Starting /dee2/code/volunteer_pipeline.sh ERR5052701 current disk space = 1525855182848 free memory = 1568093352 ERR5052701 SRAfilesize a4ded3016ca98db5a3728e2f26b9dafb ERR5052701.sra ERR5052701.sra file validated ERR5052701 is paired end ERR5052701 is conventional basespace ERR5052701 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052701_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.40725 35.0 35.0 35.0 34.0 35.0 2 34.603 35.0 35.0 35.0 35.0 35.0 3 34.563 35.0 35.0 35.0 34.0 35.0 4 34.535 35.0 35.0 35.0 34.0 35.0 5 34.5625 35.0 35.0 35.0 34.0 35.0 6 39.2285 40.0 40.0 40.0 39.0 40.0 7 39.21225 40.0 40.0 40.0 39.0 40.0 8 39.122 40.0 40.0 40.0 38.0 40.0 9 39.20275 40.0 40.0 40.0 39.0 40.0 10 39.2155 40.0 40.0 40.0 39.0 40.0 11 39.17525 40.0 40.0 40.0 39.0 40.0 12 39.17775 40.0 40.0 40.0 39.0 40.0 13 39.16825 40.0 40.0 40.0 39.0 40.0 14 39.24625 40.0 40.0 40.0 39.0 40.0 15 39.20925 40.0 40.0 40.0 39.0 40.0 16 39.19125 40.0 40.0 40.0 39.0 40.0 17 39.10825 40.0 40.0 40.0 38.0 40.0 18 39.17425 40.0 40.0 40.0 39.0 40.0 19 39.217 40.0 40.0 40.0 38.0 40.0 20 39.193 40.0 40.0 40.0 38.0 40.0 21 39.128 40.0 40.0 40.0 38.0 40.0 22 39.13025 40.0 40.0 40.0 38.0 40.0 23 39.081 40.0 40.0 40.0 38.0 40.0 24 39.135 40.0 40.0 40.0 39.0 40.0 25 39.193 40.0 40.0 40.0 38.0 40.0 26 39.12625 40.0 40.0 40.0 39.0 40.0 27 39.116 40.0 40.0 40.0 38.0 40.0 28 39.082 40.0 40.0 40.0 39.0 40.0 29 39.0875 40.0 40.0 40.0 38.0 40.0 30 39.05825 40.0 40.0 40.0 38.0 40.0 31 39.043 40.0 40.0 40.0 38.0 40.0 32 39.1345 40.0 40.0 40.0 38.0 40.0 33 39.11975 40.0 40.0 40.0 38.0 40.0 34 39.14525 40.0 40.0 40.0 38.0 40.0 35 39.06625 40.0 40.0 40.0 38.0 40.0 36 39.1035 40.0 40.0 40.0 38.0 40.0 37 39.155 40.0 40.0 40.0 39.0 40.0 38 39.0885 40.0 40.0 40.0 38.0 40.0 39 39.0445 40.0 40.0 40.0 38.0 40.0 40 39.101 40.0 40.0 40.0 38.0 40.0 41 39.0305 40.0 40.0 40.0 38.0 40.0 42 38.98375 40.0 40.0 40.0 38.0 40.0 43 39.10925 40.0 40.0 40.0 38.0 40.0 44 39.123 40.0 40.0 40.0 38.0 40.0 45 39.07975 40.0 40.0 40.0 38.0 40.0 46 39.0275 40.0 40.0 40.0 38.0 40.0 47 39.035 40.0 40.0 40.0 38.0 40.0 48 39.08525 40.0 40.0 40.0 38.0 40.0 49 39.15025 40.0 40.0 40.0 38.0 40.0 50 39.13075 40.0 40.0 40.0 38.0 40.0 51 39.1275 40.0 40.0 40.0 38.0 40.0 52 39.0405 40.0 40.0 40.0 38.0 40.0 53 39.081 40.0 40.0 40.0 38.0 40.0 54 39.0835 40.0 40.0 40.0 38.0 40.0 55 39.0155 40.0 40.0 40.0 38.0 40.0 56 39.0315 40.0 40.0 40.0 38.0 40.0 57 38.99925 40.0 40.0 40.0 38.0 40.0 58 39.002 40.0 40.0 40.0 38.0 40.0 59 38.9885 40.0 40.0 40.0 37.0 40.0 60 38.98375 40.0 40.0 40.0 38.0 40.0 61 39.0815 40.0 40.0 40.0 38.0 40.0 62 39.09775 40.0 40.0 40.0 38.0 40.0 63 39.06125 40.0 40.0 40.0 38.0 40.0 64 38.99775 40.0 40.0 40.0 38.0 40.0 65 39.008 40.0 40.0 40.0 38.0 40.0 66 39.04225 40.0 40.0 40.0 38.0 40.0 67 39.01025 40.0 40.0 40.0 38.0 40.0 68 39.05125 40.0 40.0 40.0 38.0 40.0 69 39.0995 40.0 40.0 40.0 38.0 40.0 70 38.97675 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 4.0 26 8.0 27 10.0 28 17.0 29 23.0 30 27.0 31 31.0 32 32.0 33 54.0 34 57.0 35 69.0 36 102.0 37 121.0 38 249.0 39 3193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.508048289738433 13.707243460764587 17.354124748490946 38.43058350100604 2 21.94145609206905 16.937703277458095 28.796597448086064 32.324243182386795 3 22.075 23.525 24.875 29.525000000000002 4 24.775 26.375 24.224999999999998 24.625 5 25.1 31.175000000000004 24.3 19.425 6 19.875 25.724999999999998 30.925000000000004 23.474999999999998 7 21.8 21.925 32.725 23.549999999999997 8 19.375 20.875 31.7 28.050000000000004 9 19.650000000000002 25.1 31.125000000000004 24.125 10 24.05 27.0 22.85 26.1 11 24.95 22.95 24.0 28.1 12 23.1 24.025 26.75 26.125 13 23.875 24.05 25.275 26.8 14 22.275 25.924999999999997 27.025 24.775 15 22.975 24.125 25.75 27.150000000000002 16 23.95 24.85 25.25 25.95 17 23.25 24.525 25.674999999999997 26.55 18 23.05 24.05 25.525 27.375 19 24.025 25.074999999999996 25.924999999999997 24.975 20 23.7 24.775 26.525 25.0 21 22.05 24.25 26.424999999999997 27.275 22 23.175 25.6 24.65 26.575 23 22.400000000000002 25.6 25.275 26.724999999999998 24 21.65 24.3 25.8 28.249999999999996 25 23.599999999999998 25.0 24.349999999999998 27.05 26 23.799999999999997 25.900000000000002 25.324999999999996 24.975 27 22.475 24.6 25.275 27.650000000000002 28 24.099999999999998 24.275 25.05 26.575 29 23.724999999999998 25.55 24.95 25.775 30 22.35 24.9 25.525 27.224999999999998 31 23.05 25.575 24.6 26.775 32 23.474999999999998 25.6 25.35 25.575 33 22.025 23.549999999999997 26.325 28.1 34 23.5 24.8 25.3 26.400000000000002 35 23.3 24.425 26.3 25.974999999999998 36 24.099999999999998 23.75 25.8 26.35 37 24.05 23.275000000000002 24.9 27.775 38 24.4 24.775 25.724999999999998 25.1 39 24.0 23.799999999999997 25.174999999999997 27.025 40 23.175 25.05 24.325 27.450000000000003 41 24.05 25.025 25.0 25.924999999999997 42 23.925 24.65 25.55 25.874999999999996 43 23.549999999999997 23.65 24.099999999999998 28.7 44 23.655913978494624 25.406351587896975 25.35633908477119 25.581395348837212 45 22.930732683170792 24.60615153788447 25.906476619154787 26.556639159789945 46 23.25581395348837 25.081270317579396 25.731432858214554 25.93148287071768 47 23.705926481620406 25.381345336334082 25.006251562890725 25.906476619154787 48 22.95573893473368 24.706176544136035 25.681420355088775 26.65666416604151 49 23.330832708177045 25.10627656914228 25.30632658164541 26.25656414103526 50 24.48112028007002 25.55638909727432 24.90622655663916 25.056264066016503 51 23.330832708177045 24.63115778944736 25.6064016004001 26.431607901975497 52 24.33108277069267 24.58114528632158 24.406101525381345 26.6816704176044 53 23.53088272068017 25.85646411602901 25.156289072268066 25.456364091022753 54 23.905976494123532 24.48112028007002 25.156289072268066 26.456614153538382 55 24.58114528632158 24.456114028507127 24.8062015503876 26.156539134783696 56 22.380595148787197 26.131532883220803 25.156289072268066 26.331582895723933 57 23.15578894723681 23.95598899724931 26.331582895723933 26.556639159789945 58 24.33108277069267 25.256314078519633 23.53088272068017 26.881720430107524 59 23.81190595297649 25.362681340670335 25.83791895947974 24.987493746873437 60 23.58679339669835 24.262131065532767 26.23811905952976 25.912956478239117 61 24.16208104052026 24.487243621810904 24.187093546773387 27.163581790895446 62 25.087543771885944 25.03751875937969 25.212606303151574 24.662331165582792 63 24.337168584292147 23.81190595297649 25.912956478239117 25.937968984492244 64 23.373373373373376 24.84984984984985 25.725725725725724 26.05105105105105 65 23.5985985985986 25.075075075075077 24.924924924924923 26.401401401401404 66 22.383575363044567 24.061091637456183 25.81372058087131 27.74161241862794 67 24.086671705719326 24.16225749559083 24.666162761400855 27.08490803728899 68 24.187356027642693 23.137957512157666 25.95341694394676 26.721269516252878 69 24.97240618101545 17.908388520971304 27.041942604856512 30.07726269315673 70 26.33699633699634 0.0 36.15384615384615 37.50915750915751 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 3.5 26 6.0 27 8.0 28 8.0 29 7.0 30 6.0 31 18.0 32 35.5 33 41.0 34 40.5 35 53.0 36 87.5 37 109.0 38 125.5 39 159.5 40 177.0 41 179.5 42 211.0 43 240.0 44 260.0 45 266.5 46 261.5 47 270.0 48 275.5 49 252.5 50 224.0 51 218.0 52 201.0 53 190.0 54 176.0 55 152.0 56 133.5 57 125.0 58 117.0 59 117.5 60 126.0 61 111.0 62 92.5 63 89.0 64 83.0 65 70.5 66 66.0 67 68.0 68 60.5 69 46.5 70 40.0 71 34.5 72 24.0 73 19.0 74 17.5 75 12.5 76 6.5 77 4.0 78 3.0 79 1.0 80 0.0 81 0.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.6 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.05 60 0.05 61 0.05 62 0.05 63 0.05 64 0.1 65 0.1 66 0.15 67 0.775 68 2.325 69 9.4 70 31.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052701 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052701_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.04825 35.0 35.0 35.0 32.0 35.0 2 33.80075 35.0 35.0 35.0 31.0 35.0 3 33.46375 35.0 35.0 35.0 31.0 35.0 4 33.34925 35.0 35.0 35.0 31.0 35.0 5 33.342 35.0 35.0 35.0 31.0 35.0 6 37.63175 40.0 39.0 40.0 31.0 40.0 7 37.54275 40.0 39.0 40.0 31.0 40.0 8 37.545 40.0 39.0 40.0 31.0 40.0 9 37.6465 40.0 39.0 40.0 31.0 40.0 10 37.6645 40.0 39.0 40.0 34.0 40.0 11 37.73 40.0 39.0 40.0 34.0 40.0 12 37.77025 40.0 39.0 40.0 34.0 40.0 13 37.751 40.0 39.0 40.0 34.0 40.0 14 37.74725 40.0 39.0 40.0 31.0 40.0 15 37.7765 40.0 39.0 40.0 34.0 40.0 16 37.72625 40.0 39.0 40.0 34.0 40.0 17 37.6795 40.0 39.0 40.0 31.0 40.0 18 37.64525 40.0 39.0 40.0 31.0 40.0 19 37.56525 40.0 39.0 40.0 31.0 40.0 20 37.70525 40.0 39.0 40.0 34.0 40.0 21 37.67225 40.0 39.0 40.0 31.0 40.0 22 37.71375 40.0 39.0 40.0 34.0 40.0 23 37.749 40.0 39.0 40.0 34.0 40.0 24 37.6405 40.0 39.0 40.0 31.0 40.0 25 37.618 40.0 39.0 40.0 31.0 40.0 26 37.6175 40.0 39.0 40.0 31.0 40.0 27 37.68075 40.0 39.0 40.0 31.0 40.0 28 37.607 40.0 39.0 40.0 31.0 40.0 29 37.686 40.0 39.0 40.0 31.0 40.0 30 37.70225 40.0 39.0 40.0 34.0 40.0 31 37.708 40.0 39.0 40.0 34.0 40.0 32 37.694 40.0 39.0 40.0 31.0 40.0 33 37.7705 40.0 39.0 40.0 34.0 40.0 34 37.599 40.0 39.0 40.0 31.0 40.0 35 37.65 40.0 39.0 40.0 31.0 40.0 36 37.63475 40.0 39.0 40.0 31.0 40.0 37 37.58575 40.0 39.0 40.0 31.0 40.0 38 37.65525 40.0 39.0 40.0 31.0 40.0 39 37.742 40.0 39.0 40.0 34.0 40.0 40 37.68075 40.0 39.0 40.0 34.0 40.0 41 37.5675 40.0 39.0 40.0 31.0 40.0 42 37.50075 40.0 39.0 40.0 30.0 40.0 43 37.518 40.0 39.0 40.0 31.0 40.0 44 37.4735 40.0 39.0 40.0 30.0 40.0 45 37.606 40.0 39.0 40.0 31.0 40.0 46 37.58675 40.0 39.0 40.0 31.0 40.0 47 37.60975 40.0 39.0 40.0 31.0 40.0 48 37.5085 40.0 39.0 40.0 31.0 40.0 49 37.5595 40.0 39.0 40.0 30.0 40.0 50 37.6235 40.0 39.0 40.0 31.0 40.0 51 37.62 40.0 39.0 40.0 34.0 40.0 52 37.565 40.0 39.0 40.0 31.0 40.0 53 37.50175 40.0 39.0 40.0 30.0 40.0 54 37.646 40.0 39.0 40.0 31.0 40.0 55 37.5095 40.0 39.0 40.0 30.0 40.0 56 37.5475 40.0 39.0 40.0 31.0 40.0 57 37.47575 40.0 39.0 40.0 30.0 40.0 58 37.479 40.0 39.0 40.0 30.0 40.0 59 37.61125 40.0 39.0 40.0 31.0 40.0 60 37.5715 40.0 39.0 40.0 31.0 40.0 61 37.57375 40.0 39.0 40.0 31.0 40.0 62 37.62475 40.0 39.0 40.0 31.0 40.0 63 37.465 40.0 39.0 40.0 30.0 40.0 64 37.55725 40.0 39.0 40.0 31.0 40.0 65 37.548 40.0 39.0 40.0 31.0 40.0 66 37.5355 40.0 39.0 40.0 31.0 40.0 67 37.45 40.0 39.0 40.0 28.0 40.0 68 37.54575 40.0 39.0 40.0 31.0 40.0 69 37.4635 40.0 39.0 40.0 27.0 40.0 70 37.5175 40.0 39.0 40.0 31.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 10.0 18 18.0 19 42.0 20 34.0 21 43.0 22 53.0 23 51.0 24 24.0 25 36.0 26 18.0 27 33.0 28 30.0 29 31.0 30 17.0 31 32.0 32 43.0 33 43.0 34 52.0 35 47.0 36 64.0 37 104.0 38 248.0 39 2923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.1 19.650000000000002 20.549999999999997 28.7 2 29.25 26.5 22.650000000000002 21.6 3 23.425 26.700000000000003 24.625 25.25 4 25.55 30.049999999999997 21.3 23.1 5 24.75 34.599999999999994 20.75 19.900000000000002 6 23.667750813109834 26.394796097072803 26.21966474856142 23.71778834125594 7 25.6 19.3 28.15 26.950000000000003 8 22.55 22.05 26.450000000000003 28.95 9 23.724999999999998 23.724999999999998 26.275 26.275 10 26.8 25.75 21.224999999999998 26.224999999999998 11 28.875 21.349999999999998 21.775 28.000000000000004 12 25.525 22.175 25.174999999999997 27.125 13 26.0 23.674999999999997 24.349999999999998 25.974999999999998 14 24.95 25.174999999999997 25.3 24.575 15 25.650000000000002 23.7 24.925 25.724999999999998 16 28.249999999999996 23.825 23.125 24.8 17 26.35 25.124999999999996 23.125 25.4 18 26.275 22.95 24.65 26.125 19 27.125 24.375 22.675 25.825 20 26.150000000000002 25.35 23.474999999999998 25.025 21 25.525 24.6 25.224999999999998 24.65 22 27.224999999999998 24.625 22.575 25.575 23 25.775 26.0 23.45 24.775 24 24.875 24.2 25.1 25.825 25 26.700000000000003 23.425 24.975 24.9 26 26.325 24.15 24.349999999999998 25.174999999999997 27 25.45 25.6 24.0 24.95 28 26.900000000000002 24.2 23.375 25.525 29 25.75 25.974999999999998 23.724999999999998 24.55 30 25.424999999999997 24.775 24.8 25.0 31 26.974999999999998 25.1 23.35 24.575 32 26.625 24.75 23.075000000000003 25.55 33 25.3 25.1 24.325 25.275 34 27.224999999999998 24.8 23.75 24.224999999999998 35 26.200000000000003 26.325 23.425 24.05 36 25.5 24.95 23.549999999999997 26.0 37 26.700000000000003 23.974999999999998 23.575 25.75 38 26.1 26.375 24.325 23.200000000000003 39 25.224999999999998 24.15 25.650000000000002 24.975 40 26.875 22.725 24.675 25.724999999999998 41 26.200000000000003 25.05 23.575 25.174999999999997 42 25.5 24.725 23.599999999999998 26.174999999999997 43 27.224999999999998 24.075 23.95 24.75 44 26.25656414103526 25.35633908477119 24.33108277069267 24.056014003500874 45 26.906726681670417 24.756189047261813 23.080770192548137 25.256314078519633 46 28.00700175043761 24.006001500375092 22.080520130032507 25.906476619154787 47 26.356589147286826 25.256314078519633 24.10602650662666 24.281070267566893 48 27.00675168792198 25.30632658164541 23.605901475368842 24.081020255063766 49 27.056764191047762 26.106526631657918 23.755938984746187 23.080770192548137 50 27.056764191047762 24.656164041010253 24.031007751937985 24.256064016004 51 25.581395348837212 24.50612653163291 25.30632658164541 24.60615153788447 52 27.53188297074269 25.28132033008252 23.50587646911728 23.680920230057513 53 25.206301575393848 26.25656414103526 24.10602650662666 24.431107776944234 54 25.93148287071768 24.50612653163291 24.681170292573142 24.88122030507627 55 27.656914228557138 23.830957739434858 23.330832708177045 25.18129532383096 56 26.30657664416104 25.30632658164541 24.981245311327832 23.40585146286572 57 25.656414103525883 24.431107776944234 24.50612653163291 25.406351587896975 58 28.157039259814955 24.15603900975244 23.10577644411103 24.58114528632158 59 26.60665166291573 25.93148287071768 24.18104526131533 23.280820205051263 60 24.487243621810904 25.46273136568284 24.58729364682341 25.46273136568284 61 26.488244122061033 24.287143571785894 24.387193596798397 24.83741870935468 62 26.738369184592298 26.613306653326664 23.23661830915458 23.411705852926463 63 25.212606303151574 24.487243621810904 24.88744372186093 25.41270635317659 64 24.637318659329665 23.88694347173587 25.887943971985994 25.587793896948476 65 26.770077558168627 24.618463847885916 23.892919689767325 24.718538904178132 66 25.306940616386868 25.382109746930592 24.95615134051616 24.354798296166376 67 27.99193751574704 24.288233812043337 23.683547493071302 24.03628117913832 68 27.41769547325103 23.765432098765434 24.819958847736626 23.996913580246915 69 27.543079488604782 19.06614785992218 26.87604224569205 26.51473040578099 70 30.128205128205128 0.0 34.16289592760181 35.70889894419306 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 3.0 26 3.5 27 4.0 28 4.5 29 15.0 30 25.0 31 22.0 32 23.0 33 27.0 34 38.5 35 58.5 36 79.0 37 91.0 38 104.5 39 134.5 40 151.0 41 171.0 42 205.0 43 219.0 44 232.5 45 239.5 46 237.0 47 241.0 48 230.5 49 210.5 50 201.0 51 205.5 52 180.5 53 151.0 54 174.5 55 179.0 56 156.0 57 152.0 58 139.0 59 137.5 60 149.0 61 132.0 62 107.5 63 100.0 64 104.0 65 92.5 66 78.0 67 79.0 68 77.0 69 67.0 70 59.0 71 53.5 72 38.0 73 28.0 74 22.0 75 14.0 76 9.5 77 7.0 78 7.0 79 4.5 80 2.0 81 1.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.05 61 0.05 62 0.05 63 0.05 64 0.05 65 0.075 66 0.22499999999999998 67 0.775 68 2.8000000000000003 69 10.05 70 33.7 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra Read 209415 spots for ERR5052701.sra Written 209415 spots for ERR5052701.sra Read 209413 spots for ERR5052701.sra Written 209413 spots for ERR5052701.sra SRR ids: ['ERR5052701.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u95hhbah ERR5052701.sra spots: 4188262 blocks: [[1, 209413], [209414, 418826], [418827, 628239], [628240, 837652], [837653, 1047065], [1047066, 1256478], [1256479, 1465891], [1465892, 1675304], [1675305, 1884717], [1884718, 2094130], [2094131, 2303543], [2303544, 2512956], [2512957, 2722369], [2722370, 2931782], [2931783, 3141195], [3141196, 3350608], [3350609, 3560021], [3560022, 3769434], [3769435, 3978847], [3978848, 4188262]] ERR5052701 file size 742229 ERR5052701 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052701 ERR5052701_1.fastq ERR5052701_2.fastq Input file: ERR5052701_1.fastq Paired file: ERR5052701_2.fastq trimmed: ERR5052701-trimmed-pair1.fastq, ERR5052701-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:41:59 2024 >> started Tue Dec 10 05:42:03 2024 >> done (4.369s) 4188262 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 26 ( 0.00%) empty read pairs filtered out after trimming by size control 4188236 (100.00%) read pairs available; of these: 7 ( 0.00%) trimmed read pairs available after processing 4188229 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 5 0.00% 70 4188229 100.00% 4188236 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=36 prefix-density=0.10 prefix-fanout=2.5 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=472.47 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=32.0 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=33 prefix-density=0.14 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=501.94 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=15.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGC ERR5052701 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:44:01 Started mapping on | Dec 10 05:44:02 Finished on | Dec 10 05:44:21 Mapping speed, Million of reads per hour | 793.56 Number of input reads | 4188236 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3902873 Uniquely mapped reads % | 93.19% Average mapped length | 138.73 Number of splices: Total | 1956639 Number of splices: Annotated (sjdb) | 1851613 Number of splices: GT/AG | 1928227 Number of splices: GC/AG | 25317 Number of splices: AT/AC | 1334 Number of splices: Non-canonical | 1761 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 55369 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 7272 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.84% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 229994 229994 229994 N_multimapping 55369 55369 55369 N_noFeature 101203 3820744 122911 N_ambiguous 68707 367 8419 UnstrandedReadsAssigned:3732963 PositiveStrandReadsAssigned:81762 NegativeStrandReadsAssigned:3771543 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052701 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052701-trimmed-pair1.fastq ERR5052701-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,188,236 reads, 3,933,917 reads pseudoaligned [quant] estimated average fragment length: 188.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52973 ERR5052701.ke.tsv 35125 ERR5052701.se.tsv 88098 total ==> ERR5052701.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.462 0 0 PNS24247 1044 856.149 12.4126 5.55895 PNS24249 1928 1740.15 30.6851 6.76116 PNS24246 1044 856.149 12.4126 5.55895 PNS24248 1044 856.149 12.4126 5.55895 PNS24244 1471 1283.15 23.0771 6.89578 PNS24243 293 119.699 0 0 KQK14069 1603 1415.15 2289.33 620.278 KQK14071 474 289.122 48.4328 64.2301 ==> ERR5052701.se.tsv <== BRADI_1g14170v3 2498 BRADI_1g53295v3 26 BRADI_1g59795v3 47 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 281 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 44 BRADI_1g48960v3 0 ERR5052701 completed mapping pipeline successfully