Starting /dee2/code/volunteer_pipeline.sh ERR5052703 current disk space = 1525846847488 free memory = 1570760792 ERR5052703 SRAfilesize 62b8df65ae1476135c9f5951b6372cce ERR5052703.sra ERR5052703.sra file validated ERR5052703 is paired end ERR5052703 is conventional basespace ERR5052703 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052703_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.44125 35.0 35.0 35.0 35.0 35.0 2 34.62725 35.0 35.0 35.0 35.0 35.0 3 34.68125 35.0 35.0 35.0 35.0 35.0 4 34.7095 35.0 35.0 35.0 35.0 35.0 5 34.68825 35.0 35.0 35.0 35.0 35.0 6 39.54575 40.0 40.0 40.0 39.0 40.0 7 39.4605 40.0 40.0 40.0 39.0 40.0 8 39.4335 40.0 40.0 40.0 39.0 40.0 9 39.481 40.0 40.0 40.0 39.0 40.0 10 39.48375 40.0 40.0 40.0 39.0 40.0 11 39.4635 40.0 40.0 40.0 39.0 40.0 12 39.424 40.0 40.0 40.0 39.0 40.0 13 39.4635 40.0 40.0 40.0 39.0 40.0 14 39.46875 40.0 40.0 40.0 39.0 40.0 15 39.42125 40.0 40.0 40.0 39.0 40.0 16 39.48375 40.0 40.0 40.0 39.0 40.0 17 39.452 40.0 40.0 40.0 39.0 40.0 18 39.478 40.0 40.0 40.0 39.0 40.0 19 39.46575 40.0 40.0 40.0 39.0 40.0 20 39.459 40.0 40.0 40.0 39.0 40.0 21 39.46375 40.0 40.0 40.0 39.0 40.0 22 39.4735 40.0 40.0 40.0 39.0 40.0 23 39.41525 40.0 40.0 40.0 39.0 40.0 24 39.44425 40.0 40.0 40.0 39.0 40.0 25 39.36225 40.0 40.0 40.0 39.0 40.0 26 39.3635 40.0 40.0 40.0 39.0 40.0 27 39.386 40.0 40.0 40.0 39.0 40.0 28 39.395 40.0 40.0 40.0 39.0 40.0 29 39.4025 40.0 40.0 40.0 39.0 40.0 30 39.41025 40.0 40.0 40.0 39.0 40.0 31 39.38325 40.0 40.0 40.0 39.0 40.0 32 39.3965 40.0 40.0 40.0 39.0 40.0 33 39.36575 40.0 40.0 40.0 39.0 40.0 34 39.4495 40.0 40.0 40.0 39.0 40.0 35 39.38575 40.0 40.0 40.0 39.0 40.0 36 39.41575 40.0 40.0 40.0 39.0 40.0 37 39.43625 40.0 40.0 40.0 39.0 40.0 38 39.387 40.0 40.0 40.0 39.0 40.0 39 39.3735 40.0 40.0 40.0 39.0 40.0 40 39.365 40.0 40.0 40.0 39.0 40.0 41 39.3645 40.0 40.0 40.0 39.0 40.0 42 39.40025 40.0 40.0 40.0 39.0 40.0 43 39.41525 40.0 40.0 40.0 39.0 40.0 44 39.38225 40.0 40.0 40.0 39.0 40.0 45 39.361 40.0 40.0 40.0 39.0 40.0 46 39.36325 40.0 40.0 40.0 39.0 40.0 47 39.35775 40.0 40.0 40.0 39.0 40.0 48 39.3525 40.0 40.0 40.0 39.0 40.0 49 39.38675 40.0 40.0 40.0 39.0 40.0 50 39.33475 40.0 40.0 40.0 39.0 40.0 51 39.37625 40.0 40.0 40.0 39.0 40.0 52 39.38 40.0 40.0 40.0 39.0 40.0 53 39.40675 40.0 40.0 40.0 39.0 40.0 54 39.40475 40.0 40.0 40.0 39.0 40.0 55 39.336 40.0 40.0 40.0 39.0 40.0 56 39.35825 40.0 40.0 40.0 39.0 40.0 57 39.335 40.0 40.0 40.0 39.0 40.0 58 39.294 40.0 40.0 40.0 39.0 40.0 59 39.3655 40.0 40.0 40.0 39.0 40.0 60 39.37325 40.0 40.0 40.0 39.0 40.0 61 39.35475 40.0 40.0 40.0 39.0 40.0 62 39.34225 40.0 40.0 40.0 39.0 40.0 63 39.35275 40.0 40.0 40.0 39.0 40.0 64 39.326 40.0 40.0 40.0 39.0 40.0 65 39.333 40.0 40.0 40.0 39.0 40.0 66 39.26875 40.0 40.0 40.0 39.0 40.0 67 39.327 40.0 40.0 40.0 39.0 40.0 68 39.36875 40.0 40.0 40.0 39.0 40.0 69 39.3995 40.0 40.0 40.0 39.0 40.0 70 39.36375 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 1.0 27 10.0 28 13.0 29 10.0 30 15.0 31 22.0 32 31.0 33 38.0 34 28.0 35 50.0 36 57.0 37 97.0 38 211.0 39 3416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.06478447189312 10.410889841189816 8.545500378119486 51.97882530879758 2 19.400000000000002 12.65 40.425 27.525 3 19.225 15.675 24.375 40.725 4 23.799999999999997 23.925 23.45 28.825 5 25.25 29.525000000000002 24.025 21.2 6 22.2 29.225 26.85 21.725 7 18.275 24.25 39.35 18.125 8 18.825 22.55 32.300000000000004 26.325 9 18.099999999999998 22.5 34.675 24.725 10 19.950000000000003 33.425 24.95 21.675 11 25.324999999999996 25.374999999999996 23.549999999999997 25.75 12 22.6 22.55 27.375 27.474999999999998 13 21.224999999999998 24.349999999999998 28.199999999999996 26.224999999999998 14 22.400000000000002 26.25 27.425 23.925 15 21.075 25.575 27.55 25.8 16 21.975 24.725 27.425 25.874999999999996 17 22.675 24.9 27.175 25.25 18 22.35 25.424999999999997 26.55 25.674999999999997 19 22.3 25.924999999999997 25.95 25.825 20 21.95 25.8 27.0 25.25 21 22.375 26.625 26.025 24.975 22 22.95 25.85 24.975 26.224999999999998 23 21.975 27.625 26.424999999999997 23.974999999999998 24 23.25 24.625 27.900000000000002 24.224999999999998 25 22.575 26.224999999999998 24.7 26.5 26 21.575 26.400000000000002 25.525 26.5 27 21.275 24.9 26.900000000000002 26.924999999999997 28 22.375 24.925 26.275 26.424999999999997 29 22.575 26.224999999999998 26.775 24.425 30 22.525000000000002 23.849999999999998 26.950000000000003 26.674999999999997 31 23.724999999999998 26.0 25.074999999999996 25.2 32 21.7 25.650000000000002 28.050000000000004 24.6 33 21.45 24.5 27.025 27.025 34 22.95 25.8 25.374999999999996 25.874999999999996 35 21.825 26.525 26.224999999999998 25.424999999999997 36 21.725 25.35 26.474999999999998 26.450000000000003 37 23.025000000000002 25.45 25.624999999999996 25.900000000000002 38 23.150000000000002 27.500000000000004 24.25 25.1 39 22.375 25.55 27.150000000000002 24.925 40 21.925 25.525 25.75 26.8 41 22.025 25.5 27.875 24.6 42 22.475 25.424999999999997 25.825 26.275 43 22.85 25.074999999999996 26.25 25.825 44 21.725 25.650000000000002 27.200000000000003 25.424999999999997 45 21.125 25.874999999999996 26.5 26.5 46 20.974999999999998 26.724999999999998 25.575 26.724999999999998 47 22.475 24.8 27.0 25.724999999999998 48 21.85 26.525 25.45 26.174999999999997 49 23.724999999999998 25.25 25.224999999999998 25.8 50 22.55 27.175 26.375 23.9 51 22.25 24.4 25.924999999999997 27.425 52 22.8 26.55 25.374999999999996 25.275 53 23.25 25.45 26.05 25.25 54 22.400000000000002 25.6 26.6 25.4 55 23.799999999999997 26.224999999999998 24.8 25.174999999999997 56 22.75 26.55 25.674999999999997 25.025 57 21.175 25.825 27.35 25.650000000000002 58 23.225 24.474999999999998 26.400000000000002 25.900000000000002 59 22.650000000000002 26.525 26.325 24.5 60 22.73068267066767 24.731182795698924 26.25656414103526 26.281570392598148 61 22.9057264316079 25.70642660665166 24.456114028507127 26.93173293323331 62 22.355588897224308 26.756689172293076 24.90622655663916 25.98149537384346 63 21.38569284642321 26.038019009504755 26.538269134567283 26.038019009504755 64 23.54854854854855 25.45045045045045 25.55055055055055 25.45045045045045 65 24.036054081121684 25.7386079118678 26.189283925888834 24.036054081121684 66 22.44488977955912 26.452905811623246 25.701402805611224 25.400801603206414 67 21.956740442655935 25.32696177062374 26.282696177062377 26.43360160965795 68 23.06902745701822 24.65999486784706 26.40492686682063 25.86605080831409 69 22.329030486130183 20.87338643229882 28.591046415819832 28.20653666575117 70 23.302411873840445 0.0 38.47866419294991 38.218923933209645 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 2.5 26 5.0 27 6.0 28 6.0 29 11.5 30 17.0 31 20.0 32 30.5 33 38.0 34 53.5 35 80.5 36 109.0 37 126.0 38 152.0 39 194.5 40 211.0 41 209.5 42 247.5 43 287.0 44 293.0 45 301.0 46 291.0 47 279.0 48 259.5 49 249.0 50 258.0 51 232.5 52 195.5 53 184.0 54 173.5 55 135.5 56 108.5 57 109.0 58 110.5 59 97.0 60 82.0 61 80.5 62 71.5 63 64.0 64 58.0 65 52.5 66 50.0 67 47.0 68 38.0 69 29.0 70 29.0 71 21.5 72 11.5 73 9.0 74 8.5 75 4.5 76 0.5 77 0.0 78 1.5 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.025 62 0.025 63 0.05 64 0.1 65 0.15 66 0.2 67 0.6 68 2.5749999999999997 69 8.975 70 32.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052703 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052703_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4625 35.0 35.0 35.0 33.0 35.0 2 34.36525 35.0 35.0 35.0 33.0 35.0 3 34.373 35.0 35.0 35.0 34.0 35.0 4 34.37875 35.0 35.0 35.0 34.0 35.0 5 34.40025 35.0 35.0 35.0 34.0 35.0 6 39.06475 40.0 40.0 40.0 39.0 40.0 7 39.1605 40.0 40.0 40.0 39.0 40.0 8 39.09225 40.0 40.0 40.0 39.0 40.0 9 39.14625 40.0 40.0 40.0 39.0 40.0 10 39.11225 40.0 40.0 40.0 39.0 40.0 11 39.1425 40.0 40.0 40.0 39.0 40.0 12 39.13725 40.0 40.0 40.0 39.0 40.0 13 39.15575 40.0 40.0 40.0 39.0 40.0 14 39.1575 40.0 40.0 40.0 39.0 40.0 15 39.17775 40.0 40.0 40.0 39.0 40.0 16 39.22225 40.0 40.0 40.0 39.0 40.0 17 39.14725 40.0 40.0 40.0 39.0 40.0 18 39.17875 40.0 40.0 40.0 39.0 40.0 19 39.16925 40.0 40.0 40.0 39.0 40.0 20 39.161 40.0 40.0 40.0 39.0 40.0 21 39.17325 40.0 40.0 40.0 39.0 40.0 22 39.18275 40.0 40.0 40.0 39.0 40.0 23 39.17 40.0 40.0 40.0 39.0 40.0 24 39.1275 40.0 40.0 40.0 39.0 40.0 25 39.1545 40.0 40.0 40.0 39.0 40.0 26 39.19725 40.0 40.0 40.0 39.0 40.0 27 39.1315 40.0 40.0 40.0 39.0 40.0 28 39.15125 40.0 40.0 40.0 39.0 40.0 29 39.151 40.0 40.0 40.0 39.0 40.0 30 39.163 40.0 40.0 40.0 39.0 40.0 31 39.242 40.0 40.0 40.0 39.0 40.0 32 39.1535 40.0 40.0 40.0 39.0 40.0 33 39.18425 40.0 40.0 40.0 39.0 40.0 34 39.11625 40.0 40.0 40.0 39.0 40.0 35 39.1215 40.0 40.0 40.0 39.0 40.0 36 39.15175 40.0 40.0 40.0 39.0 40.0 37 39.12325 40.0 40.0 40.0 39.0 40.0 38 39.10275 40.0 40.0 40.0 39.0 40.0 39 39.148 40.0 40.0 40.0 39.0 40.0 40 39.16725 40.0 40.0 40.0 39.0 40.0 41 39.15275 40.0 40.0 40.0 39.0 40.0 42 39.12375 40.0 40.0 40.0 39.0 40.0 43 39.05325 40.0 40.0 40.0 39.0 40.0 44 39.069 40.0 40.0 40.0 39.0 40.0 45 39.11425 40.0 40.0 40.0 39.0 40.0 46 39.09725 40.0 40.0 40.0 39.0 40.0 47 39.0315 40.0 40.0 40.0 39.0 40.0 48 39.05825 40.0 40.0 40.0 39.0 40.0 49 39.116 40.0 40.0 40.0 39.0 40.0 50 39.15075 40.0 40.0 40.0 39.0 40.0 51 39.068 40.0 40.0 40.0 39.0 40.0 52 39.08375 40.0 40.0 40.0 39.0 40.0 53 39.12475 40.0 40.0 40.0 39.0 40.0 54 39.061 40.0 40.0 40.0 39.0 40.0 55 39.06425 40.0 40.0 40.0 39.0 40.0 56 39.03675 40.0 40.0 40.0 39.0 40.0 57 39.12725 40.0 40.0 40.0 39.0 40.0 58 39.07325 40.0 40.0 40.0 39.0 40.0 59 39.14675 40.0 40.0 40.0 39.0 40.0 60 39.095 40.0 40.0 40.0 39.0 40.0 61 39.05275 40.0 40.0 40.0 39.0 40.0 62 39.03975 40.0 40.0 40.0 39.0 40.0 63 39.02675 40.0 40.0 40.0 39.0 40.0 64 38.96375 40.0 40.0 40.0 39.0 40.0 65 38.9975 40.0 40.0 40.0 39.0 40.0 66 39.00775 40.0 40.0 40.0 39.0 40.0 67 39.058 40.0 40.0 40.0 39.0 40.0 68 39.03425 40.0 40.0 40.0 39.0 40.0 69 39.076 40.0 40.0 40.0 39.0 40.0 70 39.0655 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 4.0 19 5.0 20 9.0 21 11.0 22 10.0 23 3.0 24 7.0 25 6.0 26 15.0 27 16.0 28 18.0 29 18.0 30 14.0 31 10.0 32 28.0 33 23.0 34 19.0 35 43.0 36 61.0 37 89.0 38 217.0 39 3373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.2 18.4 11.975 40.425 2 27.950000000000003 23.25 30.599999999999998 18.2 3 20.075000000000003 25.8 30.099999999999998 24.025 4 23.974999999999998 30.875000000000004 22.05 23.1 5 28.449999999999996 32.574999999999996 21.05 17.925 6 22.20555138784696 34.808702175543885 22.58064516129032 20.40510127531883 7 23.125 19.425 35.6 21.85 8 23.150000000000002 22.25 27.400000000000002 27.200000000000003 9 23.25 21.925 29.5 25.324999999999996 10 25.0 31.6 23.0 20.4 11 26.5 25.575 21.2 26.724999999999998 12 26.224999999999998 23.575 24.625 25.575 13 25.35 24.45 24.75 25.45 14 25.874999999999996 26.900000000000002 23.724999999999998 23.5 15 24.925 26.724999999999998 26.224999999999998 22.125 16 25.650000000000002 26.174999999999997 23.974999999999998 24.2 17 27.325 24.8 24.825 23.05 18 25.124999999999996 25.775 24.975 24.125 19 25.074999999999996 26.75 24.425 23.75 20 27.1 24.349999999999998 25.275 23.275000000000002 21 25.674999999999997 26.6 24.45 23.275000000000002 22 25.624999999999996 24.75 25.224999999999998 24.4 23 25.85 26.025 26.200000000000003 21.925 24 27.275 25.525 24.65 22.55 25 24.25 26.375 25.624999999999996 23.75 26 25.874999999999996 26.450000000000003 24.725 22.95 27 24.425 26.825 25.575 23.175 28 26.700000000000003 24.474999999999998 24.8 24.025 29 25.124999999999996 25.974999999999998 25.45 23.45 30 25.5 25.575 26.474999999999998 22.45 31 25.724999999999998 24.075 26.1 24.099999999999998 32 26.05 26.150000000000002 25.124999999999996 22.675 33 24.224999999999998 26.424999999999997 26.375 22.975 34 26.625 24.925 24.375 24.075 35 26.875 25.624999999999996 24.275 23.225 36 24.525 26.1 25.724999999999998 23.65 37 25.6 25.674999999999997 25.3 23.425 38 25.974999999999998 24.625 24.775 24.625 39 25.650000000000002 25.25 24.675 24.425 40 25.6 24.45 25.5 24.45 41 26.650000000000002 24.75 25.25 23.35 42 23.7 27.900000000000002 25.15 23.25 43 25.374999999999996 25.5 25.025 24.099999999999998 44 26.3 24.7 24.65 24.349999999999998 45 25.124999999999996 25.8 26.075 23.0 46 25.55 25.275 24.45 24.725 47 25.95 27.325 24.875 21.85 48 25.324999999999996 25.650000000000002 26.424999999999997 22.6 49 26.3 25.074999999999996 26.400000000000002 22.225 50 24.925 26.974999999999998 24.875 23.225 51 26.5 25.575 25.775 22.15 52 26.200000000000003 25.424999999999997 24.775 23.599999999999998 53 25.3 27.0 24.875 22.825 54 25.75 25.575 26.525 22.15 55 26.075 25.275 24.525 24.125 56 26.025 25.05 24.4 24.525 57 24.725 25.974999999999998 25.874999999999996 23.425 58 25.8 25.424999999999997 25.6 23.175 59 26.5 24.099999999999998 25.55 23.849999999999998 60 23.7 26.325 26.724999999999998 23.25 61 26.6 24.55 24.925 23.925 62 26.674999999999997 26.6 24.825 21.9 63 25.650000000000002 26.025 25.15 23.175 64 26.65666416604151 25.78144536134033 24.431107776944234 23.13078269567392 65 25.731432858214554 26.60665166291573 24.5311327831958 23.13078269567392 66 25.488232348522782 26.765147721582373 25.88883324987481 21.85778668002003 67 26.221662468513856 25.465994962216627 24.6095717884131 23.702770780856422 68 26.459244021599382 24.273592183080485 25.250707122653637 24.016456672666493 69 26.129121640343584 20.25491825990579 29.066223330562487 24.54973676918814 70 29.133560348089294 0.0 36.28452516080212 34.58191449110859 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 1.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 4.5 26 7.0 27 7.0 28 8.5 29 9.5 30 9.0 31 13.0 32 27.5 33 38.0 34 50.0 35 72.5 36 93.5 37 104.0 38 129.5 39 180.5 40 206.0 41 231.0 42 268.5 43 281.0 44 269.5 45 265.0 46 278.0 47 284.0 48 263.0 49 234.5 50 227.0 51 203.5 52 183.0 53 186.0 54 171.5 55 147.0 56 126.5 57 116.0 58 105.5 59 98.5 60 102.0 61 95.5 62 74.0 63 59.0 64 63.0 65 71.5 66 61.5 67 47.0 68 45.0 69 42.0 70 41.0 71 33.5 72 23.5 73 21.0 74 17.5 75 10.0 76 6.5 77 7.0 78 5.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.025 66 0.15 67 0.75 68 2.775 69 9.775 70 33.925 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204394 spots for ERR5052703.sra Written 204394 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra Read 204385 spots for ERR5052703.sra Written 204385 spots for ERR5052703.sra SRR ids: ['ERR5052703.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o7np_807 ERR5052703.sra spots: 4087709 blocks: [[1, 204385], [204386, 408770], [408771, 613155], [613156, 817540], [817541, 1021925], [1021926, 1226310], [1226311, 1430695], [1430696, 1635080], [1635081, 1839465], [1839466, 2043850], [2043851, 2248235], [2248236, 2452620], [2452621, 2657005], [2657006, 2861390], [2861391, 3065775], [3065776, 3270160], [3270161, 3474545], [3474546, 3678930], [3678931, 3883315], [3883316, 4087709]] ERR5052703 file size 724357 ERR5052703 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052703 ERR5052703_1.fastq ERR5052703_2.fastq Input file: ERR5052703_1.fastq Paired file: ERR5052703_2.fastq trimmed: ERR5052703-trimmed-pair1.fastq, ERR5052703-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:42:24 2024 >> started Tue Dec 10 05:42:40 2024 >> done (15.323s) 4087709 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 9 ( 0.00%) empty read pairs filtered out after trimming by size control 4087700 (100.00%) read pairs available; of these: 18 ( 0.00%) trimmed read pairs available after processing 4087682 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 69 18 0.00% 70 4087682 100.00% 4087700 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=2.5 sequence=GTCCTTGCCGTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=253.66 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=22.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.23 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=175.91 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.6 sequence=CGGCGGCGGCTACGGTGGCAGCCGTGGAGGCTCCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGT ERR5052703 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:44:17 Started mapping on | Dec 10 05:44:18 Finished on | Dec 10 05:44:34 Mapping speed, Million of reads per hour | 919.73 Number of input reads | 4087700 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3859121 Uniquely mapped reads % | 94.41% Average mapped length | 138.73 Number of splices: Total | 2026068 Number of splices: Annotated (sjdb) | 1930972 Number of splices: GT/AG | 2000107 Number of splices: GC/AG | 23144 Number of splices: AT/AC | 976 Number of splices: Non-canonical | 1841 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 64688 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 11521 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 163891 163891 163891 N_multimapping 64688 64688 64688 N_noFeature 136510 3768704 159622 N_ambiguous 80214 338 13056 UnstrandedReadsAssigned:3642397 PositiveStrandReadsAssigned:90079 NegativeStrandReadsAssigned:3686443 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052703 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052703-trimmed-pair1.fastq ERR5052703-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,087,700 reads, 3,743,288 reads pseudoaligned [quant] estimated average fragment length: 184.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 ERR5052703.ke.tsv 35125 ERR5052703.se.tsv 88098 total ==> ERR5052703.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.344 0 0 PNS24247 1044 860.107 13.7236 6.75134 PNS24249 1928 1744.11 23.2558 5.64199 PNS24246 1044 860.107 13.7236 6.75134 PNS24248 1044 860.107 13.7236 6.75134 PNS24244 1471 1287.11 17.5734 5.77719 PNS24243 293 125.295 0 0 KQK14069 1603 1419.11 3501.14 1043.92 KQK14071 474 293.45 79.0329 113.959 ==> ERR5052703.se.tsv <== BRADI_1g14170v3 3923 BRADI_1g53295v3 34 BRADI_1g59795v3 161 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 222 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 119 BRADI_1g48960v3 0 ERR5052703 completed mapping pipeline successfully