Starting /dee2/code/volunteer_pipeline.sh ERR5052704 current disk space = 1525853503488 free memory = 1561655336 ERR5052704 SRAfilesize af1c2425dafc4dd6be929c76e594dd66 ERR5052704.sra ERR5052704.sra file validated ERR5052704 is paired end ERR5052704 is conventional basespace ERR5052704 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052704_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.25475 35.0 35.0 35.0 35.0 35.0 2 34.621 35.0 35.0 35.0 35.0 35.0 3 34.6605 35.0 35.0 35.0 35.0 35.0 4 34.6765 35.0 35.0 35.0 35.0 35.0 5 34.567 35.0 35.0 35.0 34.0 35.0 6 39.41325 40.0 40.0 40.0 39.0 40.0 7 39.3935 40.0 40.0 40.0 39.0 40.0 8 39.41275 40.0 40.0 40.0 39.0 40.0 9 39.449 40.0 40.0 40.0 39.0 40.0 10 39.43775 40.0 40.0 40.0 39.0 40.0 11 39.41625 40.0 40.0 40.0 39.0 40.0 12 39.3905 40.0 40.0 40.0 39.0 40.0 13 39.46025 40.0 40.0 40.0 39.0 40.0 14 39.4165 40.0 40.0 40.0 39.0 40.0 15 39.3565 40.0 40.0 40.0 39.0 40.0 16 39.41225 40.0 40.0 40.0 39.0 40.0 17 39.3955 40.0 40.0 40.0 39.0 40.0 18 39.4645 40.0 40.0 40.0 39.0 40.0 19 39.439 40.0 40.0 40.0 39.0 40.0 20 39.42025 40.0 40.0 40.0 39.0 40.0 21 39.43375 40.0 40.0 40.0 39.0 40.0 22 39.42325 40.0 40.0 40.0 39.0 40.0 23 39.35 40.0 40.0 40.0 39.0 40.0 24 39.28725 40.0 40.0 40.0 39.0 40.0 25 39.329 40.0 40.0 40.0 39.0 40.0 26 39.322 40.0 40.0 40.0 39.0 40.0 27 39.38325 40.0 40.0 40.0 39.0 40.0 28 39.37825 40.0 40.0 40.0 39.0 40.0 29 39.36975 40.0 40.0 40.0 39.0 40.0 30 39.35375 40.0 40.0 40.0 39.0 40.0 31 39.3515 40.0 40.0 40.0 39.0 40.0 32 39.38125 40.0 40.0 40.0 39.0 40.0 33 39.41225 40.0 40.0 40.0 39.0 40.0 34 39.32625 40.0 40.0 40.0 39.0 40.0 35 39.3365 40.0 40.0 40.0 39.0 40.0 36 39.3645 40.0 40.0 40.0 39.0 40.0 37 39.35925 40.0 40.0 40.0 39.0 40.0 38 39.3475 40.0 40.0 40.0 39.0 40.0 39 39.38825 40.0 40.0 40.0 39.0 40.0 40 39.40275 40.0 40.0 40.0 39.0 40.0 41 39.346 40.0 40.0 40.0 39.0 40.0 42 39.36475 40.0 40.0 40.0 39.0 40.0 43 39.401 40.0 40.0 40.0 39.0 40.0 44 39.3535 40.0 40.0 40.0 39.0 40.0 45 39.30725 40.0 40.0 40.0 39.0 40.0 46 39.36425 40.0 40.0 40.0 39.0 40.0 47 39.33425 40.0 40.0 40.0 39.0 40.0 48 39.317 40.0 40.0 40.0 39.0 40.0 49 39.31625 40.0 40.0 40.0 39.0 40.0 50 39.36475 40.0 40.0 40.0 39.0 40.0 51 39.3405 40.0 40.0 40.0 39.0 40.0 52 39.30575 40.0 40.0 40.0 39.0 40.0 53 39.38075 40.0 40.0 40.0 39.0 40.0 54 39.29625 40.0 40.0 40.0 39.0 40.0 55 39.291 40.0 40.0 40.0 39.0 40.0 56 39.27825 40.0 40.0 40.0 39.0 40.0 57 39.3265 40.0 40.0 40.0 39.0 40.0 58 39.30125 40.0 40.0 40.0 39.0 40.0 59 39.27025 40.0 40.0 40.0 39.0 40.0 60 39.32475 40.0 40.0 40.0 39.0 40.0 61 39.296 40.0 40.0 40.0 39.0 40.0 62 39.24425 40.0 40.0 40.0 39.0 40.0 63 39.32425 40.0 40.0 40.0 39.0 40.0 64 39.32425 40.0 40.0 40.0 39.0 40.0 65 39.333 40.0 40.0 40.0 39.0 40.0 66 39.323 40.0 40.0 40.0 39.0 40.0 67 39.31875 40.0 40.0 40.0 39.0 40.0 68 39.3195 40.0 40.0 40.0 39.0 40.0 69 39.297 40.0 40.0 40.0 39.0 40.0 70 39.30175 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 3.0 28 9.0 29 14.0 30 18.0 31 28.0 32 24.0 33 41.0 34 46.0 35 46.0 36 69.0 37 121.0 38 223.0 39 3354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.07178968655207 11.248736097067745 10.56622851365015 42.113245702730026 2 24.4 13.100000000000001 30.975 31.525 3 23.275000000000002 18.0 22.85 35.875 4 26.525 24.474999999999998 21.975 27.025 5 26.674999999999997 29.799999999999997 23.200000000000003 20.325 6 22.025 29.225 26.974999999999998 21.775 7 18.9 22.3 37.724999999999994 21.075 8 19.875 22.95 32.05 25.124999999999996 9 20.025000000000002 22.5 31.900000000000002 25.575 10 21.9 31.924999999999997 23.525 22.650000000000002 11 25.224999999999998 23.225 23.125 28.425 12 22.175 22.425 26.25 29.15 13 22.575 24.8 27.0 25.624999999999996 14 23.674999999999997 25.2 25.650000000000002 25.474999999999998 15 23.474999999999998 24.2 25.374999999999996 26.950000000000003 16 24.2 24.5 25.75 25.55 17 24.85 24.8 25.1 25.25 18 23.7 25.324999999999996 24.8 26.174999999999997 19 23.575 25.074999999999996 25.55 25.8 20 23.05 25.4 26.025 25.525 21 22.175 25.6 25.45 26.775 22 23.599999999999998 24.55 26.174999999999997 25.674999999999997 23 22.925 26.900000000000002 24.95 25.224999999999998 24 23.599999999999998 24.05 25.224999999999998 27.125 25 22.85 27.0 24.175 25.974999999999998 26 22.575 25.55 25.85 26.025 27 23.375 24.05 26.3 26.275 28 24.375 24.175 24.25 27.200000000000003 29 23.35 25.424999999999997 25.5 25.724999999999998 30 23.025000000000002 24.275 24.875 27.825 31 22.6 26.125 25.374999999999996 25.900000000000002 32 23.474999999999998 25.424999999999997 25.5 25.6 33 23.400000000000002 24.975 26.325 25.3 34 24.325 24.65 24.325 26.700000000000003 35 24.275 24.75 25.374999999999996 25.6 36 22.675 24.975 26.424999999999997 25.924999999999997 37 23.825 24.85 24.3 27.025 38 22.925 25.224999999999998 25.874999999999996 25.974999999999998 39 23.474999999999998 25.5 25.05 25.974999999999998 40 24.075 25.525 23.775 26.625 41 23.225 25.474999999999998 25.650000000000002 25.650000000000002 42 23.05 24.625 25.775 26.55 43 23.674999999999997 25.124999999999996 24.675 26.525 44 23.225 24.15 25.650000000000002 26.974999999999998 45 22.95 25.4 25.05 26.6 46 23.799999999999997 25.324999999999996 25.7 25.174999999999997 47 22.775000000000002 25.424999999999997 26.375 25.424999999999997 48 22.900000000000002 25.0 26.200000000000003 25.900000000000002 49 23.825 25.025 24.625 26.525 50 24.05 25.174999999999997 24.6 26.174999999999997 51 24.075 24.3 25.650000000000002 25.974999999999998 52 22.6 25.25 25.7 26.450000000000003 53 22.625 26.325 25.324999999999996 25.724999999999998 54 24.025 24.349999999999998 24.85 26.775 55 24.675 25.05 24.0 26.275 56 23.849999999999998 25.85 25.4 24.9 57 23.724999999999998 24.175 25.35 26.75 58 24.275 24.9 24.9 25.924999999999997 59 23.925 24.0 26.3 25.775 60 23.625 24.45 25.474999999999998 26.450000000000003 61 23.474999999999998 23.65 24.725 28.15 62 23.45 25.025 25.924999999999997 25.6 63 23.1 23.925 26.924999999999997 26.05 64 22.75 24.95 25.35 26.950000000000003 65 23.48087021755439 24.306076519129782 25.95648912228057 26.25656414103526 66 23.642732049036777 23.692769577182887 26.54490868151113 26.1195896922692 67 23.461441848781714 25.094197437829692 24.591811102738006 26.852549610650588 68 24.26885582349923 23.961005643919957 26.218573627501286 25.551564905079527 69 24.03421633554084 19.839955849889623 27.511037527593817 28.614790286975715 70 24.36661698956781 0.0 35.991058122205665 39.642324888226526 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 3.0 27 5.0 28 10.0 29 14.5 30 14.0 31 14.5 32 26.0 33 37.0 34 48.0 35 75.5 36 100.5 37 109.0 38 133.5 39 180.5 40 203.0 41 202.5 42 229.5 43 257.0 44 252.0 45 249.5 46 249.5 47 247.0 48 244.0 49 236.0 50 231.0 51 202.5 52 176.0 53 178.0 54 166.5 55 143.0 56 133.5 57 136.0 58 124.0 59 110.5 60 109.0 61 103.5 62 88.5 63 79.0 64 75.5 65 81.5 66 78.5 67 66.0 68 64.0 69 51.5 70 41.0 71 34.0 72 26.0 73 25.0 74 22.0 75 17.5 76 10.5 77 5.0 78 5.5 79 4.5 80 3.0 81 3.0 82 2.5 83 2.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.025 66 0.075 67 0.475 68 2.55 69 9.4 70 32.9 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052704 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052704_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.24425 35.0 35.0 35.0 33.0 35.0 2 34.12075 35.0 35.0 35.0 32.0 35.0 3 34.224 35.0 35.0 35.0 33.0 35.0 4 34.2595 35.0 35.0 35.0 33.0 35.0 5 34.2165 35.0 35.0 35.0 33.0 35.0 6 38.906 40.0 40.0 40.0 39.0 40.0 7 38.86375 40.0 40.0 40.0 38.0 40.0 8 38.93625 40.0 40.0 40.0 39.0 40.0 9 38.968 40.0 40.0 40.0 39.0 40.0 10 38.98775 40.0 40.0 40.0 39.0 40.0 11 38.90775 40.0 40.0 40.0 38.0 40.0 12 38.9255 40.0 40.0 40.0 39.0 40.0 13 38.86525 40.0 40.0 40.0 39.0 40.0 14 38.90275 40.0 40.0 40.0 39.0 40.0 15 38.8555 40.0 40.0 40.0 38.0 40.0 16 38.91875 40.0 40.0 40.0 39.0 40.0 17 38.9165 40.0 40.0 40.0 38.0 40.0 18 38.9065 40.0 40.0 40.0 39.0 40.0 19 38.947 40.0 40.0 40.0 39.0 40.0 20 38.9425 40.0 40.0 40.0 38.0 40.0 21 38.90425 40.0 40.0 40.0 38.0 40.0 22 38.8965 40.0 40.0 40.0 38.0 40.0 23 38.9 40.0 40.0 40.0 38.0 40.0 24 38.8865 40.0 40.0 40.0 38.0 40.0 25 38.916 40.0 40.0 40.0 38.0 40.0 26 38.9 40.0 40.0 40.0 38.0 40.0 27 38.8695 40.0 40.0 40.0 38.0 40.0 28 38.91125 40.0 40.0 40.0 38.0 40.0 29 38.90575 40.0 40.0 40.0 38.0 40.0 30 38.8855 40.0 40.0 40.0 38.0 40.0 31 38.8585 40.0 40.0 40.0 38.0 40.0 32 38.8965 40.0 40.0 40.0 38.0 40.0 33 38.861 40.0 40.0 40.0 38.0 40.0 34 38.8355 40.0 40.0 40.0 38.0 40.0 35 38.87575 40.0 40.0 40.0 38.0 40.0 36 38.807 40.0 40.0 40.0 38.0 40.0 37 38.8385 40.0 40.0 40.0 38.0 40.0 38 38.8775 40.0 40.0 40.0 38.0 40.0 39 38.9085 40.0 40.0 40.0 38.0 40.0 40 38.9035 40.0 40.0 40.0 38.0 40.0 41 38.85175 40.0 40.0 40.0 38.0 40.0 42 38.9125 40.0 40.0 40.0 38.0 40.0 43 38.86825 40.0 40.0 40.0 38.0 40.0 44 38.8985 40.0 40.0 40.0 38.0 40.0 45 38.84775 40.0 40.0 40.0 38.0 40.0 46 38.9165 40.0 40.0 40.0 38.0 40.0 47 38.8065 40.0 40.0 40.0 38.0 40.0 48 38.79275 40.0 40.0 40.0 38.0 40.0 49 38.73475 40.0 40.0 40.0 38.0 40.0 50 38.846 40.0 40.0 40.0 38.0 40.0 51 38.80625 40.0 40.0 40.0 38.0 40.0 52 38.69125 40.0 40.0 40.0 37.0 40.0 53 38.69525 40.0 40.0 40.0 37.0 40.0 54 38.71225 40.0 40.0 40.0 38.0 40.0 55 38.79075 40.0 40.0 40.0 38.0 40.0 56 38.7285 40.0 40.0 40.0 38.0 40.0 57 38.776 40.0 40.0 40.0 37.0 40.0 58 38.7415 40.0 40.0 40.0 38.0 40.0 59 38.77825 40.0 40.0 40.0 38.0 40.0 60 38.81575 40.0 40.0 40.0 38.0 40.0 61 38.75675 40.0 40.0 40.0 38.0 40.0 62 38.801 40.0 40.0 40.0 38.0 40.0 63 38.66125 40.0 40.0 40.0 37.0 40.0 64 38.77825 40.0 40.0 40.0 38.0 40.0 65 38.747 40.0 40.0 40.0 37.0 40.0 66 38.66525 40.0 40.0 40.0 38.0 40.0 67 38.683 40.0 40.0 40.0 37.0 40.0 68 38.64075 40.0 40.0 40.0 37.0 40.0 69 38.7545 40.0 40.0 40.0 37.0 40.0 70 38.64175 40.0 40.0 40.0 37.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 10.0 20 12.0 21 17.0 22 10.0 23 14.0 24 12.0 25 11.0 26 20.0 27 18.0 28 15.0 29 12.0 30 20.0 31 28.0 32 24.0 33 31.0 34 41.0 35 43.0 36 74.0 37 121.0 38 262.0 39 3201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.650000000000006 18.325 14.2 33.825 2 27.575 24.625 26.875 20.925 3 21.9 26.650000000000002 27.375 24.075 4 26.1 29.549999999999997 20.724999999999998 23.625 5 28.199999999999996 31.0 19.975 20.825 6 22.625 33.0 21.625 22.75 7 23.125 18.55 33.25 25.074999999999996 8 22.925 21.825 24.725 30.525000000000002 9 23.425 23.549999999999997 27.025 26.0 10 25.45 30.55 21.125 22.875 11 28.1 22.875 20.275000000000002 28.749999999999996 12 26.05 22.425 23.9 27.625 13 25.4 24.349999999999998 24.5 25.75 14 24.6 25.25 25.324999999999996 24.825 15 25.35 24.375 25.324999999999996 24.95 16 26.950000000000003 24.025 22.675 26.35 17 26.75 25.174999999999997 24.15 23.925 18 25.2 25.525 24.075 25.2 19 26.525 23.7 24.099999999999998 25.674999999999997 20 27.650000000000002 25.5 23.05 23.799999999999997 21 25.174999999999997 25.825 24.125 24.875 22 26.400000000000002 25.025 22.900000000000002 25.674999999999997 23 27.224999999999998 24.425 23.925 24.425 24 25.45 25.1 24.425 25.025 25 26.474999999999998 23.95 25.324999999999996 24.25 26 27.800000000000004 25.5 22.775000000000002 23.925 27 25.15 25.0 24.45 25.4 28 26.150000000000002 23.9 24.875 25.074999999999996 29 26.5 23.825 24.15 25.525 30 25.674999999999997 24.7 25.724999999999998 23.9 31 25.75 23.25 24.625 26.375 32 26.625 24.65 24.099999999999998 24.625 33 25.0 25.95 24.775 24.275 34 24.925 25.275 24.25 25.55 35 27.05 25.174999999999997 23.150000000000002 24.625 36 24.6 25.924999999999997 25.025 24.45 37 25.25 24.45 24.925 25.374999999999996 38 25.95 24.6 24.375 25.074999999999996 39 25.7 25.174999999999997 24.25 24.875 40 24.95 24.675 24.375 26.0 41 25.974999999999998 24.9 23.425 25.7 42 26.224999999999998 25.4 23.95 24.425 43 26.1 23.525 24.625 25.75 44 26.525 24.4 24.275 24.8 45 26.200000000000003 25.2 24.5 24.099999999999998 46 26.325 25.324999999999996 24.099999999999998 24.25 47 26.200000000000003 25.55 23.65 24.6 48 25.525 25.900000000000002 23.5 25.074999999999996 49 24.825 25.224999999999998 24.7 25.25 50 24.975 24.625 25.4 25.0 51 26.325 24.7 25.0 23.974999999999998 52 26.8 23.200000000000003 24.725 25.275 53 27.325 24.775 23.95 23.95 54 25.275 24.25 23.974999999999998 26.5 55 27.3 24.4 24.95 23.35 56 26.275 24.45 23.825 25.45 57 25.1 24.65 26.125 24.125 58 25.724999999999998 24.675 24.875 24.725 59 27.3 24.05 24.474999999999998 24.175 60 25.074999999999996 25.074999999999996 25.324999999999996 24.525 61 27.05 23.775 25.1 24.075 62 25.650000000000002 24.525 25.15 24.675 63 26.05 25.85 24.675 23.425 64 26.55 25.474999999999998 24.15 23.825 65 26.875 24.474999999999998 23.25 25.4 66 25.556946182728414 25.33166458072591 25.807259073842303 23.30413016270338 67 26.569195865893626 23.796319637005293 26.065036551550293 23.569447945550795 68 27.57371960682876 22.840144852560787 23.719606828763578 25.86652871184687 69 25.727069351230426 19.463087248322147 28.159955257270692 26.649888143176735 70 28.317580340264648 0.0 35.614366729678636 36.06805293005671 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 2.0 26 6.0 27 10.0 28 7.5 29 9.0 30 13.0 31 21.5 32 31.5 33 33.0 34 39.5 35 61.0 36 85.5 37 95.0 38 113.0 39 153.5 40 176.0 41 177.5 42 197.5 43 216.0 44 236.0 45 253.5 46 246.5 47 242.0 48 248.5 49 233.0 50 211.0 51 196.0 52 178.5 53 176.0 54 171.5 55 157.5 56 133.0 57 118.0 58 118.5 59 110.0 60 101.0 61 113.5 62 108.5 63 91.0 64 86.5 65 99.0 66 99.0 67 82.0 68 72.0 69 54.0 70 46.0 71 51.5 72 47.0 73 37.0 74 30.0 75 20.5 76 13.0 77 8.0 78 7.5 79 3.5 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.125 67 0.8250000000000001 68 3.35 69 10.6 70 33.875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67344888219041 99.2 2 0.25119316754584275 0.5 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025119316754584273 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGANNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234532 spots for ERR5052704.sra Written 234532 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra Read 234517 spots for ERR5052704.sra Written 234517 spots for ERR5052704.sra SRR ids: ['ERR5052704.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6jdjq9v_ ERR5052704.sra spots: 4690355 blocks: [[1, 234517], [234518, 469034], [469035, 703551], [703552, 938068], [938069, 1172585], [1172586, 1407102], [1407103, 1641619], [1641620, 1876136], [1876137, 2110653], [2110654, 2345170], [2345171, 2579687], [2579688, 2814204], [2814205, 3048721], [3048722, 3283238], [3283239, 3517755], [3517756, 3752272], [3752273, 3986789], [3986790, 4221306], [4221307, 4455823], [4455824, 4690355]] ERR5052704 file size 831468 ERR5052704 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052704 ERR5052704_1.fastq ERR5052704_2.fastq Input file: ERR5052704_1.fastq Paired file: ERR5052704_2.fastq trimmed: ERR5052704-trimmed-pair1.fastq, ERR5052704-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:41:57 2024 >> started Tue Dec 10 05:42:01 2024 >> done (4.179s) 4690355 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 30 ( 0.00%) empty read pairs filtered out after trimming by size control 4690325 (100.00%) read pairs available; of these: 12 ( 0.00%) trimmed read pairs available after processing 4690313 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 1 0.00% 52 2 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 8 0.00% 70 4690313 100.00% 4690325 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.1 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=273.60 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=25.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=30 prefix-density=0.31 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=284.93 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=21.2 sequence=CGCCGCCGCCGA ERR5052704 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:42:34 Started mapping on | Dec 10 05:42:34 Finished on | Dec 10 05:42:50 Mapping speed, Million of reads per hour | 1055.32 Number of input reads | 4690325 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4451875 Uniquely mapped reads % | 94.92% Average mapped length | 138.75 Number of splices: Total | 2217078 Number of splices: Annotated (sjdb) | 2110644 Number of splices: GT/AG | 2187575 Number of splices: GC/AG | 26225 Number of splices: AT/AC | 1066 Number of splices: Non-canonical | 2212 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.90 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 67954 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 9143 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 170496 170496 170496 N_multimapping 67954 67954 67954 N_noFeature 140722 4348354 167550 N_ambiguous 91633 426 15068 UnstrandedReadsAssigned:4219520 PositiveStrandReadsAssigned:103095 NegativeStrandReadsAssigned:4269257 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052704 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052704-trimmed-pair1.fastq ERR5052704-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,690,325 reads, 4,356,278 reads pseudoaligned [quant] estimated average fragment length: 185.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52973 ERR5052704.ke.tsv 35125 ERR5052704.se.tsv 88098 total ==> ERR5052704.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.391 3.17489 1.47094 PNS24247 1044 859.171 18.5995 7.53622 PNS24249 1928 1743.17 37.7611 7.54112 PNS24246 1044 859.171 18.5995 7.53622 PNS24248 1044 859.171 18.5995 7.53622 PNS24244 1471 1286.17 13.2653 3.59046 PNS24243 293 122.88 0 0 KQK14069 1603 1418.17 5405.07 1326.79 KQK14071 474 291.846 133.478 159.216 ==> ERR5052704.se.tsv <== BRADI_1g14170v3 5915 BRADI_1g53295v3 33 BRADI_1g59795v3 172 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 260 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 ERR5052704 completed mapping pipeline successfully