Starting /dee2/code/volunteer_pipeline.sh ERR5052702 current disk space = 1525861154816 free memory = 1601547108 ERR5052702 SRAfilesize c2f8ef1c38906077acbdc7a643a477b4 ERR5052702.sra ERR5052702.sra file validated ERR5052702 is paired end ERR5052702 is conventional basespace ERR5052702 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052702_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.39275 35.0 35.0 35.0 35.0 35.0 2 34.6405 35.0 35.0 35.0 35.0 35.0 3 34.68275 35.0 35.0 35.0 35.0 35.0 4 34.681 35.0 35.0 35.0 35.0 35.0 5 34.668 35.0 35.0 35.0 35.0 35.0 6 39.499 40.0 40.0 40.0 39.0 40.0 7 39.47125 40.0 40.0 40.0 39.0 40.0 8 39.4895 40.0 40.0 40.0 39.0 40.0 9 39.50825 40.0 40.0 40.0 39.0 40.0 10 39.528 40.0 40.0 40.0 39.0 40.0 11 39.48525 40.0 40.0 40.0 39.0 40.0 12 39.423 40.0 40.0 40.0 39.0 40.0 13 39.47775 40.0 40.0 40.0 39.0 40.0 14 39.48025 40.0 40.0 40.0 39.0 40.0 15 39.43875 40.0 40.0 40.0 39.0 40.0 16 39.4765 40.0 40.0 40.0 39.0 40.0 17 39.47425 40.0 40.0 40.0 39.0 40.0 18 39.46575 40.0 40.0 40.0 39.0 40.0 19 39.41725 40.0 40.0 40.0 39.0 40.0 20 39.4675 40.0 40.0 40.0 39.0 40.0 21 39.42475 40.0 40.0 40.0 39.0 40.0 22 39.43775 40.0 40.0 40.0 39.0 40.0 23 39.44175 40.0 40.0 40.0 39.0 40.0 24 39.3955 40.0 40.0 40.0 39.0 40.0 25 39.44275 40.0 40.0 40.0 39.0 40.0 26 39.4175 40.0 40.0 40.0 39.0 40.0 27 39.446 40.0 40.0 40.0 39.0 40.0 28 39.50175 40.0 40.0 40.0 39.0 40.0 29 39.45 40.0 40.0 40.0 39.0 40.0 30 39.44775 40.0 40.0 40.0 39.0 40.0 31 39.44475 40.0 40.0 40.0 39.0 40.0 32 39.494 40.0 40.0 40.0 39.0 40.0 33 39.49625 40.0 40.0 40.0 39.0 40.0 34 39.3975 40.0 40.0 40.0 39.0 40.0 35 39.433 40.0 40.0 40.0 39.0 40.0 36 39.4255 40.0 40.0 40.0 39.0 40.0 37 39.46075 40.0 40.0 40.0 39.0 40.0 38 39.41925 40.0 40.0 40.0 39.0 40.0 39 39.42675 40.0 40.0 40.0 39.0 40.0 40 39.401 40.0 40.0 40.0 39.0 40.0 41 39.4365 40.0 40.0 40.0 39.0 40.0 42 39.4355 40.0 40.0 40.0 39.0 40.0 43 39.4285 40.0 40.0 40.0 39.0 40.0 44 39.45875 40.0 40.0 40.0 39.0 40.0 45 39.48925 40.0 40.0 40.0 39.0 40.0 46 39.44875 40.0 40.0 40.0 39.0 40.0 47 39.42925 40.0 40.0 40.0 39.0 40.0 48 39.38675 40.0 40.0 40.0 39.0 40.0 49 39.427 40.0 40.0 40.0 39.0 40.0 50 39.43375 40.0 40.0 40.0 39.0 40.0 51 39.41975 40.0 40.0 40.0 39.0 40.0 52 39.38375 40.0 40.0 40.0 39.0 40.0 53 39.4 40.0 40.0 40.0 39.0 40.0 54 39.36075 40.0 40.0 40.0 39.0 40.0 55 39.38625 40.0 40.0 40.0 39.0 40.0 56 39.43225 40.0 40.0 40.0 39.0 40.0 57 39.36525 40.0 40.0 40.0 39.0 40.0 58 39.2935 40.0 40.0 40.0 39.0 40.0 59 39.31725 40.0 40.0 40.0 39.0 40.0 60 39.42025 40.0 40.0 40.0 39.0 40.0 61 39.3485 40.0 40.0 40.0 39.0 40.0 62 39.37425 40.0 40.0 40.0 39.0 40.0 63 39.42025 40.0 40.0 40.0 39.0 40.0 64 39.40125 40.0 40.0 40.0 39.0 40.0 65 39.369 40.0 40.0 40.0 39.0 40.0 66 39.39375 40.0 40.0 40.0 39.0 40.0 67 39.37625 40.0 40.0 40.0 39.0 40.0 68 39.38875 40.0 40.0 40.0 39.0 40.0 69 39.36425 40.0 40.0 40.0 39.0 40.0 70 39.4105 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 4.0 27 4.0 28 9.0 29 10.0 30 16.0 31 16.0 32 21.0 33 30.0 34 42.0 35 46.0 36 67.0 37 92.0 38 239.0 39 3402.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.68803634528016 11.206461383139828 9.010600706713781 52.09490156486623 2 19.275000000000002 12.75 38.675 29.299999999999997 3 18.55 16.525000000000002 24.65 40.275 4 26.625 23.599999999999998 21.349999999999998 28.425 5 25.374999999999996 27.525 25.074999999999996 22.025 6 21.349999999999998 31.900000000000002 25.25 21.5 7 17.8 24.675 38.625 18.9 8 18.575 24.349999999999998 33.725 23.35 9 18.45 21.675 35.35 24.525 10 19.900000000000002 34.325 25.074999999999996 20.7 11 24.625 25.374999999999996 22.825 27.175 12 23.0 22.225 28.15 26.625 13 22.675 23.674999999999997 27.800000000000004 25.85 14 22.225 25.1 27.700000000000003 24.975 15 21.95 24.975 26.825 26.25 16 22.325 24.55 27.075 26.05 17 23.325000000000003 25.224999999999998 26.150000000000002 25.3 18 22.125 25.45 25.724999999999998 26.700000000000003 19 22.725 25.674999999999997 25.7 25.900000000000002 20 23.0 25.650000000000002 26.400000000000002 24.95 21 21.85 24.025 27.0 27.125 22 21.6 26.075 26.450000000000003 25.874999999999996 23 22.225 25.674999999999997 27.675 24.425 24 21.075 25.174999999999997 27.400000000000002 26.35 25 21.8 26.200000000000003 25.4 26.6 26 22.075 25.55 26.55 25.825 27 21.725 26.474999999999998 26.3 25.5 28 22.175 24.45 26.8 26.575 29 21.875 24.825 27.575 25.724999999999998 30 21.8 25.2 26.450000000000003 26.55 31 22.85 26.325 26.55 24.275 32 23.225 26.400000000000002 25.6 24.775 33 22.1 25.650000000000002 26.424999999999997 25.825 34 22.575 25.624999999999996 24.6 27.200000000000003 35 22.125 26.325 26.525 25.025 36 23.599999999999998 24.125 26.424999999999997 25.85 37 24.025 26.474999999999998 24.5 25.0 38 22.175 26.200000000000003 26.724999999999998 24.9 39 22.5 26.200000000000003 26.474999999999998 24.825 40 22.875 26.6 25.374999999999996 25.15 41 23.799999999999997 26.075 25.6 24.525 42 23.1 25.75 26.875 24.275 43 23.825 26.424999999999997 25.525 24.224999999999998 44 23.5 26.0 25.924999999999997 24.575 45 20.45 24.875 26.6 28.075 46 21.6 26.400000000000002 25.924999999999997 26.075 47 22.775000000000002 26.525 26.375 24.325 48 22.55 24.775 25.474999999999998 27.200000000000003 49 23.075000000000003 24.625 26.724999999999998 25.575 50 23.825 25.650000000000002 26.174999999999997 24.349999999999998 51 21.775 26.35 25.25 26.625 52 21.7 26.1 25.900000000000002 26.3 53 23.3 26.55 25.2 24.95 54 22.3 25.900000000000002 25.324999999999996 26.474999999999998 55 22.35 27.05 25.124999999999996 25.474999999999998 56 22.405601400350086 26.881720430107524 26.30657664416104 24.406101525381345 57 23.43085771442861 25.056264066016503 26.206551637909474 25.30632658164541 58 23.10577644411103 26.581645411352838 25.10627656914228 25.206301575393848 59 23.030757689422355 27.206801700425103 25.85646411602901 23.905976494123532 60 23.005751437859466 25.28132033008252 25.93148287071768 25.78144536134033 61 22.95573893473368 25.98149537384346 25.131282820705174 25.93148287071768 62 22.630657664416105 26.531632908227053 25.831457864466117 25.006251562890725 63 21.580395098774694 26.456614153538382 27.28182045511378 24.681170292573142 64 24.381095273818453 24.981245311327832 25.63140785196299 25.006251562890725 65 23.51175587793897 24.437218609304654 26.163081540770385 25.887943971985994 66 22.564487853744055 25.269221136989735 25.97044828449787 26.195842724768344 67 23.687515699572973 25.872896257221807 25.295151971866364 25.14443607133886 68 22.509603072983356 25.32650448143406 26.555697823303458 25.60819462227913 69 23.694998633506422 20.087455588958733 28.423066411587865 27.794479365946977 70 23.40029761904762 0.0 38.69047619047619 37.90922619047619 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 6.0 27 8.0 28 6.0 29 11.0 30 18.0 31 23.0 32 34.0 33 40.0 34 50.5 35 65.5 36 102.0 37 134.0 38 141.5 39 178.0 40 207.0 41 236.5 42 271.5 43 277.0 44 298.5 45 295.0 46 275.5 47 281.0 48 277.0 49 263.5 50 254.0 51 228.5 52 180.0 53 157.0 54 159.0 55 140.5 56 113.5 57 107.0 58 98.5 59 86.5 60 83.0 61 83.5 62 75.0 63 66.0 64 61.5 65 55.0 66 49.5 67 46.0 68 43.5 69 33.5 70 26.0 71 22.5 72 11.0 73 3.0 74 5.5 75 6.0 76 3.5 77 3.0 78 2.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.17500000000000002 67 0.475 68 2.375 69 8.525 70 32.800000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052702 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052702_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4155 35.0 35.0 35.0 33.0 35.0 2 34.2675 35.0 35.0 35.0 33.0 35.0 3 34.43225 35.0 35.0 35.0 34.0 35.0 4 34.45875 35.0 35.0 35.0 34.0 35.0 5 34.3745 35.0 35.0 35.0 34.0 35.0 6 39.21325 40.0 40.0 40.0 39.0 40.0 7 39.1745 40.0 40.0 40.0 39.0 40.0 8 39.169 40.0 40.0 40.0 39.0 40.0 9 39.2235 40.0 40.0 40.0 39.0 40.0 10 39.24425 40.0 40.0 40.0 39.0 40.0 11 39.20475 40.0 40.0 40.0 39.0 40.0 12 39.24475 40.0 40.0 40.0 39.0 40.0 13 39.218 40.0 40.0 40.0 39.0 40.0 14 39.16375 40.0 40.0 40.0 39.0 40.0 15 39.214 40.0 40.0 40.0 39.0 40.0 16 39.24475 40.0 40.0 40.0 39.0 40.0 17 39.1575 40.0 40.0 40.0 39.0 40.0 18 39.21675 40.0 40.0 40.0 39.0 40.0 19 39.22425 40.0 40.0 40.0 39.0 40.0 20 39.22175 40.0 40.0 40.0 39.0 40.0 21 39.233 40.0 40.0 40.0 39.0 40.0 22 39.1985 40.0 40.0 40.0 39.0 40.0 23 39.1765 40.0 40.0 40.0 39.0 40.0 24 39.23175 40.0 40.0 40.0 39.0 40.0 25 39.22975 40.0 40.0 40.0 39.0 40.0 26 39.1655 40.0 40.0 40.0 39.0 40.0 27 39.228 40.0 40.0 40.0 39.0 40.0 28 39.2 40.0 40.0 40.0 39.0 40.0 29 39.15475 40.0 40.0 40.0 39.0 40.0 30 39.1845 40.0 40.0 40.0 39.0 40.0 31 39.21625 40.0 40.0 40.0 39.0 40.0 32 39.19275 40.0 40.0 40.0 39.0 40.0 33 39.216 40.0 40.0 40.0 39.0 40.0 34 39.18425 40.0 40.0 40.0 39.0 40.0 35 39.23875 40.0 40.0 40.0 39.0 40.0 36 39.1305 40.0 40.0 40.0 39.0 40.0 37 39.19125 40.0 40.0 40.0 39.0 40.0 38 39.128 40.0 40.0 40.0 39.0 40.0 39 39.11375 40.0 40.0 40.0 39.0 40.0 40 39.19175 40.0 40.0 40.0 39.0 40.0 41 39.2055 40.0 40.0 40.0 39.0 40.0 42 39.19425 40.0 40.0 40.0 39.0 40.0 43 39.173 40.0 40.0 40.0 39.0 40.0 44 39.14925 40.0 40.0 40.0 39.0 40.0 45 39.16375 40.0 40.0 40.0 39.0 40.0 46 39.161 40.0 40.0 40.0 39.0 40.0 47 39.09925 40.0 40.0 40.0 39.0 40.0 48 39.13675 40.0 40.0 40.0 39.0 40.0 49 39.1015 40.0 40.0 40.0 39.0 40.0 50 39.11325 40.0 40.0 40.0 39.0 40.0 51 39.1265 40.0 40.0 40.0 39.0 40.0 52 39.025 40.0 40.0 40.0 39.0 40.0 53 39.03725 40.0 40.0 40.0 39.0 40.0 54 39.02725 40.0 40.0 40.0 39.0 40.0 55 39.0845 40.0 40.0 40.0 39.0 40.0 56 39.0475 40.0 40.0 40.0 39.0 40.0 57 39.0995 40.0 40.0 40.0 39.0 40.0 58 39.10475 40.0 40.0 40.0 39.0 40.0 59 39.10225 40.0 40.0 40.0 39.0 40.0 60 39.10375 40.0 40.0 40.0 39.0 40.0 61 39.156 40.0 40.0 40.0 39.0 40.0 62 39.08975 40.0 40.0 40.0 39.0 40.0 63 39.05025 40.0 40.0 40.0 39.0 40.0 64 39.0275 40.0 40.0 40.0 39.0 40.0 65 39.1345 40.0 40.0 40.0 39.0 40.0 66 39.02025 40.0 40.0 40.0 39.0 40.0 67 39.03125 40.0 40.0 40.0 39.0 40.0 68 39.09425 40.0 40.0 40.0 39.0 40.0 69 39.027 40.0 40.0 40.0 39.0 40.0 70 38.964 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 4.0 19 6.0 20 3.0 21 6.0 22 5.0 23 7.0 24 17.0 25 7.0 26 9.0 27 8.0 28 12.0 29 18.0 30 17.0 31 20.0 32 25.0 33 33.0 34 27.0 35 45.0 36 55.0 37 83.0 38 234.0 39 3359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.400000000000002 19.400000000000002 12.525 40.675 2 26.8 23.275000000000002 30.55 19.375 3 19.45 26.150000000000002 29.7 24.7 4 24.125 30.599999999999998 21.4 23.875 5 26.85 34.225 20.025000000000002 18.9 6 21.75 35.25 22.825 20.175 7 22.175 20.7 33.95 23.175 8 20.925 23.375 28.000000000000004 27.700000000000003 9 23.150000000000002 22.375 29.25 25.224999999999998 10 23.925 31.324999999999996 23.65 21.099999999999998 11 25.95 23.95 22.225 27.875 12 25.124999999999996 22.675 26.400000000000002 25.8 13 25.15 23.599999999999998 25.85 25.4 14 25.8 26.724999999999998 24.224999999999998 23.25 15 25.650000000000002 25.15 25.825 23.375 16 25.525 25.224999999999998 24.325 24.925 17 26.3 25.825 23.849999999999998 24.025 18 24.975 26.55 24.9 23.575 19 26.0 25.15 26.150000000000002 22.7 20 25.525 26.924999999999997 24.875 22.675 21 25.55 25.474999999999998 25.124999999999996 23.849999999999998 22 26.1 25.85 23.599999999999998 24.45 23 25.25 26.625 25.4 22.725 24 24.525 25.900000000000002 25.275 24.3 25 25.674999999999997 25.724999999999998 24.0 24.6 26 26.0 26.825 23.674999999999997 23.5 27 24.75 26.200000000000003 26.05 23.0 28 25.4 24.8 25.025 24.775 29 25.624999999999996 25.7 24.95 23.724999999999998 30 24.125 25.35 26.0 24.525 31 24.349999999999998 26.3 25.45 23.9 32 25.275 25.55 25.85 23.325000000000003 33 25.4 26.0 25.35 23.25 34 25.900000000000002 23.9 25.45 24.75 35 25.85 25.674999999999997 25.05 23.425 36 23.625 28.025 25.8 22.55 37 26.424999999999997 24.9 25.4 23.275000000000002 38 24.9 26.424999999999997 25.8 22.875 39 25.775 26.1 25.624999999999996 22.5 40 25.7 25.874999999999996 24.224999999999998 24.2 41 25.05 26.224999999999998 25.15 23.575 42 24.349999999999998 27.150000000000002 26.375 22.125 43 25.05 24.825 26.25 23.875 44 24.525 26.724999999999998 25.0 23.75 45 25.4 25.6 25.2 23.799999999999997 46 26.125 25.5 24.925 23.45 47 26.275 25.674999999999997 25.224999999999998 22.825 48 25.0 25.575 25.8 23.625 49 24.825 26.625 23.375 25.174999999999997 50 25.25 26.474999999999998 24.525 23.75 51 24.8 27.3 24.7 23.200000000000003 52 24.8 25.825 25.650000000000002 23.724999999999998 53 26.950000000000003 25.35 24.175 23.525 54 24.6 25.95 25.650000000000002 23.799999999999997 55 25.124999999999996 26.6 24.975 23.3 56 25.081270317579396 27.906976744186046 23.95598899724931 23.055763940985248 57 25.081270317579396 27.106776694173547 25.35633908477119 22.455613903475868 58 25.431357839459867 25.30632658164541 25.18129532383096 24.081020255063766 59 26.30657664416104 25.256314078519633 24.90622655663916 23.53088272068017 60 24.55613903475869 26.131532883220803 25.30632658164541 24.006001500375092 61 27.056764191047762 25.70642660665166 25.531382845711427 21.705426356589147 62 27.081770442610654 24.981245311327832 25.581395348837212 22.355588897224308 63 25.506376594148538 26.831707926981746 25.156289072268066 22.50562640660165 64 25.437718859429715 25.912956478239117 24.712356178089045 23.936968484242122 65 25.53776888444222 25.83791895947974 25.962981490745374 22.661330665332667 66 25.845229151014276 26.471324818432258 25.694966190833963 21.98847983971951 67 26.535750251762337 23.615307150050352 25.27693856998993 24.57200402819738 68 26.01290322580645 23.92258064516129 25.883870967741935 24.18064516129032 69 26.536312849162012 20.893854748603353 27.79329608938548 24.776536312849164 70 27.65876052027544 0.0 36.9548584544759 35.38638102524866 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 3.5 26 5.5 27 7.0 28 7.5 29 12.5 30 17.0 31 23.0 32 35.5 33 42.0 34 55.5 35 80.0 36 108.5 37 126.0 38 143.5 39 175.5 40 190.0 41 208.0 42 233.5 43 241.0 44 263.5 45 286.5 46 297.5 47 308.0 48 269.5 49 228.5 50 226.0 51 207.5 52 182.5 53 176.0 54 166.5 55 132.5 56 111.0 57 114.0 58 115.5 59 103.5 60 90.0 61 87.5 62 77.5 63 70.0 64 75.0 65 74.0 66 58.5 67 49.0 68 46.0 69 41.5 70 40.0 71 30.5 72 17.0 73 13.0 74 13.0 75 9.0 76 3.0 77 1.0 78 3.0 79 3.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.05 65 0.05 66 0.17500000000000002 67 0.7000000000000001 68 3.125 69 10.5 70 34.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198129 spots for ERR5052702.sra Written 198129 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra Read 198117 spots for ERR5052702.sra Written 198117 spots for ERR5052702.sra SRR ids: ['ERR5052702.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dpksyf4y ERR5052702.sra spots: 3962352 blocks: [[1, 198117], [198118, 396234], [396235, 594351], [594352, 792468], [792469, 990585], [990586, 1188702], [1188703, 1386819], [1386820, 1584936], [1584937, 1783053], [1783054, 1981170], [1981171, 2179287], [2179288, 2377404], [2377405, 2575521], [2575522, 2773638], [2773639, 2971755], [2971756, 3169872], [3169873, 3367989], [3367990, 3566106], [3566107, 3764223], [3764224, 3962352]] ERR5052702 file size 702077 ERR5052702 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052702 ERR5052702_1.fastq ERR5052702_2.fastq Input file: ERR5052702_1.fastq Paired file: ERR5052702_2.fastq trimmed: ERR5052702-trimmed-pair1.fastq, ERR5052702-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:41:41 2024 >> started Tue Dec 10 05:41:45 2024 >> done (3.806s) 3962352 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 4 ( 0.00%) empty read pairs filtered out after trimming by size control 3962348 (100.00%) read pairs available; of these: 16 ( 0.00%) trimmed read pairs available after processing 3962332 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 2 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 11 0.00% 70 3962332 100.00% 3962348 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.05 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=240.55 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=22.1 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=793.65 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=14.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR5052702 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:42:28 Started mapping on | Dec 10 05:42:29 Finished on | Dec 10 05:42:44 Mapping speed, Million of reads per hour | 950.96 Number of input reads | 3962348 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3741743 Uniquely mapped reads % | 94.43% Average mapped length | 138.73 Number of splices: Total | 1963842 Number of splices: Annotated (sjdb) | 1870614 Number of splices: GT/AG | 1938299 Number of splices: GC/AG | 22797 Number of splices: AT/AC | 985 Number of splices: Non-canonical | 1761 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.87 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 62411 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 11405 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 158194 158194 158194 N_multimapping 62411 62411 62411 N_noFeature 131127 3654288 153681 N_ambiguous 77495 357 12688 UnstrandedReadsAssigned:3533121 PositiveStrandReadsAssigned:87098 NegativeStrandReadsAssigned:3575374 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052702 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052702-trimmed-pair1.fastq ERR5052702-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,962,348 reads, 3,628,969 reads pseudoaligned [quant] estimated average fragment length: 185.393 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52973 ERR5052702.ke.tsv 35125 ERR5052702.se.tsv 88098 total ==> ERR5052702.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.81 0 0 PNS24247 1044 859.607 11.1883 5.67126 PNS24249 1928 1743.61 20.4842 5.11901 PNS24246 1044 859.607 11.1883 5.67126 PNS24248 1044 859.607 11.1883 5.67126 PNS24244 1471 1286.61 23.951 8.11136 PNS24243 293 125.286 0 0 KQK14069 1603 1418.61 3385.96 1040.01 KQK14071 474 293.313 79.9502 118.769 ==> ERR5052702.se.tsv <== BRADI_1g14170v3 3784 BRADI_1g53295v3 32 BRADI_1g59795v3 153 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 236 BRADI_1g74790v3 77 BRADI_1g09890v3 0 BRADI_1g77505v3 107 BRADI_1g48960v3 0 ERR5052702 completed mapping pipeline successfully