Starting /dee2/code/volunteer_pipeline.sh ERR5052699 current disk space = 1526854909952 free memory = 1422022888 ERR5052699 SRAfilesize 4f0b83822cff9096b57c056112200462 ERR5052699.sra ERR5052699.sra file validated ERR5052699 is paired end ERR5052699 is conventional basespace ERR5052699 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052699_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.35075 35.0 35.0 35.0 35.0 35.0 2 34.61575 35.0 35.0 35.0 35.0 35.0 3 34.5915 35.0 35.0 35.0 35.0 35.0 4 34.6095 35.0 35.0 35.0 35.0 35.0 5 34.6125 35.0 35.0 35.0 35.0 35.0 6 39.361 40.0 40.0 40.0 39.0 40.0 7 39.2545 40.0 40.0 40.0 39.0 40.0 8 39.23875 40.0 40.0 40.0 39.0 40.0 9 39.2865 40.0 40.0 40.0 39.0 40.0 10 39.3525 40.0 40.0 40.0 39.0 40.0 11 39.24075 40.0 40.0 40.0 39.0 40.0 12 39.2625 40.0 40.0 40.0 39.0 40.0 13 39.278 40.0 40.0 40.0 39.0 40.0 14 39.24 40.0 40.0 40.0 39.0 40.0 15 39.23525 40.0 40.0 40.0 39.0 40.0 16 39.2675 40.0 40.0 40.0 39.0 40.0 17 39.21675 40.0 40.0 40.0 39.0 40.0 18 39.27025 40.0 40.0 40.0 39.0 40.0 19 39.236 40.0 40.0 40.0 39.0 40.0 20 39.19675 40.0 40.0 40.0 39.0 40.0 21 39.24925 40.0 40.0 40.0 39.0 40.0 22 39.241 40.0 40.0 40.0 39.0 40.0 23 39.17125 40.0 40.0 40.0 39.0 40.0 24 39.138 40.0 40.0 40.0 39.0 40.0 25 39.172 40.0 40.0 40.0 38.0 40.0 26 39.1635 40.0 40.0 40.0 39.0 40.0 27 39.1585 40.0 40.0 40.0 39.0 40.0 28 39.22375 40.0 40.0 40.0 39.0 40.0 29 39.171 40.0 40.0 40.0 39.0 40.0 30 39.23525 40.0 40.0 40.0 39.0 40.0 31 39.2085 40.0 40.0 40.0 39.0 40.0 32 39.237 40.0 40.0 40.0 39.0 40.0 33 39.2075 40.0 40.0 40.0 39.0 40.0 34 39.24675 40.0 40.0 40.0 39.0 40.0 35 39.17525 40.0 40.0 40.0 39.0 40.0 36 39.21775 40.0 40.0 40.0 39.0 40.0 37 39.20525 40.0 40.0 40.0 39.0 40.0 38 39.17725 40.0 40.0 40.0 39.0 40.0 39 39.17525 40.0 40.0 40.0 39.0 40.0 40 39.18425 40.0 40.0 40.0 39.0 40.0 41 39.13225 40.0 40.0 40.0 38.0 40.0 42 39.13375 40.0 40.0 40.0 38.0 40.0 43 39.171 40.0 40.0 40.0 39.0 40.0 44 39.189 40.0 40.0 40.0 39.0 40.0 45 39.1315 40.0 40.0 40.0 39.0 40.0 46 39.12725 40.0 40.0 40.0 39.0 40.0 47 39.10325 40.0 40.0 40.0 39.0 40.0 48 39.21675 40.0 40.0 40.0 39.0 40.0 49 39.143 40.0 40.0 40.0 39.0 40.0 50 39.19075 40.0 40.0 40.0 39.0 40.0 51 39.2155 40.0 40.0 40.0 39.0 40.0 52 39.1375 40.0 40.0 40.0 39.0 40.0 53 39.1435 40.0 40.0 40.0 39.0 40.0 54 39.1625 40.0 40.0 40.0 39.0 40.0 55 39.12425 40.0 40.0 40.0 39.0 40.0 56 39.1605 40.0 40.0 40.0 39.0 40.0 57 39.045 40.0 40.0 40.0 38.0 40.0 58 39.099 40.0 40.0 40.0 38.0 40.0 59 39.15075 40.0 40.0 40.0 39.0 40.0 60 39.1585 40.0 40.0 40.0 39.0 40.0 61 39.1385 40.0 40.0 40.0 39.0 40.0 62 39.13025 40.0 40.0 40.0 39.0 40.0 63 39.18775 40.0 40.0 40.0 39.0 40.0 64 39.1195 40.0 40.0 40.0 38.0 40.0 65 39.118 40.0 40.0 40.0 38.0 40.0 66 39.12875 40.0 40.0 40.0 39.0 40.0 67 39.12 40.0 40.0 40.0 39.0 40.0 68 39.185 40.0 40.0 40.0 38.0 40.0 69 39.08875 40.0 40.0 40.0 38.0 40.0 70 39.07925 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 4.0 26 5.0 27 14.0 28 9.0 29 11.0 30 37.0 31 28.0 32 31.0 33 43.0 34 61.0 35 53.0 36 77.0 37 126.0 38 275.0 39 3223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.137452711223204 13.593947036569986 18.28499369482976 40.98360655737705 2 21.11055527763882 15.532766383191596 29.214607303651825 34.14207103551776 3 19.725 20.8 25.2 34.275 4 23.25 26.200000000000003 25.1 25.45 5 24.8 29.325000000000003 25.45 20.424999999999997 6 19.3 27.575 31.45 21.675 7 20.424999999999997 22.7 33.800000000000004 23.075000000000003 8 19.225 22.425 32.475 25.874999999999996 9 18.9 26.275 31.5 23.325000000000003 10 23.525 28.549999999999997 23.125 24.8 11 24.725 22.675 23.150000000000002 29.45 12 21.375 22.75 27.05 28.825 13 22.85 24.349999999999998 26.6 26.200000000000003 14 22.1 25.95 26.525 25.424999999999997 15 22.25 24.875 26.0 26.875 16 23.7 24.825 25.224999999999998 26.25 17 23.425 26.05 25.025 25.5 18 23.225 25.724999999999998 25.650000000000002 25.4 19 23.375 25.75 25.775 25.1 20 23.9 25.424999999999997 25.650000000000002 25.025 21 22.475 24.675 26.174999999999997 26.674999999999997 22 24.025 24.275 25.95 25.75 23 22.875 24.05 27.05 26.025 24 22.225 25.900000000000002 25.224999999999998 26.650000000000002 25 24.15 24.125 25.324999999999996 26.400000000000002 26 23.025000000000002 25.174999999999997 26.0 25.8 27 22.425 26.025 24.95 26.6 28 24.0 24.425 25.174999999999997 26.400000000000002 29 22.875 25.174999999999997 25.900000000000002 26.05 30 23.425 24.725 26.8 25.05 31 24.05 24.825 25.25 25.874999999999996 32 23.7 25.174999999999997 24.675 26.450000000000003 33 22.425 25.424999999999997 26.724999999999998 25.424999999999997 34 23.625 25.275 24.5 26.6 35 23.549999999999997 25.124999999999996 25.1 26.224999999999998 36 22.825 24.025 25.674999999999997 27.474999999999998 37 24.725 24.625 24.825 25.825 38 23.5 25.3 26.200000000000003 25.0 39 22.75 25.2 25.674999999999997 26.375 40 23.25 25.124999999999996 24.925 26.700000000000003 41 23.525 24.45 25.575 26.450000000000003 42 23.974999999999998 25.35 25.45 25.224999999999998 43 23.674999999999997 24.85 24.725 26.75 44 22.225 25.1 25.974999999999998 26.700000000000003 45 23.3 23.275000000000002 26.025 27.400000000000002 46 23.275000000000002 25.874999999999996 24.275 26.575 47 23.025000000000002 24.875 25.174999999999997 26.924999999999997 48 22.425 24.75 25.8 27.025 49 23.5 25.900000000000002 25.074999999999996 25.525 50 23.400000000000002 23.775 25.4 27.425 51 22.875 23.925 25.85 27.35 52 24.975 24.099999999999998 25.174999999999997 25.75 53 22.525000000000002 24.55 25.525 27.400000000000002 54 22.825 24.825 26.025 26.325 55 22.7 26.450000000000003 25.05 25.8 56 23.799999999999997 24.2 25.75 26.25 57 23.25 24.224999999999998 26.05 26.474999999999998 58 24.224999999999998 24.85 24.925 26.0 59 23.150000000000002 25.474999999999998 25.124999999999996 26.25 60 23.025000000000002 25.05 26.0 25.924999999999997 61 23.13078269567392 24.356089022255563 26.081520380095025 26.431607901975497 62 24.20605151287822 23.980995248812203 25.881470367591895 25.93148287071768 63 23.43085771442861 24.406101525381345 24.831207801950487 27.33183295823956 64 23.186593296648326 25.887943971985994 24.68734367183592 26.23811905952976 65 22.98649324662331 24.312156078039017 25.987993996998497 26.713356678339167 66 21.968937875751504 23.371743486973948 25.526052104208418 29.13326653306613 67 25.10702593805087 24.024175270712668 24.880382775119617 25.98841601611685 68 25.025641025641026 22.230769230769234 25.846153846153847 26.897435897435894 69 25.30186608122942 17.45334796926454 27.908891328210757 29.335894621295278 70 25.490909090909092 0.0 36.50909090909091 38.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.0 25 3.0 26 5.5 27 5.0 28 4.5 29 6.0 30 8.0 31 18.0 32 34.5 33 41.0 34 45.5 35 69.5 36 99.5 37 110.0 38 130.5 39 165.5 40 180.0 41 203.0 42 229.0 43 232.0 44 252.5 45 263.0 46 264.0 47 275.0 48 259.0 49 226.5 50 210.0 51 208.0 52 199.5 53 193.0 54 176.5 55 153.5 56 133.5 57 120.0 58 116.5 59 117.0 60 121.0 61 104.0 62 91.5 63 96.0 64 88.5 65 76.0 66 62.5 67 54.0 68 54.5 69 47.5 70 40.0 71 34.5 72 22.0 73 15.0 74 12.5 75 8.5 76 5.0 77 3.0 78 2.5 79 1.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.8750000000000001 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.05 65 0.05 66 0.2 67 0.7250000000000001 68 2.5 69 8.9 70 31.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052699 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052699_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.201 35.0 35.0 35.0 32.0 35.0 2 34.0035 35.0 35.0 35.0 32.0 35.0 3 33.7195 35.0 35.0 35.0 31.0 35.0 4 33.62775 35.0 35.0 35.0 31.0 35.0 5 33.6075 35.0 35.0 35.0 31.0 35.0 6 38.05875 40.0 40.0 40.0 34.0 40.0 7 37.98025 40.0 39.0 40.0 34.0 40.0 8 37.83675 40.0 39.0 40.0 34.0 40.0 9 38.0245 40.0 39.0 40.0 34.0 40.0 10 38.073 40.0 39.0 40.0 35.0 40.0 11 37.98325 40.0 40.0 40.0 34.0 40.0 12 38.055 40.0 40.0 40.0 34.0 40.0 13 38.0525 40.0 40.0 40.0 34.0 40.0 14 38.106 40.0 40.0 40.0 34.0 40.0 15 38.1395 40.0 40.0 40.0 34.0 40.0 16 38.09725 40.0 40.0 40.0 34.0 40.0 17 38.03225 40.0 40.0 40.0 34.0 40.0 18 38.07925 40.0 40.0 40.0 34.0 40.0 19 38.05475 40.0 40.0 40.0 34.0 40.0 20 38.1505 40.0 40.0 40.0 35.0 40.0 21 38.12175 40.0 40.0 40.0 35.0 40.0 22 38.12325 40.0 40.0 40.0 34.0 40.0 23 38.14375 40.0 40.0 40.0 35.0 40.0 24 38.065 40.0 40.0 40.0 35.0 40.0 25 38.02975 40.0 40.0 40.0 34.0 40.0 26 38.027 40.0 40.0 40.0 34.0 40.0 27 38.036 40.0 40.0 40.0 34.0 40.0 28 38.13175 40.0 40.0 40.0 35.0 40.0 29 38.03675 40.0 40.0 40.0 34.0 40.0 30 38.043 40.0 40.0 40.0 34.0 40.0 31 38.079 40.0 40.0 40.0 34.0 40.0 32 38.0775 40.0 40.0 40.0 34.0 40.0 33 38.134 40.0 40.0 40.0 35.0 40.0 34 38.081 40.0 40.0 40.0 35.0 40.0 35 38.0 40.0 39.0 40.0 34.0 40.0 36 38.10675 40.0 40.0 40.0 34.0 40.0 37 37.962 40.0 39.0 40.0 34.0 40.0 38 38.03925 40.0 40.0 40.0 34.0 40.0 39 38.019 40.0 40.0 40.0 34.0 40.0 40 38.09025 40.0 40.0 40.0 34.0 40.0 41 38.13475 40.0 39.0 40.0 35.0 40.0 42 38.07125 40.0 39.0 40.0 34.0 40.0 43 37.9265 40.0 39.0 40.0 34.0 40.0 44 37.83875 40.0 39.0 40.0 34.0 40.0 45 37.95775 40.0 39.0 40.0 34.0 40.0 46 37.94975 40.0 39.0 40.0 34.0 40.0 47 37.96575 40.0 39.0 40.0 34.0 40.0 48 37.88725 40.0 39.0 40.0 34.0 40.0 49 37.902 40.0 39.0 40.0 34.0 40.0 50 37.9445 40.0 39.0 40.0 34.0 40.0 51 37.94825 40.0 39.0 40.0 34.0 40.0 52 37.96625 40.0 39.0 40.0 34.0 40.0 53 37.87925 40.0 39.0 40.0 34.0 40.0 54 37.932 40.0 39.0 40.0 34.0 40.0 55 38.04875 40.0 39.0 40.0 34.0 40.0 56 37.90375 40.0 39.0 40.0 34.0 40.0 57 37.87575 40.0 39.0 40.0 34.0 40.0 58 37.971 40.0 39.0 40.0 34.0 40.0 59 37.931 40.0 39.0 40.0 34.0 40.0 60 37.96925 40.0 39.0 40.0 34.0 40.0 61 37.913 40.0 39.0 40.0 34.0 40.0 62 37.893 40.0 39.0 40.0 34.0 40.0 63 37.88975 40.0 39.0 40.0 34.0 40.0 64 37.84575 40.0 39.0 40.0 34.0 40.0 65 37.832 40.0 39.0 40.0 34.0 40.0 66 37.86475 40.0 39.0 40.0 34.0 40.0 67 37.961 40.0 39.0 40.0 34.0 40.0 68 37.97025 40.0 39.0 40.0 34.0 40.0 69 37.93425 40.0 39.0 40.0 34.0 40.0 70 37.873 40.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 8.0 18 11.0 19 31.0 20 39.0 21 33.0 22 35.0 23 29.0 24 38.0 25 24.0 26 25.0 27 26.0 28 23.0 29 23.0 30 17.0 31 27.0 32 32.0 33 41.0 34 41.0 35 48.0 36 78.0 37 103.0 38 246.0 39 3022.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.325 22.05 20.45 31.175000000000004 2 28.199999999999996 25.8 25.224999999999998 20.775 3 20.575 26.875 26.825 25.724999999999998 4 27.450000000000003 29.075 20.200000000000003 23.275000000000002 5 25.35 33.275 21.6 19.775000000000002 6 21.66624968726545 28.7215411558669 26.069552164123095 23.54265699274456 7 24.05 20.4 29.549999999999997 26.0 8 22.7 22.900000000000002 27.1 27.3 9 22.825 24.275 27.35 25.55 10 27.400000000000002 26.200000000000003 20.775 25.624999999999996 11 27.35 22.35 22.2 28.1 12 25.224999999999998 22.8 24.474999999999998 27.500000000000004 13 25.8 23.425 24.075 26.700000000000003 14 25.6 25.5 24.6 24.3 15 26.724999999999998 23.875 23.875 25.525 16 26.174999999999997 24.525 23.925 25.374999999999996 17 26.724999999999998 27.1 22.900000000000002 23.275000000000002 18 25.825 24.75 22.95 26.474999999999998 19 27.375 23.925 23.849999999999998 24.85 20 26.674999999999997 24.675 23.825 24.825 21 25.124999999999996 25.1 23.7 26.075 22 26.05 25.35 23.1 25.5 23 25.825 25.5 23.575 25.1 24 24.474999999999998 25.1 25.5 24.925 25 25.8 24.224999999999998 24.2 25.775 26 25.25 26.200000000000003 24.25 24.3 27 26.025 23.875 24.65 25.45 28 25.650000000000002 24.95 24.275 25.124999999999996 29 25.85 25.6 25.324999999999996 23.225 30 25.224999999999998 24.75 24.975 25.05 31 25.5 25.35 23.05 26.1 32 25.05 25.35 24.575 25.025 33 25.2 23.925 25.025 25.85 34 25.55 23.974999999999998 24.175 26.3 35 25.25 26.474999999999998 23.225 25.05 36 25.15 24.725 24.45 25.674999999999997 37 26.974999999999998 24.0 24.15 24.875 38 26.150000000000002 25.45 23.75 24.65 39 26.125 25.2 24.075 24.6 40 27.175 24.025 23.7 25.1 41 26.825 25.4 23.625 24.15 42 24.725 25.474999999999998 24.825 24.975 43 25.4 24.15 24.099999999999998 26.35 44 26.375 24.625 24.75 24.25 45 25.674999999999997 24.4 25.3 24.625 46 26.450000000000003 24.349999999999998 24.474999999999998 24.725 47 26.375 25.5 23.549999999999997 24.575 48 25.374999999999996 24.474999999999998 26.125 24.025 49 27.825 24.25 22.925 25.0 50 26.625 25.6 23.0 24.775 51 25.775 25.1 25.124999999999996 24.0 52 27.55 24.825 23.3 24.325 53 26.075 25.924999999999997 23.575 24.425 54 24.2 26.325 25.624999999999996 23.849999999999998 55 27.875 23.05 24.375 24.7 56 25.775 26.05 23.925 24.25 57 25.025 24.425 25.525 25.025 58 26.974999999999998 24.325 23.775 24.925 59 27.525 25.275 23.625 23.575 60 26.125 24.325 24.9 24.65 61 27.181795448862218 24.056014003500874 25.55638909727432 23.20580145036259 62 25.93148287071768 25.131282820705174 25.731432858214554 23.20580145036259 63 26.30657664416104 25.206301575393848 24.50612653163291 23.980995248812203 64 28.064032016008007 23.761880940470235 23.961980990495245 24.212106053026513 65 26.26970227670753 25.794345759319487 24.74355766825119 23.19239429572179 66 25.338345864661655 24.335839598997495 25.288220551378448 25.03759398496241 67 26.391337194661297 25.56031226391337 24.60337446487031 23.444976076555022 68 26.935940313866734 23.97736043220993 25.237972729611524 23.848726524311807 69 28.084868788386373 18.453378001116693 26.716917922948074 26.744835287548856 70 29.44649446494465 0.0 34.35424354243543 36.199261992619924 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 4.0 25 6.0 26 4.5 27 4.0 28 10.5 29 15.0 30 13.0 31 20.5 32 32.0 33 36.0 34 39.0 35 58.0 36 89.0 37 104.0 38 119.0 39 145.5 40 157.0 41 167.5 42 206.0 43 234.0 44 229.0 45 247.0 46 256.5 47 243.0 48 240.5 49 220.5 50 203.0 51 187.5 52 171.0 53 170.0 54 169.5 55 158.0 56 147.5 57 148.0 58 136.0 59 127.0 60 130.0 61 124.5 62 109.5 63 100.0 64 94.5 65 93.0 66 91.0 67 85.0 68 73.5 69 53.5 70 45.0 71 38.5 72 33.5 73 35.0 74 28.5 75 22.0 76 14.0 77 6.0 78 5.5 79 3.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.05 65 0.075 66 0.25 67 0.7250000000000001 68 2.825 69 10.45 70 32.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203691 spots for ERR5052699.sra Written 203691 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra Read 203673 spots for ERR5052699.sra Written 203673 spots for ERR5052699.sra SRR ids: ['ERR5052699.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3aoowfih ERR5052699.sra spots: 4073478 blocks: [[1, 203673], [203674, 407346], [407347, 611019], [611020, 814692], [814693, 1018365], [1018366, 1222038], [1222039, 1425711], [1425712, 1629384], [1629385, 1833057], [1833058, 2036730], [2036731, 2240403], [2240404, 2444076], [2444077, 2647749], [2647750, 2851422], [2851423, 3055095], [3055096, 3258768], [3258769, 3462441], [3462442, 3666114], [3666115, 3869787], [3869788, 4073478]] ERR5052699 file size 721827 ERR5052699 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052699 ERR5052699_1.fastq ERR5052699_2.fastq Input file: ERR5052699_1.fastq Paired file: ERR5052699_2.fastq trimmed: ERR5052699-trimmed-pair1.fastq, ERR5052699-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:15:44 2024 >> started Tue Dec 10 08:15:47 2024 >> done (3.491s) 4073478 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 150 ( 0.00%) empty read pairs filtered out after trimming by size control 4073328 (100.00%) read pairs available; of these: 20 ( 0.00%) trimmed read pairs available after processing 4073308 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 69 20 0.00% 70 4073308 100.00% 4073328 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=33 prefix-density=0.08 prefix-fanout=2.8 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=465.08 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=33.8 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=116.19 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=17.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=480.63 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=15.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR5052699 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:16:19 Started mapping on | Dec 10 08:16:19 Finished on | Dec 10 08:16:34 Mapping speed, Million of reads per hour | 977.60 Number of input reads | 4073328 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3851500 Uniquely mapped reads % | 94.55% Average mapped length | 138.72 Number of splices: Total | 1920025 Number of splices: Annotated (sjdb) | 1820635 Number of splices: GT/AG | 1892616 Number of splices: GC/AG | 24141 Number of splices: AT/AC | 1430 Number of splices: Non-canonical | 1838 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 57009 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 6912 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 164819 164819 164819 N_multimapping 57009 57009 57009 N_noFeature 107380 3766429 130123 N_ambiguous 70594 342 8448 UnstrandedReadsAssigned:3673526 PositiveStrandReadsAssigned:84729 NegativeStrandReadsAssigned:3712929 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052699 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052699-trimmed-pair1.fastq ERR5052699-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,073,328 reads, 3,845,123 reads pseudoaligned [quant] estimated average fragment length: 191.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52973 ERR5052699.ke.tsv 35125 ERR5052699.se.tsv 88098 total ==> ERR5052699.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.42 15.3801 8.09646 PNS24247 1044 853.08 9.34166 4.29706 PNS24249 1928 1737.08 20.1695 4.55629 PNS24246 1044 853.08 9.34166 4.29706 PNS24248 1044 853.08 9.34166 4.29706 PNS24244 1471 1280.08 21.4255 6.56796 PNS24243 293 120.868 0 0 KQK14069 1603 1412.08 1466.31 407.479 KQK14071 474 286.956 16.0192 21.9059 ==> ERR5052699.se.tsv <== BRADI_1g14170v3 1548 BRADI_1g53295v3 15 BRADI_1g59795v3 60 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 290 BRADI_1g74790v3 17 BRADI_1g09890v3 0 BRADI_1g77505v3 36 BRADI_1g48960v3 0 ERR5052699 completed mapping pipeline successfully