30875 40.0 40.0 40.0 39.0 40.0 8 39.28175 40.0 40.0 40.0 39.0 40.0 9 39.308 40.0 40.0 40.0 39.0 40.0 10 39.3205 40.0 40.0 40.0 39.0 40.0 11 39.286 40.0 40.0 40.0 39.0 40.0 12 39.29 40.0 40.0 40.0 39.0 40.0 13 39.299 40.0 40.0 40.0 39.0 40.0 14 39.2875 40.0 40.0 40.0 39.0 40.0 15 39.22325 40.0 40.0 40.0 39.0 40.0 16 39.2715 40.0 40.0 40.0 39.0 40.0 17 39.22075 40.0 40.0 40.0 39.0 40.0 18 39.26725 40.0 40.0 40.0 39.0 40.0 19 39.27975 40.0 40.0 40.0 39.0 40.0 20 39.22275 40.0 40.0 40.0 39.0 40.0 21 39.27425 40.0 40.0 40.0 39.0 40.0 22 39.27525 40.0 40.0 40.0 39.0 40.0 23 39.24375 40.0 40.0 40.0 39.0 40.0 24 39.25975 40.0 40.0 40.0 39.0 40.0 25 39.26625 40.0 40.0 40.0 39.0 40.0 26 39.2125 40.0 40.0 40.0 39.0 40.0 27 39.192 40.0 40.0 40.0 39.0 40.0 28 39.21675 40.0 40.0 40.0 39.0 40.0 29 39.1255 40.0 40.0 40.0 39.0 40.0 30 39.201 40.0 40.0 40.0 39.0 40.0 31 39.1775 40.0 40.0 40.0 39.0 40.0 32 39.18 40.0 40.0 40.0 39.0 40.0 33 39.261 40.0 40.0 40.0 39.0 40.0 34 39.2615 40.0 40.0 40.0 39.0 40.0 35 39.274 40.0 40.0 40.0 39.0 40.0 36 39.2585 40.0 40.0 40.0 39.0 40.0 37 39.21175 40.0 40.0 40.0 39.0 40.0 38 39.22525 40.0 40.0 40.0 39.0 40.0 39 39.14475 40.0 40.0 40.0 39.0 40.0 40 39.2415 40.0 40.0 40.0 39.0 40.0 41 39.17175 40.0 40.0 40.0 39.0 40.0 42 39.16625 40.0 40.0 40.0 39.0 40.0 43 39.20425 40.0 40.0 40.0 39.0 40.0 44 39.18675 40.0 40.0 40.0 39.0 40.0 45 39.174 40.0 40.0 40.0 39.0 40.0 46 39.17075 40.0 40.0 40.0 39.0 40.0 47 39.12325 40.0 40.0 40.0 39.0 40.0 48 39.20275 40.0 40.0 40.0 39.0 40.0 49 39.172 40.0 40.0 40.0 39.0 40.0 50 39.22325 40.0 40.0 40.0 39.0 40.0 51 39.25725 40.0 40.0 40.0 39.0 40.0 52 39.237 40.0 40.0 40.0 39.0 40.0 53 39.19925 40.0 40.0 40.0 39.0 40.0 54 39.207 40.0 40.0 40.0 39.0 40.0 55 39.1605 40.0 40.0 40.0 39.0 40.0 56 39.166 40.0 40.0 40.0 39.0 40.0 57 39.12375 40.0 40.0 40.0 38.0 40.0 58 39.1365 40.0 40.0 40.0 39.0 40.0 59 39.17325 40.0 40.0 40.0 39.0 40.0 60 39.2425 40.0 40.0 40.0 39.0 40.0 61 39.17225 40.0 40.0 40.0 39.0 40.0 62 39.1945 40.0 40.0 40.0 39.0 40.0 63 39.25925 40.0 40.0 40.0 39.0 40.0 64 39.1695 40.0 40.0 40.0 39.0 40.0 65 39.254 40.0 40.0 40.0 39.0 40.0 66 39.1855 40.0 40.0 40.0 39.0 40.0 67 39.097 40.0 40.0 40.0 39.0 40.0 68 39.14125 40.0 40.0 40.0 38.0 40.0 69 39.108 40.0 40.0 40.0 38.0 40.0 70 39.124 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 4.0 27 11.0 28 12.0 29 14.0 30 27.0 31 29.0 32 47.0 33 44.0 34 43.0 35 53.0 36 82.0 37 110.0 38 232.0 39 3288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.815261044176705 12.198795180722891 14.88453815261044 44.101405622489956 2 21.380345086271568 14.328582145536384 29.80745186296574 34.48362090522631 3 20.7 19.55 23.875 35.875 4 25.324999999999996 23.799999999999997 24.425 26.450000000000003 5 24.975 31.424999999999997 24.349999999999998 19.25 6 20.575 28.15 28.349999999999998 22.925 7 19.1 23.825 35.3 21.775 8 19.475 22.0 32.1 26.424999999999997 9 19.975 25.424999999999997 31.724999999999998 22.875 10 22.75 30.525000000000002 23.35 23.375 11 24.9 22.95 23.674999999999997 28.475 12 22.625 22.975 27.400000000000002 27.0 13 23.375 24.875 27.075 24.675 14 22.8 23.9 28.325 24.975 15 21.325 24.375 25.825 28.475 16 23.599999999999998 25.55 25.15 25.7 17 22.55 25.1 27.575 24.775 18 23.225 24.575 25.900000000000002 26.3 19 22.3 26.474999999999998 24.474999999999998 26.75 20 22.925 26.125 26.650000000000002 24.3 21 23.0 24.675 25.874999999999996 26.450000000000003 22 22.825 26.200000000000003 25.525 25.45 23 22.725 25.424999999999997 27.0 24.85 24 22.35 26.6 25.05 26.0 25 22.025 25.525 26.174999999999997 26.275 26 23.525 25.05 25.974999999999998 25.45 27 21.825 24.825 24.825 28.525 28 22.875 24.325 25.474999999999998 27.325 29 22.650000000000002 26.1 24.95 26.3 30 22.5 25.224999999999998 25.224999999999998 27.05 31 23.35 24.375 25.424999999999997 26.85 32 22.675 24.375 26.0 26.950000000000003 33 22.225 24.099999999999998 26.35 27.325 34 23.7 25.05 26.075 25.174999999999997 35 23.35 23.65 25.674999999999997 27.325 36 23.724999999999998 24.525 25.624999999999996 26.125 37 23.45 25.0 24.675 26.875 38 22.2 25.45 26.424999999999997 25.924999999999997 39 22.650000000000002 25.85 25.724999999999998 25.775 40 24.2 25.2 24.175 26.424999999999997 41 23.7 25.924999999999997 24.45 25.924999999999997 42 22.575 25.525 25.624999999999996 26.275 43 23.849999999999998 26.1 24.2 25.85 44 23.25 26.200000000000003 25.55 25.0 45 22.225 24.4 25.35 28.025 46 22.275 25.3 25.525 26.900000000000002 47 23.175 25.025 26.275 25.525 48 21.825 25.45 26.85 25.874999999999996 49 22.8 24.725 25.775 26.700000000000003 50 21.75 25.974999999999998 26.1 26.174999999999997 51 23.325000000000003 23.825 25.8 27.05 52 24.675 24.375 24.0 26.950000000000003 53 23.1 26.35 24.525 26.025 54 22.35 25.8 25.775 26.075 55 24.474999999999998 24.7 24.7 26.125 56 24.525 25.124999999999996 25.25 25.1 57 24.4 25.174999999999997 23.724999999999998 26.700000000000003 58 23.75 25.674999999999997 24.625 25.95 59 23.25 25.0 26.474999999999998 25.275 60 22.355588897224308 25.006251562890725 25.481370342585645 27.156789197299325 61 23.605901475368842 24.90622655663916 25.10627656914228 26.38159539884971 62 22.83070767691923 24.706176544136035 26.581645411352838 25.881470367591895 63 23.80595148787197 24.256064016004 25.03125781445361 26.906726681670417 64 25.081270317579396 24.706176544136035 23.1807951987997 27.031757939484873 65 22.53063265816454 24.85621405351338 25.35633908477119 27.25681420355089 66 23.790423665078965 24.367009275507645 25.04387064427175 26.798696415141638 67 24.438839848675915 24.060529634300128 26.027742749054223 25.472887767969738 68 23.276748971193413 23.662551440329217 25.385802469135804 27.674897119341562 69 23.095823095823096 19.05541905541906 28.883428883428884 28.96532896532897 70 24.89067055393586 0.0 38.265306122448976 36.84402332361516 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.5 25 1.5 26 3.5 27 5.0 28 7.5 29 12.0 30 14.0 31 13.5 32 18.5 33 24.0 34 41.0 35 73.0 36 98.0 37 108.0 38 117.5 39 171.5 40 216.0 41 225.0 42 243.5 43 253.0 44 251.0 45 257.0 46 262.0 47 259.0 48 265.5 49 256.5 50 241.0 51 228.5 52 199.5 53 183.0 54 167.0 55 145.0 56 131.5 57 124.0 58 118.5 59 106.0 60 99.0 61 103.0 62 96.0 63 85.0 64 73.5 65 63.0 66 64.5 67 65.0 68 54.0 69 37.5 70 32.0 71 30.0 72 25.0 73 22.0 74 17.0 75 10.5 76 6.5 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.4 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.27499999999999997 67 0.8750000000000001 68 2.8000000000000003 69 8.425 70 31.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTTG 15 0.0030193129 63.612503 6 >>END_MODULE ERR5052697 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052697_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.272 35.0 35.0 35.0 33.0 35.0 2 34.086 35.0 35.0 35.0 33.0 35.0 3 33.8575 35.0 35.0 35.0 32.0 35.0 4 33.82 35.0 35.0 35.0 32.0 35.0 5 33.77025 35.0 35.0 35.0 32.0 35.0 6 38.28175 40.0 40.0 40.0 36.0 40.0 7 38.26675 40.0 40.0 40.0 36.0 40.0 8 38.18525 40.0 39.0 40.0 36.0 40.0 9 38.27875 40.0 40.0 40.0 36.0 40.0 10 38.3145 40.0 40.0 40.0 36.0 40.0 11 38.30725 40.0 40.0 40.0 36.0 40.0 12 38.332 40.0 40.0 40.0 36.0 40.0 13 38.3765 40.0 40.0 40.0 36.0 40.0 14 38.418 40.0 40.0 40.0 36.0 40.0 15 38.39625 40.0 40.0 40.0 36.0 40.0 16 38.3965 40.0 40.0 40.0 36.0 40.0 17 38.30575 40.0 40.0 40.0 36.0 40.0 18 38.2485 40.0 40.0 40.0 36.0 40.0 19 38.306 40.0 40.0 40.0 36.0 40.0 20 38.31925 40.0 40.0 40.0 36.0 40.0 21 38.33325 40.0 40.0 40.0 36.0 40.0 22 38.471 40.0 40.0 40.0 36.0 40.0 23 38.4155 40.0 40.0 40.0 36.0 40.0 24 38.43475 40.0 40.0 40.0 36.0 40.0 25 38.40375 40.0 40.0 40.0 36.0 40.0 26 38.40975 40.0 40.0 40.0 36.0 40.0 27 38.27225 40.0 40.0 40.0 36.0 40.0 28 38.291 40.0 40.0 40.0 36.0 40.0 29 38.29975 40.0 40.0 40.0 36.0 40.0 30 38.32225 40.0 40.0 40.0 36.0 40.0 31 38.381 40.0 40.0 40.0 36.0 40.0 32 38.39125 40.0 40.0 40.0 36.0 40.0 33 38.33275 40.0 40.0 40.0 36.0 40.0 34 38.429 40.0 40.0 40.0 36.0 40.0 35 38.365 40.0 40.0 40.0 36.0 40.0 36 38.3645 40.0 40.0 40.0 36.0 40.0 37 38.33975 40.0 40.0 40.0 36.0 40.0 38 38.40525 40.0 40.0 40.0 36.0 40.0 39 38.2425 40.0 40.0 40.0 36.0 40.0 40 38.31075 40.0 40.0 40.0 36.0 40.0 41 38.25675 40.0 40.0 40.0 36.0 40.0 42 38.298 40.0 40.0 40.0 36.0 40.0 43 38.18675 40.0 40.0 40.0 35.0 40.0 44 38.21425 40.0 39.0 40.0 35.0 40.0 45 38.28325 40.0 40.0 40.0 36.0 40.0 46 38.268 40.0 40.0 40.0 36.0 40.0 47 38.15975 40.0 40.0 40.0 35.0 40.0 48 38.2815 40.0 40.0 40.0 36.0 40.0 49 38.2535 40.0 40.0 40.0 35.0 40.0 50 38.2205 40.0 39.0 40.0 36.0 40.0 51 38.19025 40.0 40.0 40.0 35.0 40.0 52 38.2545 40.0 39.0 40.0 36.0 40.0 53 38.197 40.0 40.0 40.0 35.0 40.0 54 38.25325 40.0 39.0 40.0 36.0 40.0 55 38.10225 40.0 40.0 40.0 35.0 40.0 56 38.21525 40.0 40.0 40.0 35.0 40.0 57 38.194 40.0 40.0 40.0 35.0 40.0 58 38.2085 40.0 40.0 40.0 35.0 40.0 59 38.18175 40.0 40.0 40.0 35.0 40.0 60 38.208 40.0 40.0 40.0 36.0 40.0 61 38.27675 40.0 40.0 40.0 36.0 40.0 62 38.223 40.0 39.0 40.0 35.0 40.0 63 38.23025 40.0 39.0 40.0 35.0 40.0 64 38.23375 40.0 39.0 40.0 36.0 40.0 65 38.146 40.0 39.0 40.0 35.0 40.0 66 38.195 40.0 39.0 40.0 35.0 40.0 67 38.16975 40.0 39.0 40.0 35.0 40.0 68 38.218 40.0 40.0 40.0 35.0 40.0 69 38.22625 40.0 40.0 40.0 35.0 40.0 70 38.1755 40.0 39.0 40.0 35.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 8.0 18 17.0 19 24.0 20 21.0 21 32.0 22 21.0 23 27.0 24 35.0 25 22.0 26 21.0 27 18.0 28 18.0 29 16.0 30 25.0 31 30.0 32 26.0 33 35.0 34 39.0 35 33.0 36 79.0 37 103.0 38 212.0 39 3137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.999999999999996 20.325 17.05 33.625 2 26.75 25.174999999999997 27.250000000000004 20.825 3 20.875 26.55 26.474999999999998 26.1 4 24.625 31.0 21.975 22.400000000000002 5 26.650000000000002 31.275 20.825 21.25 6 21.50537634408602 29.9074768692173 24.63115778944736 23.95598899724931 7 23.825 20.200000000000003 30.825000000000003 25.15 8 22.375 21.525 26.400000000000002 29.7 9 22.5 24.375 26.775 26.35 10 25.275 29.925 21.224999999999998 23.575 11 28.625 22.55 19.925 28.9 12 25.874999999999996 21.95 25.45 26.724999999999998 13 23.625 24.375 26.474999999999998 25.525 14 25.45 24.5 24.95 25.1 15 25.575 24.6 23.849999999999998 25.974999999999998 16 25.35 25.1 24.5 25.05 17 25.8 25.2 22.45 26.55 18 24.425 25.275 26.075 24.224999999999998 19 27.075 23.3 24.325 25.3 20 26.974999999999998 25.05 23.1 24.875 21 25.7 24.275 23.075000000000003 26.950000000000003 22 25.224999999999998 25.174999999999997 23.825 25.775 23 25.75 26.5 23.275000000000002 24.474999999999998 24 24.625 26.174999999999997 25.324999999999996 23.875 25 26.075 23.625 24.349999999999998 25.95 26 25.674999999999997 25.7 23.825 24.8 27 25.85 23.95 24.25 25.95 28 26.05 25.124999999999996 24.0 24.825 29 26.424999999999997 25.025 23.974999999999998 24.575 30 26.150000000000002 25.2 24.275 24.375 31 26.875 25.074999999999996 23.45 24.6 32 25.75 26.125 24.2 23.925 33 26.125 26.075 24.4 23.400000000000002 34 26.1 24.525 23.275000000000002 26.1 35 26.674999999999997 24.375 23.375 25.575 36 24.65 25.8 24.825 24.725 37 25.825 24.4 24.45 25.324999999999996 38 26.55 25.75 21.85 25.85 39 26.325 24.575 24.6 24.5 40 26.875 24.5 23.05 25.575 41 25.624999999999996 25.474999999999998 23.674999999999997 25.224999999999998 42 25.775 25.0 23.425 25.8 43 26.325 25.55 24.224999999999998 23.9 44 26.775 25.424999999999997 23.75 24.05 45 25.650000000000002 24.575 24.075 25.7 46 26.3 24.825 24.0 24.875 47 26.224999999999998 25.324999999999996 23.525 24.925 48 25.424999999999997 24.575 24.5 25.5 49 25.874999999999996 24.425 23.925 25.775 50 25.8 25.1 25.424999999999997 23.674999999999997 51 25.525 25.124999999999996 24.474999999999998 24.875 52 25.650000000000002 23.799999999999997 25.025 25.525 53 25.575 25.525 24.325 24.575 54 26.224999999999998 24.95 23.75 25.074999999999996 55 26.924999999999997 25.1 23.599999999999998 24.375 56 26.700000000000003 24.7 23.400000000000002 25.2 57 26.3 25.424999999999997 23.9 24.375 58 26.8 25.95 24.15 23.1 59 26.3 26.05 23.525 24.125 60 26.625 24.15 24.625 24.6 61 26.3 24.4 24.575 24.725 62 26.700000000000003 24.65 24.3 24.349999999999998 63 24.825 24.9 25.525 24.75 64 26.275 25.674999999999997 24.4 23.65 65 26.756689172293076 25.431357839459867 24.60615153788447 23.20580145036259 66 26.090225563909776 25.71428571428571 25.438596491228072 22.75689223057644 67 26.08366935483871 24.74798387096774 24.798387096774192 24.369959677419356 68 28.90665291387313 23.36255801959773 23.465703971119133 24.265085095410004 69 26.715205824698963 19.714365723886868 26.99523942873145 26.57518902268272 70 27.300037551633494 0.0 35.411190386781826 37.28877206158468 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 2.0 23 3.0 24 2.0 25 3.0 26 6.0 27 7.0 28 6.5 29 8.0 30 10.0 31 14.0 32 24.0 33 30.0 34 35.5 35 51.0 36 79.5 37 98.0 38 110.5 39 151.0 40 179.0 41 182.5 42 194.5 43 203.0 44 225.5 45 253.0 46 248.0 47 238.0 48 239.5 49 234.0 50 227.0 51 222.5 52 219.0 53 220.0 54 190.5 55 158.0 56 145.0 57 135.0 58 123.0 59 122.5 60 134.0 61 120.5 62 105.5 63 104.0 64 104.5 65 91.0 66 71.5 67 66.0 68 63.5 69 57.5 70 54.0 71 43.5 72 28.5 73 24.0 74 23.0 75 16.0 76 7.0 77 4.0 78 3.5 79 2.0 80 1.0 81 1.5 82 2.5 83 3.0 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.025 66 0.25 67 0.8 68 3.05 69 10.725 70 33.425 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191646 spots for ERR5052697.sra Written 191646 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra Read 191637 spots for ERR5052697.sra Written 191637 spots for ERR5052697.sra SRR ids: ['ERR5052697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9i454z38 ERR5052697.sra spots: 3832749 blocks: [[1, 191637], [191638, 383274], [383275, 574911], [574912, 766548], [766549, 958185], [958186, 1149822], [1149823, 1341459], [1341460, 1533096], [1533097, 1724733], [1724734, 1916370], [1916371, 2108007], [2108008, 2299644], [2299645, 2491281], [2491282, 2682918], [2682919, 2874555], [2874556, 3066192], [3066193, 3257829], [3257830, 3449466], [3449467, 3641103], [3641104, 3832749]] ERR5052697 file size 679042 ERR5052697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052697 ERR5052697_1.fastq ERR5052697_2.fastq Input file: ERR5052697_1.fastq Paired file: ERR5052697_2.fastq trimmed: ERR5052697-trimmed-pair1.fastq, ERR5052697-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:40:07 2024 >> started Tue Dec 10 05:40:10 2024 >> done (2.732s) 3832749 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 47 ( 0.00%) empty read pairs filtered out after trimming by size control 3832702 (100.00%) read pairs available; of these: 23 ( 0.00%) trimmed read pairs available after processing 3832679 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 19 0.00% 70 3832679 100.00% 3832702 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=35 prefix-density=0.09 prefix-fanout=3.0 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=530.19 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=31.9 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=28 prefix-density=0.15 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=411.62 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=17.6 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGC ERR5052697 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:40:38 Started mapping on | Dec 10 05:40:38 Finished on | Dec 10 05:40:58 Mapping speed, Million of reads per hour | 689.89 Number of input reads | 3832702 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3648136 Uniquely mapped reads % | 95.18% Average mapped length | 138.70 Number of splices: Total | 1846359 Number of splices: Annotated (sjdb) | 1750515 Number of splices: GT/AG | 1819549 Number of splices: GC/AG | 23915 Number of splices: AT/AC | 1272 Number of splices: Non-canonical | 1623 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 51339 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 5111 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 133227 133227 133227 N_multimapping 51339 51339 51339 N_noFeature 94704 3564292 114995 N_ambiguous 71617 340 8190 UnstrandedReadsAssigned:3481815 PositiveStrandReadsAssigned:83504 NegativeStrandReadsAssigned:3524951 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052697 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052697-trimmed-pair1.fastq ERR5052697-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,832,702 reads, 3,632,616 reads pseudoaligned [quant] estimated average fragment length: 205.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 ERR5052697.ke.tsv 35125 ERR5052697.se.tsv 88098 total ==> ERR5052697.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.2 24.5863 13.7354 PNS24247 1044 839.861 7.80095 3.79943 PNS24249 1928 1723.86 12.3588 2.93259 PNS24246 1044 839.861 7.80095 3.79943 PNS24248 1044 839.861 7.80095 3.79943 PNS24244 1471 1266.86 37.6521 12.1573 PNS24243 293 114.463 0 0 KQK14069 1603 1398.86 2257.54 660.146 KQK14071 474 274.82 43.5615 64.8384 ==> ERR5052697.se.tsv <== BRADI_1g14170v3 2499 BRADI_1g53295v3 18 BRADI_1g59795v3 44 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 213 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 54 BRADI_1g48960v3 0 ERR5052697 completed mapping pipeline successfully