Starting /dee2/code/volunteer_pipeline.sh ERR5052698 current disk space = 1525888954368 free memory = 1602382432 ERR5052698 SRAfilesize f3160efb3cc4380fb0da070d460c2bb1 ERR5052698.sra ERR5052698.sra file validated ERR5052698 is paired end ERR5052698 is conventional basespace ERR5052698 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052698_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.36975 35.0 35.0 35.0 35.0 35.0 2 34.58525 35.0 35.0 35.0 34.0 35.0 3 34.53475 35.0 35.0 35.0 34.0 35.0 4 34.5965 35.0 35.0 35.0 34.0 35.0 5 34.5655 35.0 35.0 35.0 34.0 35.0 6 39.31 40.0 40.0 40.0 39.0 40.0 7 39.21475 40.0 40.0 40.0 39.0 40.0 8 39.26525 40.0 40.0 40.0 39.0 40.0 9 39.18125 40.0 40.0 40.0 39.0 40.0 10 39.2455 40.0 40.0 40.0 39.0 40.0 11 39.22625 40.0 40.0 40.0 39.0 40.0 12 39.1985 40.0 40.0 40.0 39.0 40.0 13 39.2915 40.0 40.0 40.0 39.0 40.0 14 39.24275 40.0 40.0 40.0 39.0 40.0 15 39.16125 40.0 40.0 40.0 39.0 40.0 16 39.19225 40.0 40.0 40.0 39.0 40.0 17 39.2235 40.0 40.0 40.0 39.0 40.0 18 39.23575 40.0 40.0 40.0 39.0 40.0 19 39.23725 40.0 40.0 40.0 39.0 40.0 20 39.232 40.0 40.0 40.0 39.0 40.0 21 39.1805 40.0 40.0 40.0 39.0 40.0 22 39.188 40.0 40.0 40.0 38.0 40.0 23 39.2585 40.0 40.0 40.0 39.0 40.0 24 39.143 40.0 40.0 40.0 38.0 40.0 25 39.21525 40.0 40.0 40.0 39.0 40.0 26 39.0955 40.0 40.0 40.0 39.0 40.0 27 39.1195 40.0 40.0 40.0 38.0 40.0 28 39.13 40.0 40.0 40.0 39.0 40.0 29 39.17425 40.0 40.0 40.0 38.0 40.0 30 39.18425 40.0 40.0 40.0 39.0 40.0 31 39.16175 40.0 40.0 40.0 39.0 40.0 32 39.0955 40.0 40.0 40.0 38.0 40.0 33 39.1565 40.0 40.0 40.0 38.0 40.0 34 39.1135 40.0 40.0 40.0 38.0 40.0 35 39.12875 40.0 40.0 40.0 38.0 40.0 36 39.168 40.0 40.0 40.0 39.0 40.0 37 39.18475 40.0 40.0 40.0 39.0 40.0 38 39.08225 40.0 40.0 40.0 38.0 40.0 39 39.10875 40.0 40.0 40.0 38.0 40.0 40 39.08175 40.0 40.0 40.0 38.0 40.0 41 39.07025 40.0 40.0 40.0 38.0 40.0 42 39.09975 40.0 40.0 40.0 38.0 40.0 43 39.12825 40.0 40.0 40.0 39.0 40.0 44 39.1855 40.0 40.0 40.0 39.0 40.0 45 39.14375 40.0 40.0 40.0 39.0 40.0 46 39.139 40.0 40.0 40.0 39.0 40.0 47 39.1515 40.0 40.0 40.0 39.0 40.0 48 39.071 40.0 40.0 40.0 39.0 40.0 49 39.058 40.0 40.0 40.0 38.0 40.0 50 39.11525 40.0 40.0 40.0 38.0 40.0 51 39.1465 40.0 40.0 40.0 39.0 40.0 52 39.013 40.0 40.0 40.0 38.0 40.0 53 39.107 40.0 40.0 40.0 39.0 40.0 54 39.05825 40.0 40.0 40.0 38.0 40.0 55 39.11875 40.0 40.0 40.0 38.0 40.0 56 39.105 40.0 40.0 40.0 39.0 40.0 57 39.13975 40.0 40.0 40.0 38.0 40.0 58 38.98425 40.0 40.0 40.0 38.0 40.0 59 39.0525 40.0 40.0 40.0 38.0 40.0 60 39.03875 40.0 40.0 40.0 38.0 40.0 61 39.0265 40.0 40.0 40.0 38.0 40.0 62 39.0765 40.0 40.0 40.0 38.0 40.0 63 39.0535 40.0 40.0 40.0 38.0 40.0 64 39.0655 40.0 40.0 40.0 38.0 40.0 65 39.106 40.0 40.0 40.0 39.0 40.0 66 39.03275 40.0 40.0 40.0 38.0 40.0 67 39.00075 40.0 40.0 40.0 38.0 40.0 68 39.0895 40.0 40.0 40.0 38.0 40.0 69 39.048 40.0 40.0 40.0 38.0 40.0 70 39.0415 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 2.0 26 7.0 27 15.0 28 17.0 29 28.0 30 28.0 31 27.0 32 34.0 33 40.0 34 43.0 35 72.0 36 90.0 37 125.0 38 273.0 39 3198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.77760968229955 13.161875945537066 17.599596570852245 42.46091780131114 2 20.724999999999998 14.45 29.575000000000003 35.25 3 19.925 21.85 23.0 35.225 4 23.925 26.950000000000003 23.575 25.55 5 24.175 30.099999999999998 25.35 20.375 6 19.625 26.8 29.575000000000003 24.0 7 19.8 22.8 34.875 22.525000000000002 8 19.325 21.975 33.300000000000004 25.4 9 20.225 25.025 31.974999999999998 22.775000000000002 10 24.275 28.075 23.674999999999997 23.974999999999998 11 25.8 21.85 23.25 29.099999999999998 12 22.175 22.15 27.975 27.700000000000003 13 21.9 25.2 27.325 25.575 14 22.5 24.2 28.675 24.625 15 22.1 24.525 26.724999999999998 26.650000000000002 16 24.675 26.150000000000002 22.975 26.200000000000003 17 23.425 24.825 26.05 25.7 18 23.400000000000002 23.825 25.75 27.025 19 23.275000000000002 25.45 24.9 26.375 20 23.400000000000002 24.5 28.000000000000004 24.099999999999998 21 22.425 24.625 26.650000000000002 26.3 22 23.7 25.45 26.075 24.775 23 22.675 25.374999999999996 25.974999999999998 25.974999999999998 24 22.15 25.074999999999996 26.424999999999997 26.35 25 23.7 25.374999999999996 24.4 26.525 26 23.150000000000002 25.25 26.875 24.725 27 22.875 25.624999999999996 25.474999999999998 26.025 28 23.3 25.35 24.625 26.724999999999998 29 24.3 25.55 25.474999999999998 24.675 30 23.525 24.05 26.3 26.125 31 22.825 26.35 24.75 26.075 32 23.625 24.8 26.400000000000002 25.174999999999997 33 22.1 25.424999999999997 25.55 26.924999999999997 34 23.925 25.05 24.875 26.150000000000002 35 21.975 24.474999999999998 26.75 26.8 36 22.525000000000002 24.025 25.624999999999996 27.825 37 24.224999999999998 24.575 24.4 26.8 38 22.625 25.55 26.400000000000002 25.424999999999997 39 22.85 24.825 24.9 27.425 40 23.150000000000002 24.425 25.35 27.075 41 24.474999999999998 25.974999999999998 24.6 24.95 42 22.875 24.6 25.5 27.025 43 25.3 24.675 24.099999999999998 25.924999999999997 44 23.35 25.05 25.25 26.35 45 22.15 24.05 26.224999999999998 27.575 46 23.225 24.075 25.85 26.85 47 23.525 25.3 25.7 25.474999999999998 48 23.925 25.3 25.074999999999996 25.7 49 23.175 25.55 25.324999999999996 25.95 50 24.4 25.775 24.55 25.275 51 23.724999999999998 24.175 24.775 27.325 52 22.980745186296573 24.63115778944736 24.85621405351338 27.53188297074269 53 23.85596399099775 24.731182795698924 25.881470367591895 25.531382845711427 54 23.680920230057513 24.58114528632158 25.581395348837212 26.156539134783696 55 23.080770192548137 25.93148287071768 24.756189047261813 26.231557889472366 56 23.48087021755439 25.481370342585645 25.531382845711427 25.506376594148538 57 22.605651412853213 24.706176544136035 25.381345336334082 27.306826706676667 58 24.88122030507627 25.10627656914228 24.656164041010253 25.35633908477119 59 24.23105776444111 25.93148287071768 24.981245311327832 24.85621405351338 60 24.18104526131533 23.25581395348837 25.581395348837212 26.981745436359088 61 25.506376594148538 25.131282820705174 24.306076519129782 25.056264066016503 62 23.43085771442861 27.056764191047762 24.55613903475869 24.956239059764943 63 23.36168084042021 25.287643821910955 25.162581290645324 26.18809404702351 64 23.58679339669835 25.03751875937969 25.587793896948476 25.78789394697349 65 23.54854854854855 25.025025025025027 26.276276276276278 25.150150150150154 66 22.764838467317805 25.344352617079892 25.118958176809414 26.771850738792885 67 24.521651560926486 24.219536757301107 25.553877139979857 25.704934541792547 68 24.596464258262873 23.059185242121444 26.518063028439663 25.82628747117602 69 24.615384615384617 19.752747252747252 27.252747252747252 28.37912087912088 70 25.675675675675674 0.0 34.40467494521548 39.91964937910884 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 4.5 27 6.0 28 8.0 29 12.0 30 14.0 31 21.0 32 35.0 33 42.0 34 46.0 35 70.5 36 95.5 37 100.0 38 114.5 39 167.0 40 205.0 41 217.5 42 245.0 43 260.0 44 260.5 45 249.5 46 253.5 47 269.0 48 259.5 49 229.0 50 208.0 51 198.5 52 192.0 53 195.0 54 189.5 55 161.5 56 137.0 57 135.0 58 123.0 59 108.5 60 106.0 61 96.5 62 87.5 63 88.0 64 80.5 65 71.5 66 67.0 67 64.0 68 57.0 69 42.5 70 35.0 71 32.5 72 23.5 73 17.0 74 14.0 75 6.5 76 5.5 77 9.0 78 7.5 79 4.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.05 64 0.05 65 0.1 66 0.17500000000000002 67 0.7000000000000001 68 2.4250000000000003 69 9.0 70 31.55 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052698 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052698_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.09625 35.0 35.0 35.0 32.0 35.0 2 33.86225 35.0 35.0 35.0 31.0 35.0 3 33.6475 35.0 35.0 35.0 31.0 35.0 4 33.557 35.0 35.0 35.0 31.0 35.0 5 33.53025 35.0 35.0 35.0 31.0 35.0 6 37.934 40.0 39.0 40.0 34.0 40.0 7 37.79425 40.0 39.0 40.0 34.0 40.0 8 37.90075 40.0 39.0 40.0 34.0 40.0 9 37.8685 40.0 39.0 40.0 34.0 40.0 10 37.8225 40.0 39.0 40.0 34.0 40.0 11 37.9365 40.0 39.0 40.0 34.0 40.0 12 37.9255 40.0 39.0 40.0 34.0 40.0 13 37.9505 40.0 39.0 40.0 34.0 40.0 14 37.98575 40.0 40.0 40.0 34.0 40.0 15 37.9775 40.0 39.0 40.0 34.0 40.0 16 37.924 40.0 40.0 40.0 34.0 40.0 17 37.94575 40.0 39.0 40.0 34.0 40.0 18 37.86125 40.0 39.0 40.0 34.0 40.0 19 37.99175 40.0 39.0 40.0 34.0 40.0 20 37.89325 40.0 39.0 40.0 34.0 40.0 21 37.8725 40.0 39.0 40.0 34.0 40.0 22 37.8125 40.0 39.0 40.0 34.0 40.0 23 37.92725 40.0 39.0 40.0 34.0 40.0 24 37.96575 40.0 39.0 40.0 34.0 40.0 25 37.98725 40.0 39.0 40.0 34.0 40.0 26 38.05625 40.0 40.0 40.0 34.0 40.0 27 37.90475 40.0 40.0 40.0 34.0 40.0 28 37.95075 40.0 39.0 40.0 34.0 40.0 29 37.887 40.0 39.0 40.0 34.0 40.0 30 37.86975 40.0 39.0 40.0 34.0 40.0 31 37.8575 40.0 39.0 40.0 34.0 40.0 32 37.8935 40.0 39.0 40.0 34.0 40.0 33 37.873 40.0 39.0 40.0 34.0 40.0 34 37.86025 40.0 39.0 40.0 34.0 40.0 35 37.9165 40.0 39.0 40.0 34.0 40.0 36 37.91975 40.0 39.0 40.0 34.0 40.0 37 37.85925 40.0 39.0 40.0 34.0 40.0 38 37.78275 40.0 39.0 40.0 34.0 40.0 39 37.87175 40.0 39.0 40.0 34.0 40.0 40 37.90725 40.0 39.0 40.0 34.0 40.0 41 37.8745 40.0 39.0 40.0 34.0 40.0 42 37.88025 40.0 39.0 40.0 34.0 40.0 43 37.76475 40.0 39.0 40.0 34.0 40.0 44 37.85875 40.0 39.0 40.0 34.0 40.0 45 37.82875 40.0 39.0 40.0 34.0 40.0 46 37.83025 40.0 39.0 40.0 34.0 40.0 47 37.83325 40.0 39.0 40.0 34.0 40.0 48 37.68925 40.0 39.0 40.0 34.0 40.0 49 37.63375 40.0 39.0 40.0 31.0 40.0 50 37.77375 40.0 39.0 40.0 34.0 40.0 51 37.832 40.0 39.0 40.0 34.0 40.0 52 37.7 40.0 39.0 40.0 34.0 40.0 53 37.66675 40.0 39.0 40.0 31.0 40.0 54 37.71675 40.0 39.0 40.0 34.0 40.0 55 37.701 40.0 39.0 40.0 34.0 40.0 56 37.7425 40.0 39.0 40.0 34.0 40.0 57 37.74825 40.0 39.0 40.0 34.0 40.0 58 37.847 40.0 39.0 40.0 34.0 40.0 59 37.7735 40.0 39.0 40.0 34.0 40.0 60 37.786 40.0 39.0 40.0 34.0 40.0 61 37.7255 40.0 39.0 40.0 34.0 40.0 62 37.7275 40.0 39.0 40.0 34.0 40.0 63 37.62075 40.0 39.0 40.0 31.0 40.0 64 37.69725 40.0 39.0 40.0 31.0 40.0 65 37.77825 40.0 39.0 40.0 34.0 40.0 66 37.70925 40.0 39.0 40.0 34.0 40.0 67 37.6925 40.0 39.0 40.0 34.0 40.0 68 37.656 40.0 39.0 40.0 31.0 40.0 69 37.58025 40.0 39.0 40.0 31.0 40.0 70 37.72825 40.0 39.0 40.0 31.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 6.0 18 16.0 19 25.0 20 32.0 21 32.0 22 36.0 23 39.0 24 39.0 25 26.0 26 28.0 27 30.0 28 32.0 29 32.0 30 37.0 31 29.0 32 36.0 33 35.0 34 46.0 35 47.0 36 69.0 37 137.0 38 235.0 39 2951.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.35 21.625 20.75 31.275 2 28.599999999999998 25.124999999999996 23.275000000000002 23.0 3 21.6 27.474999999999998 25.900000000000002 25.025 4 25.174999999999997 30.025000000000002 21.775 23.025000000000002 5 25.775 31.825 21.65 20.75 6 21.95 27.85 25.674999999999997 24.525 7 23.974999999999998 20.200000000000003 32.05 23.775 8 22.275 21.25 27.800000000000004 28.675 9 22.900000000000002 24.575 27.875 24.65 10 26.75 26.424999999999997 21.575 25.25 11 26.8 22.5 21.175 29.525000000000002 12 25.45 22.5 25.174999999999997 26.875 13 25.275 23.875 24.349999999999998 26.5 14 25.55 25.124999999999996 23.375 25.95 15 24.75 24.224999999999998 25.2 25.825 16 27.275 24.825 22.475 25.424999999999997 17 25.6 24.55 23.525 26.325 18 25.3 25.575 24.2 24.925 19 26.650000000000002 24.3 23.724999999999998 25.324999999999996 20 26.525 24.224999999999998 23.375 25.874999999999996 21 25.124999999999996 24.05 24.95 25.874999999999996 22 26.1 24.85 23.425 25.624999999999996 23 25.45 25.124999999999996 25.025 24.4 24 26.0 24.474999999999998 25.275 24.25 25 26.05 22.975 24.7 26.275 26 26.174999999999997 25.474999999999998 24.425 23.925 27 25.15 25.55 23.875 25.424999999999997 28 25.974999999999998 25.374999999999996 23.95 24.7 29 25.85 25.5 24.349999999999998 24.3 30 25.3 24.4 25.5 24.8 31 25.5 26.125 23.974999999999998 24.4 32 24.675 25.6 24.9 24.825 33 25.074999999999996 24.2 25.45 25.275 34 26.575 23.5 23.7 26.224999999999998 35 26.0 25.2 24.875 23.925 36 26.275 24.474999999999998 23.599999999999998 25.650000000000002 37 25.624999999999996 24.224999999999998 24.575 25.575 38 27.250000000000004 25.3 23.849999999999998 23.599999999999998 39 25.474999999999998 24.6 24.525 25.4 40 26.474999999999998 24.85 24.525 24.15 41 25.25 25.75 24.175 24.825 42 26.25 25.575 24.0 24.175 43 25.900000000000002 24.65 24.675 24.775 44 25.900000000000002 24.8 23.674999999999997 25.624999999999996 45 24.65 26.200000000000003 23.45 25.7 46 25.974999999999998 24.875 24.025 25.124999999999996 47 25.8 25.45 24.15 24.6 48 25.525 25.775 24.45 24.25 49 26.6 24.2 23.9 25.3 50 24.8 25.874999999999996 24.5 24.825 51 26.325 24.4 24.5 24.775 52 25.731432858214554 24.281070267566893 25.081270317579396 24.90622655663916 53 26.981745436359088 25.35633908477119 22.605651412853213 25.056264066016503 54 25.531382845711427 24.48112028007002 24.756189047261813 25.23130782695674 55 27.631907976994246 25.131282820705174 23.53088272068017 23.705926481620406 56 26.531632908227053 25.731432858214554 23.10577644411103 24.63115778944736 57 25.881470367591895 24.90622655663916 24.406101525381345 24.8062015503876 58 27.68192048012003 24.10602650662666 24.256064016004 23.95598899724931 59 27.106776694173547 26.356589147286826 22.85571392848212 23.680920230057513 60 25.28132033008252 25.256314078519633 23.830957739434858 25.63140785196299 61 27.231807951987996 24.456114028507127 24.356089022255563 23.95598899724931 62 25.95648912228057 25.406351587896975 25.28132033008252 23.355838959739934 63 24.63115778944736 25.93148287071768 26.006501625406354 23.43085771442861 64 27.181795448862218 24.58114528632158 24.006001500375092 24.23105776444111 65 26.194645984488368 25.39404553415061 24.193144858643983 24.218163622717036 66 26.11528822055138 24.260651629072683 25.012531328320804 24.61152882205514 67 25.42799597180262 25.176233635448135 24.798590130916416 24.59718026183283 68 28.152341739577974 22.619660319094184 24.189397838394235 25.038600102933607 69 25.766016713091922 19.415041782729805 25.738161559888578 29.08077994428969 70 28.24283559577677 0.0 34.76621417797888 36.990950226244344 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 3.0 26 3.5 27 3.0 28 4.5 29 8.0 30 10.0 31 16.0 32 23.5 33 25.0 34 36.5 35 69.0 36 95.0 37 100.0 38 111.5 39 139.5 40 156.0 41 177.0 42 213.0 43 228.0 44 246.0 45 251.0 46 236.5 47 235.0 48 239.5 49 234.0 50 224.0 51 214.0 52 195.5 53 187.0 54 176.0 55 146.0 56 129.0 57 131.0 58 132.5 59 137.5 60 141.0 61 117.5 62 99.5 63 105.0 64 97.0 65 84.0 66 82.5 67 86.0 68 74.5 69 54.5 70 46.0 71 43.0 72 34.5 73 29.0 74 23.5 75 18.0 76 12.0 77 6.0 78 5.5 79 3.0 80 1.0 81 1.0 82 2.0 83 3.0 84 1.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.075 66 0.25 67 0.7000000000000001 68 2.85 69 10.25 70 33.7 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra Read 199428 spots for ERR5052698.sra Written 199428 spots for ERR5052698.sra Read 199409 spots for ERR5052698.sra Written 199409 spots for ERR5052698.sra SRR ids: ['ERR5052698.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3r42u7up ERR5052698.sra spots: 3988199 blocks: [[1, 199409], [199410, 398818], [398819, 598227], [598228, 797636], [797637, 997045], [997046, 1196454], [1196455, 1395863], [1395864, 1595272], [1595273, 1794681], [1794682, 1994090], [1994091, 2193499], [2193500, 2392908], [2392909, 2592317], [2592318, 2791726], [2791727, 2991135], [2991136, 3190544], [3190545, 3389953], [3389954, 3589362], [3589363, 3788771], [3788772, 3988199]] ERR5052698 file size 706670 ERR5052698 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052698 ERR5052698_1.fastq ERR5052698_2.fastq Input file: ERR5052698_1.fastq Paired file: ERR5052698_2.fastq trimmed: ERR5052698-trimmed-pair1.fastq, ERR5052698-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:40:10 2024 >> started Tue Dec 10 05:40:14 2024 >> done (4.111s) 3988199 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 147 ( 0.00%) empty read pairs filtered out after trimming by size control 3988052 (100.00%) read pairs available; of these: 13 ( 0.00%) trimmed read pairs available after processing 3988039 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 12 0.00% 70 3988039 100.00% 3988052 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=35 prefix-density=0.09 prefix-fanout=2.7 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=538.41 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=33.8 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=121.14 fanout-score-rank=10 prefix-density=0.84 prefix-fanout=18.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=469.18 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=15.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR5052698 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:40:44 Started mapping on | Dec 10 05:40:44 Finished on | Dec 10 05:40:57 Mapping speed, Million of reads per hour | 1104.38 Number of input reads | 3988052 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3777408 Uniquely mapped reads % | 94.72% Average mapped length | 138.73 Number of splices: Total | 1881255 Number of splices: Annotated (sjdb) | 1782972 Number of splices: GT/AG | 1854468 Number of splices: GC/AG | 23710 Number of splices: AT/AC | 1353 Number of splices: Non-canonical | 1724 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 55754 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 6680 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 154890 154890 154890 N_multimapping 55754 55754 55754 N_noFeature 104360 3694201 126609 N_ambiguous 69141 372 8403 UnstrandedReadsAssigned:3603907 PositiveStrandReadsAssigned:82835 NegativeStrandReadsAssigned:3642396 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052698 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052698-trimmed-pair1.fastq ERR5052698-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,988,052 reads, 3,766,745 reads pseudoaligned [quant] estimated average fragment length: 191.944 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52973 ERR5052698.ke.tsv 35125 ERR5052698.se.tsv 88098 total ==> ERR5052698.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.394 0 0 PNS24247 1044 853.056 18.2153 8.55198 PNS24249 1928 1737.06 42.8671 9.88365 PNS24246 1044 853.056 18.2153 8.55198 PNS24248 1044 853.056 18.2153 8.55198 PNS24244 1471 1280.06 8.48685 2.65537 PNS24243 293 120.625 0 0 KQK14069 1603 1412.06 1409.79 399.862 KQK14071 474 287.126 33.7846 47.1251 ==> ERR5052698.se.tsv <== BRADI_1g14170v3 1560 BRADI_1g53295v3 13 BRADI_1g59795v3 40 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 277 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 40 BRADI_1g48960v3 0 ERR5052698 completed mapping pipeline successfully