Starting /dee2/code/volunteer_pipeline.sh ERR5052700 current disk space = 1526817607680 free memory = 1598133708 ERR5052700 SRAfilesize e229b6de16f36f1c2ad1455b7ef96ee0 ERR5052700.sra ERR5052700.sra file validated ERR5052700 is paired end ERR5052700 is conventional basespace ERR5052700 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052700_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.28325 35.0 35.0 35.0 34.0 35.0 2 34.553 35.0 35.0 35.0 34.0 35.0 3 34.52325 35.0 35.0 35.0 34.0 35.0 4 34.54 35.0 35.0 35.0 34.0 35.0 5 34.52875 35.0 35.0 35.0 34.0 35.0 6 39.28625 40.0 40.0 40.0 39.0 40.0 7 39.23975 40.0 40.0 40.0 39.0 40.0 8 39.21125 40.0 40.0 40.0 39.0 40.0 9 39.2255 40.0 40.0 40.0 39.0 40.0 10 39.2105 40.0 40.0 40.0 39.0 40.0 11 39.24725 40.0 40.0 40.0 39.0 40.0 12 39.19825 40.0 40.0 40.0 38.0 40.0 13 39.2545 40.0 40.0 40.0 39.0 40.0 14 39.257 40.0 40.0 40.0 39.0 40.0 15 39.24375 40.0 40.0 40.0 39.0 40.0 16 39.138 40.0 40.0 40.0 39.0 40.0 17 39.23475 40.0 40.0 40.0 38.0 40.0 18 39.2255 40.0 40.0 40.0 39.0 40.0 19 39.17775 40.0 40.0 40.0 38.0 40.0 20 39.18675 40.0 40.0 40.0 38.0 40.0 21 39.25125 40.0 40.0 40.0 39.0 40.0 22 39.217 40.0 40.0 40.0 39.0 40.0 23 39.18075 40.0 40.0 40.0 39.0 40.0 24 39.12175 40.0 40.0 40.0 38.0 40.0 25 39.19875 40.0 40.0 40.0 39.0 40.0 26 39.0855 40.0 40.0 40.0 38.0 40.0 27 39.14075 40.0 40.0 40.0 39.0 40.0 28 39.126 40.0 40.0 40.0 38.0 40.0 29 39.11025 40.0 40.0 40.0 38.0 40.0 30 39.11375 40.0 40.0 40.0 38.0 40.0 31 39.106 40.0 40.0 40.0 38.0 40.0 32 39.124 40.0 40.0 40.0 38.0 40.0 33 39.11625 40.0 40.0 40.0 38.0 40.0 34 39.1035 40.0 40.0 40.0 38.0 40.0 35 39.1095 40.0 40.0 40.0 39.0 40.0 36 39.0635 40.0 40.0 40.0 38.0 40.0 37 39.12925 40.0 40.0 40.0 38.0 40.0 38 39.042 40.0 40.0 40.0 38.0 40.0 39 39.1505 40.0 40.0 40.0 38.0 40.0 40 39.06 40.0 40.0 40.0 38.0 40.0 41 39.02925 40.0 40.0 40.0 38.0 40.0 42 39.064 40.0 40.0 40.0 38.0 40.0 43 39.15125 40.0 40.0 40.0 39.0 40.0 44 39.18875 40.0 40.0 40.0 39.0 40.0 45 39.1295 40.0 40.0 40.0 38.0 40.0 46 39.14475 40.0 40.0 40.0 38.0 40.0 47 39.1145 40.0 40.0 40.0 39.0 40.0 48 39.14175 40.0 40.0 40.0 39.0 40.0 49 39.1375 40.0 40.0 40.0 38.0 40.0 50 39.10475 40.0 40.0 40.0 38.0 40.0 51 39.12225 40.0 40.0 40.0 38.0 40.0 52 39.12 40.0 40.0 40.0 38.0 40.0 53 39.15975 40.0 40.0 40.0 39.0 40.0 54 39.0065 40.0 40.0 40.0 38.0 40.0 55 39.08325 40.0 40.0 40.0 38.0 40.0 56 39.11125 40.0 40.0 40.0 38.0 40.0 57 39.097 40.0 40.0 40.0 38.0 40.0 58 39.02325 40.0 40.0 40.0 38.0 40.0 59 39.076 40.0 40.0 40.0 38.0 40.0 60 39.01375 40.0 40.0 40.0 38.0 40.0 61 38.975 40.0 40.0 40.0 38.0 40.0 62 38.98625 40.0 40.0 40.0 38.0 40.0 63 39.07725 40.0 40.0 40.0 38.0 40.0 64 39.05275 40.0 40.0 40.0 38.0 40.0 65 39.07625 40.0 40.0 40.0 38.0 40.0 66 39.059 40.0 40.0 40.0 38.0 40.0 67 39.03725 40.0 40.0 40.0 38.0 40.0 68 39.1065 40.0 40.0 40.0 38.0 40.0 69 38.9805 40.0 40.0 40.0 38.0 40.0 70 39.10475 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 2.0 26 5.0 27 12.0 28 15.0 29 19.0 30 23.0 31 32.0 32 29.0 33 59.0 34 58.0 35 59.0 36 98.0 37 148.0 38 247.0 39 3190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.82769075290551 14.14855987872663 17.028802425467408 39.994946942900455 2 23.175 16.2 28.425 32.2 3 21.325 23.3 24.45 30.925000000000004 4 24.375 27.650000000000002 23.175 24.8 5 23.275000000000002 31.424999999999997 24.7 20.599999999999998 6 20.175 26.0 31.225 22.6 7 20.75 22.75 32.75 23.75 8 20.200000000000003 21.099999999999998 31.374999999999996 27.325 9 19.5 26.275 29.975 24.25 10 24.474999999999998 28.999999999999996 21.275 25.25 11 25.3 22.575 23.325000000000003 28.799999999999997 12 23.05 22.425 26.575 27.950000000000003 13 23.75 24.125 26.55 25.575 14 23.674999999999997 23.849999999999998 26.075 26.400000000000002 15 23.925 23.45 25.0 27.625 16 24.224999999999998 25.05 25.35 25.374999999999996 17 24.0 25.35 25.525 25.124999999999996 18 25.05 24.825 23.05 27.075 19 24.175 25.924999999999997 23.775 26.125 20 24.15 24.775 25.3 25.775 21 23.275000000000002 24.025 26.150000000000002 26.55 22 23.3 25.224999999999998 24.75 26.724999999999998 23 23.75 25.15 24.8 26.3 24 23.225 24.075 25.724999999999998 26.974999999999998 25 23.325000000000003 24.525 24.975 27.175 26 23.375 24.975 25.374999999999996 26.275 27 23.65 24.05 25.424999999999997 26.875 28 23.225 24.224999999999998 25.424999999999997 27.125 29 24.15 23.9 25.650000000000002 26.3 30 23.724999999999998 24.325 24.95 27.0 31 24.825 24.775 23.625 26.775 32 22.25 24.474999999999998 26.525 26.75 33 24.474999999999998 23.575 24.025 27.925 34 24.425 23.375 24.6 27.6 35 23.75 24.15 26.05 26.05 36 24.775 22.925 24.575 27.725 37 24.425 25.074999999999996 23.9 26.6 38 24.025 24.75 25.575 25.650000000000002 39 24.575 24.525 25.624999999999996 25.275 40 24.4 24.099999999999998 24.925 26.575 41 24.525 24.099999999999998 24.65 26.724999999999998 42 21.95 24.925 25.674999999999997 27.450000000000003 43 23.275000000000002 24.925 23.674999999999997 28.125 44 23.325000000000003 24.725 24.975 26.974999999999998 45 22.95 25.224999999999998 24.725 27.1 46 24.474999999999998 25.074999999999996 24.05 26.400000000000002 47 24.65 24.5 24.9 25.95 48 24.525 24.8 24.575 26.1 49 24.525 24.349999999999998 24.025 27.1 50 24.099999999999998 24.675 24.6 26.625 51 22.8 24.65 24.525 28.025 52 24.075 25.6 23.799999999999997 26.525 53 23.525 23.474999999999998 25.650000000000002 27.35 54 23.35 24.224999999999998 24.5 27.925 55 24.2 24.975 24.5 26.325 56 23.0 24.9 25.900000000000002 26.200000000000003 57 24.175 25.025 24.725 26.075 58 24.349999999999998 24.95 24.375 26.325 59 24.925 25.424999999999997 24.474999999999998 25.174999999999997 60 24.725 24.725 23.599999999999998 26.950000000000003 61 24.6 23.625 25.074999999999996 26.700000000000003 62 23.849999999999998 24.075 25.35 26.724999999999998 63 23.1 24.3 24.925 27.675 64 23.45 25.924999999999997 25.650000000000002 24.975 65 24.18104526131533 24.5311327831958 25.70642660665166 25.581395348837212 66 24.285714285714285 22.932330827067666 26.04010025062657 26.741854636591476 67 24.67924528301887 24.251572327044023 24.880503144654085 26.18867924528302 68 25.345268542199488 24.705882352941178 24.092071611253196 25.85677749360614 69 23.451692815854667 18.909991742361683 27.82824112303881 29.81007431874484 70 26.513182324545113 0.0 33.56851095432603 39.91830672112886 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.0 26 3.0 27 5.0 28 7.0 29 8.5 30 8.0 31 13.5 32 28.0 33 37.0 34 42.0 35 53.0 36 80.0 37 101.0 38 117.5 39 148.5 40 163.0 41 182.5 42 219.5 43 237.0 44 245.5 45 267.5 46 268.0 47 255.0 48 250.0 49 232.5 50 220.0 51 205.0 52 182.5 53 175.0 54 174.0 55 166.5 56 139.5 57 119.0 58 131.0 59 138.5 60 134.0 61 120.5 62 97.5 63 88.0 64 87.0 65 78.5 66 75.0 67 79.0 68 66.0 69 47.5 70 42.0 71 39.0 72 26.5 73 17.0 74 17.5 75 14.5 76 11.0 77 11.0 78 7.5 79 2.5 80 1.0 81 0.5 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.025 66 0.25 67 0.625 68 2.25 69 9.175 70 32.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052700 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052700_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.06025 35.0 35.0 35.0 32.0 35.0 2 33.86975 35.0 35.0 35.0 31.0 35.0 3 33.55025 35.0 35.0 35.0 31.0 35.0 4 33.47525 35.0 35.0 35.0 31.0 35.0 5 33.43775 35.0 35.0 35.0 31.0 35.0 6 37.97525 40.0 39.0 40.0 34.0 40.0 7 37.74725 40.0 39.0 40.0 34.0 40.0 8 37.809 40.0 39.0 40.0 34.0 40.0 9 37.90725 40.0 39.0 40.0 34.0 40.0 10 37.95875 40.0 39.0 40.0 34.0 40.0 11 37.8825 40.0 39.0 40.0 34.0 40.0 12 37.896 40.0 40.0 40.0 34.0 40.0 13 37.87225 40.0 39.0 40.0 34.0 40.0 14 38.05 40.0 40.0 40.0 34.0 40.0 15 37.99625 40.0 40.0 40.0 34.0 40.0 16 38.01775 40.0 40.0 40.0 34.0 40.0 17 37.95325 40.0 40.0 40.0 34.0 40.0 18 37.95475 40.0 40.0 40.0 34.0 40.0 19 37.9095 40.0 40.0 40.0 34.0 40.0 20 37.90275 40.0 39.0 40.0 34.0 40.0 21 37.8225 40.0 39.0 40.0 34.0 40.0 22 37.87025 40.0 39.0 40.0 34.0 40.0 23 37.89725 40.0 39.0 40.0 34.0 40.0 24 37.865 40.0 39.0 40.0 34.0 40.0 25 37.903 40.0 39.0 40.0 34.0 40.0 26 37.86875 40.0 39.0 40.0 34.0 40.0 27 37.94675 40.0 39.0 40.0 34.0 40.0 28 37.9 40.0 39.0 40.0 34.0 40.0 29 37.886 40.0 39.0 40.0 34.0 40.0 30 37.9265 40.0 39.0 40.0 34.0 40.0 31 37.87525 40.0 39.0 40.0 34.0 40.0 32 37.8805 40.0 39.0 40.0 34.0 40.0 33 37.9795 40.0 39.0 40.0 34.0 40.0 34 37.89475 40.0 39.0 40.0 34.0 40.0 35 37.938 40.0 39.0 40.0 34.0 40.0 36 37.855 40.0 39.0 40.0 34.0 40.0 37 37.92 40.0 39.0 40.0 34.0 40.0 38 37.92175 40.0 39.0 40.0 34.0 40.0 39 37.8595 40.0 39.0 40.0 34.0 40.0 40 37.82575 40.0 39.0 40.0 34.0 40.0 41 37.846 40.0 39.0 40.0 34.0 40.0 42 37.7875 40.0 39.0 40.0 34.0 40.0 43 37.68725 40.0 39.0 40.0 31.0 40.0 44 37.755 40.0 39.0 40.0 34.0 40.0 45 37.7755 40.0 39.0 40.0 34.0 40.0 46 37.8385 40.0 39.0 40.0 34.0 40.0 47 37.67375 40.0 39.0 40.0 34.0 40.0 48 37.65575 40.0 39.0 40.0 31.0 40.0 49 37.70925 40.0 39.0 40.0 34.0 40.0 50 37.70275 40.0 39.0 40.0 34.0 40.0 51 37.71675 40.0 39.0 40.0 34.0 40.0 52 37.594 40.0 39.0 40.0 31.0 40.0 53 37.6065 40.0 39.0 40.0 31.0 40.0 54 37.57725 40.0 39.0 40.0 31.0 40.0 55 37.62525 40.0 39.0 40.0 31.0 40.0 56 37.6315 40.0 39.0 40.0 31.0 40.0 57 37.6725 40.0 39.0 40.0 31.0 40.0 58 37.7085 40.0 39.0 40.0 31.0 40.0 59 37.7635 40.0 39.0 40.0 34.0 40.0 60 37.7095 40.0 39.0 40.0 34.0 40.0 61 37.70425 40.0 39.0 40.0 34.0 40.0 62 37.75125 40.0 39.0 40.0 34.0 40.0 63 37.678 40.0 39.0 40.0 31.0 40.0 64 37.708 40.0 39.0 40.0 34.0 40.0 65 37.7215 40.0 39.0 40.0 34.0 40.0 66 37.666 40.0 39.0 40.0 34.0 40.0 67 37.621 40.0 39.0 40.0 34.0 40.0 68 37.608 40.0 39.0 40.0 34.0 40.0 69 37.64775 40.0 39.0 40.0 31.0 40.0 70 37.583 40.0 39.0 40.0 31.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 7.0 18 26.0 19 26.0 20 41.0 21 33.0 22 45.0 23 36.0 24 45.0 25 27.0 26 19.0 27 25.0 28 27.0 29 13.0 30 26.0 31 31.0 32 32.0 33 42.0 34 49.0 35 50.0 36 75.0 37 132.0 38 232.0 39 2960.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.2 20.925 19.825 30.049999999999997 2 29.375 25.374999999999996 22.75 22.5 3 21.775 26.875 25.95 25.4 4 26.025 28.599999999999998 20.849999999999998 24.525 5 26.125 32.05 21.475 20.349999999999998 6 23.5 27.075 24.675 24.75 7 24.65 20.075000000000003 28.375 26.900000000000002 8 22.900000000000002 21.45 26.525 29.125 9 23.724999999999998 25.15 25.775 25.35 10 26.35 25.3 20.65 27.700000000000003 11 27.750000000000004 22.575 20.275000000000002 29.4 12 26.25 21.85 24.425 27.474999999999998 13 25.4 23.65 24.575 26.375 14 26.400000000000002 24.825 22.625 26.150000000000002 15 25.474999999999998 25.424999999999997 23.175 25.924999999999997 16 26.25 24.224999999999998 22.525000000000002 27.0 17 27.200000000000003 24.224999999999998 22.6 25.974999999999998 18 25.45 24.975 23.674999999999997 25.900000000000002 19 26.125 24.7 22.55 26.625 20 27.474999999999998 25.124999999999996 23.200000000000003 24.2 21 25.85 24.45 23.75 25.95 22 25.525 24.95 24.474999999999998 25.05 23 26.3 25.474999999999998 23.275000000000002 24.95 24 24.2 25.7 25.124999999999996 24.975 25 25.900000000000002 23.45 23.875 26.775 26 27.800000000000004 23.974999999999998 22.875 25.35 27 26.424999999999997 24.099999999999998 23.9 25.575 28 24.9 24.349999999999998 24.45 26.3 29 26.3 23.9 23.5 26.3 30 25.074999999999996 25.224999999999998 24.3 25.4 31 25.650000000000002 25.8 23.925 24.625 32 27.3 24.95 22.1 25.650000000000002 33 25.05 24.725 24.25 25.974999999999998 34 24.375 25.2 24.2 26.224999999999998 35 26.6 25.15 22.5 25.75 36 25.05 24.325 23.9 26.724999999999998 37 26.3 23.5 23.974999999999998 26.224999999999998 38 25.974999999999998 25.05 23.775 25.2 39 24.5 24.725 24.375 26.400000000000002 40 26.275 24.125 24.125 25.474999999999998 41 26.025 25.275 23.35 25.35 42 26.150000000000002 25.2 24.15 24.5 43 26.85 23.575 24.224999999999998 25.35 44 26.950000000000003 25.374999999999996 22.375 25.3 45 25.174999999999997 25.55 23.9 25.374999999999996 46 26.1 24.575 23.025000000000002 26.3 47 25.724999999999998 25.374999999999996 24.775 24.125 48 25.85 25.25 24.224999999999998 24.675 49 26.5 23.75 24.325 25.424999999999997 50 27.1 25.0 23.7 24.2 51 25.75 25.124999999999996 24.3 24.825 52 26.075 23.5 24.95 25.474999999999998 53 26.85 25.124999999999996 23.925 24.099999999999998 54 25.900000000000002 24.775 24.0 25.324999999999996 55 27.275 23.5 23.549999999999997 25.674999999999997 56 27.675 25.525 22.400000000000002 24.4 57 25.924999999999997 24.75 25.074999999999996 24.25 58 26.75 24.45 23.474999999999998 25.324999999999996 59 26.85 25.924999999999997 22.95 24.275 60 26.25 24.775 24.55 24.425 61 27.3 22.975 24.775 24.95 62 26.25 24.325 25.324999999999996 24.099999999999998 63 25.474999999999998 24.175 25.05 25.3 64 27.375 24.224999999999998 23.875 24.525 65 26.900000000000002 23.925 23.65 25.525 66 27.29323308270677 23.458646616541355 23.55889724310777 25.68922305764411 67 26.16469403173004 24.779652480483506 25.358851674641148 23.696801813145303 68 25.579001544004115 24.112197632527018 24.8327328872877 25.476067936181163 69 26.211699164345404 18.997214484679667 26.323119777158777 28.467966573816156 70 27.493462831527832 0.0 35.861038475905865 36.645498692566306 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 2.0 20 3.0 21 2.0 22 1.0 23 1.0 24 2.0 25 4.0 26 3.5 27 2.0 28 3.0 29 8.5 30 13.0 31 16.0 32 24.0 33 29.0 34 39.5 35 58.0 36 75.5 37 85.0 38 102.0 39 131.0 40 143.0 41 163.0 42 181.5 43 180.0 44 207.5 45 241.5 46 239.0 47 230.0 48 234.5 49 218.5 50 198.0 51 199.0 52 195.0 53 190.0 54 184.5 55 159.5 56 151.5 57 163.0 58 156.5 59 139.0 60 128.0 61 125.5 62 111.0 63 99.0 64 105.5 65 101.5 66 85.5 67 80.0 68 81.5 69 72.0 70 61.0 71 54.5 72 41.0 73 34.0 74 28.0 75 17.5 76 11.0 77 9.0 78 6.0 79 2.0 80 1.0 81 2.0 82 2.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.25 67 0.7250000000000001 68 2.85 69 10.25 70 33.074999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205247 spots for ERR5052700.sra Written 205247 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra Read 205243 spots for ERR5052700.sra Written 205243 spots for ERR5052700.sra SRR ids: ['ERR5052700.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oqhlxyno ERR5052700.sra spots: 4104864 blocks: [[1, 205243], [205244, 410486], [410487, 615729], [615730, 820972], [820973, 1026215], [1026216, 1231458], [1231459, 1436701], [1436702, 1641944], [1641945, 1847187], [1847188, 2052430], [2052431, 2257673], [2257674, 2462916], [2462917, 2668159], [2668160, 2873402], [2873403, 3078645], [3078646, 3283888], [3283889, 3489131], [3489132, 3694374], [3694375, 3899617], [3899618, 4104864]] ERR5052700 file size 727406 ERR5052700 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052700 ERR5052700_1.fastq ERR5052700_2.fastq Input file: ERR5052700_1.fastq Paired file: ERR5052700_2.fastq trimmed: ERR5052700-trimmed-pair1.fastq, ERR5052700-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:15:37 2024 >> started Tue Dec 10 08:15:41 2024 >> done (4.297s) 4104864 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 25 ( 0.00%) empty read pairs filtered out after trimming by size control 4104839 (100.00%) read pairs available; of these: 13 ( 0.00%) trimmed read pairs available after processing 4104826 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 12 0.00% 70 4104826 100.00% 4104839 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=33 prefix-density=0.10 prefix-fanout=2.6 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=528.86 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=32.5 sequence=CTTCTTCTTCTGCTTGCCACCGCCGGACTTGGCGGGCTTGGAAGACGGCGGCGG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=120.98 fanout-score-rank=13 prefix-density=0.94 prefix-fanout=18.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=570.66 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=16.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGC ERR5052700 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:16:16 Started mapping on | Dec 10 08:16:16 Finished on | Dec 10 08:16:31 Mapping speed, Million of reads per hour | 985.16 Number of input reads | 4104839 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3831812 Uniquely mapped reads % | 93.35% Average mapped length | 138.74 Number of splices: Total | 1919530 Number of splices: Annotated (sjdb) | 1815783 Number of splices: GT/AG | 1891857 Number of splices: GC/AG | 24760 Number of splices: AT/AC | 1293 Number of splices: Non-canonical | 1620 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 54364 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 7158 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.66% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 218663 218663 218663 N_multimapping 54364 54364 54364 N_noFeature 99105 3751389 120465 N_ambiguous 67223 367 8295 UnstrandedReadsAssigned:3665484 PositiveStrandReadsAssigned:80056 NegativeStrandReadsAssigned:3703052 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052700 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052700-trimmed-pair1.fastq ERR5052700-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,104,839 reads, 3,855,493 reads pseudoaligned [quant] estimated average fragment length: 188.848 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52973 ERR5052700.ke.tsv 35125 ERR5052700.se.tsv 88098 total ==> ERR5052700.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.479 9.11263 4.74405 PNS24247 1044 856.152 10.6019 4.82521 PNS24249 1928 1740.15 22.6177 5.06462 PNS24246 1044 856.152 10.6019 4.82521 PNS24248 1044 856.152 10.6019 4.82521 PNS24244 1471 1283.15 31.4641 9.5548 PNS24243 293 119.533 0 0 KQK14069 1603 1415.15 2265.67 623.847 KQK14071 474 289.003 35.6346 48.0456 ==> ERR5052700.se.tsv <== BRADI_1g14170v3 2443 BRADI_1g53295v3 15 BRADI_1g59795v3 51 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 275 BRADI_1g74790v3 24 BRADI_1g09890v3 0 BRADI_1g77505v3 45 BRADI_1g48960v3 0 ERR5052700 completed mapping pipeline successfully