Starting /dee2/code/volunteer_pipeline.sh ERR5052705 current disk space = 1525847187456 free memory = 1402602140 ERR5052705 SRAfilesize 2b9d1d9ed065b9a2273c156a19e092d6 ERR5052705.sra ERR5052705.sra file validated ERR5052705 is paired end ERR5052705 is conventional basespace ERR5052705 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052705_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3645 35.0 35.0 35.0 35.0 35.0 2 34.59825 35.0 35.0 35.0 35.0 35.0 3 34.62425 35.0 35.0 35.0 35.0 35.0 4 34.6475 35.0 35.0 35.0 35.0 35.0 5 34.673 35.0 35.0 35.0 35.0 35.0 6 39.3985 40.0 40.0 40.0 39.0 40.0 7 39.40625 40.0 40.0 40.0 39.0 40.0 8 39.36125 40.0 40.0 40.0 39.0 40.0 9 39.38175 40.0 40.0 40.0 39.0 40.0 10 39.42125 40.0 40.0 40.0 39.0 40.0 11 39.3915 40.0 40.0 40.0 39.0 40.0 12 39.42375 40.0 40.0 40.0 39.0 40.0 13 39.3955 40.0 40.0 40.0 39.0 40.0 14 39.3935 40.0 40.0 40.0 39.0 40.0 15 39.35625 40.0 40.0 40.0 39.0 40.0 16 39.41 40.0 40.0 40.0 39.0 40.0 17 39.38975 40.0 40.0 40.0 39.0 40.0 18 39.3715 40.0 40.0 40.0 39.0 40.0 19 39.326 40.0 40.0 40.0 39.0 40.0 20 39.35975 40.0 40.0 40.0 39.0 40.0 21 39.32175 40.0 40.0 40.0 39.0 40.0 22 39.3 40.0 40.0 40.0 39.0 40.0 23 39.367 40.0 40.0 40.0 39.0 40.0 24 39.36525 40.0 40.0 40.0 39.0 40.0 25 39.29675 40.0 40.0 40.0 39.0 40.0 26 39.27325 40.0 40.0 40.0 39.0 40.0 27 39.26375 40.0 40.0 40.0 39.0 40.0 28 39.2725 40.0 40.0 40.0 39.0 40.0 29 39.30575 40.0 40.0 40.0 39.0 40.0 30 39.288 40.0 40.0 40.0 39.0 40.0 31 39.26075 40.0 40.0 40.0 39.0 40.0 32 39.27825 40.0 40.0 40.0 39.0 40.0 33 39.256 40.0 40.0 40.0 39.0 40.0 34 39.30475 40.0 40.0 40.0 39.0 40.0 35 39.29 40.0 40.0 40.0 39.0 40.0 36 39.33975 40.0 40.0 40.0 39.0 40.0 37 39.35475 40.0 40.0 40.0 39.0 40.0 38 39.333 40.0 40.0 40.0 39.0 40.0 39 39.24525 40.0 40.0 40.0 39.0 40.0 40 39.29225 40.0 40.0 40.0 39.0 40.0 41 39.212 40.0 40.0 40.0 39.0 40.0 42 39.27825 40.0 40.0 40.0 39.0 40.0 43 39.2705 40.0 40.0 40.0 39.0 40.0 44 39.26875 40.0 40.0 40.0 39.0 40.0 45 39.27225 40.0 40.0 40.0 39.0 40.0 46 39.2125 40.0 40.0 40.0 39.0 40.0 47 39.25275 40.0 40.0 40.0 39.0 40.0 48 39.34725 40.0 40.0 40.0 39.0 40.0 49 39.30775 40.0 40.0 40.0 39.0 40.0 50 39.2715 40.0 40.0 40.0 39.0 40.0 51 39.27125 40.0 40.0 40.0 39.0 40.0 52 39.24525 40.0 40.0 40.0 39.0 40.0 53 39.27975 40.0 40.0 40.0 39.0 40.0 54 39.2815 40.0 40.0 40.0 39.0 40.0 55 39.20875 40.0 40.0 40.0 39.0 40.0 56 39.228 40.0 40.0 40.0 39.0 40.0 57 39.16 40.0 40.0 40.0 39.0 40.0 58 39.21425 40.0 40.0 40.0 39.0 40.0 59 39.25575 40.0 40.0 40.0 39.0 40.0 60 39.29475 40.0 40.0 40.0 39.0 40.0 61 39.33425 40.0 40.0 40.0 39.0 40.0 62 39.29375 40.0 40.0 40.0 39.0 40.0 63 39.31575 40.0 40.0 40.0 39.0 40.0 64 39.30375 40.0 40.0 40.0 39.0 40.0 65 39.23325 40.0 40.0 40.0 39.0 40.0 66 39.2625 40.0 40.0 40.0 39.0 40.0 67 39.20575 40.0 40.0 40.0 39.0 40.0 68 39.22975 40.0 40.0 40.0 39.0 40.0 69 39.25875 40.0 40.0 40.0 39.0 40.0 70 39.244 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 0.0 26 6.0 27 9.0 28 11.0 29 16.0 30 16.0 31 21.0 32 40.0 33 40.0 34 40.0 35 55.0 36 75.0 37 123.0 38 210.0 39 3336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.80246913580247 9.952128999748048 10.35525321239607 43.89014865205341 2 22.11105552776388 13.581790895447723 34.11705852926463 30.190095047523762 3 21.625 18.2 23.45 36.725 4 27.05 23.575 21.825 27.55 5 26.224999999999998 29.275000000000002 24.099999999999998 20.4 6 21.625 29.95 26.700000000000003 21.725 7 20.175 22.15 37.974999999999994 19.7 8 19.575 23.575 30.5 26.35 9 20.375 22.45 32.675 24.5 10 22.7 31.724999999999998 22.85 22.725 11 25.474999999999998 22.925 24.425 27.175 12 24.4 22.275 27.0 26.325 13 22.625 24.025 27.275 26.075 14 22.125 25.6 27.650000000000002 24.625 15 23.375 23.95 25.45 27.224999999999998 16 23.724999999999998 25.6 24.825 25.85 17 22.825 25.4 25.900000000000002 25.874999999999996 18 24.5 24.05 25.525 25.924999999999997 19 22.05 27.125 25.1 25.724999999999998 20 23.974999999999998 25.474999999999998 25.775 24.775 21 23.150000000000002 24.125 26.875 25.85 22 25.3 25.174999999999997 24.325 25.2 23 22.6 24.4 27.05 25.95 24 23.3 25.3 24.95 26.450000000000003 25 24.125 24.4 25.924999999999997 25.55 26 21.5 25.650000000000002 25.575 27.275 27 23.325000000000003 24.45 26.05 26.174999999999997 28 23.724999999999998 24.05 25.3 26.924999999999997 29 23.3 25.974999999999998 25.074999999999996 25.650000000000002 30 22.7 24.349999999999998 26.35 26.6 31 24.15 25.95 24.6 25.3 32 23.9 24.7 25.874999999999996 25.525 33 22.5 25.4 25.124999999999996 26.974999999999998 34 23.724999999999998 24.8 25.0 26.474999999999998 35 23.75 26.5 24.15 25.6 36 22.625 25.05 25.374999999999996 26.950000000000003 37 23.674999999999997 25.775 24.275 26.275 38 23.65 26.224999999999998 24.8 25.324999999999996 39 23.05 24.625 25.424999999999997 26.900000000000002 40 24.224999999999998 24.5 23.825 27.450000000000003 41 24.224999999999998 24.725 24.85 26.200000000000003 42 23.325000000000003 24.775 26.275 25.624999999999996 43 23.175 25.074999999999996 24.75 27.0 44 23.3 25.525 25.575 25.6 45 22.725 25.474999999999998 25.85 25.95 46 22.8 25.2 25.724999999999998 26.275 47 23.525 25.825 26.325 24.325 48 23.799999999999997 23.5 25.724999999999998 26.974999999999998 49 24.5 24.349999999999998 24.25 26.900000000000002 50 23.674999999999997 24.55 24.725 27.05 51 23.25 25.074999999999996 24.7 26.974999999999998 52 23.45 25.35 24.675 26.525 53 22.875 26.400000000000002 24.775 25.95 54 22.875 23.65 25.724999999999998 27.750000000000004 55 23.325000000000003 24.825 24.8 27.05 56 22.95573893473368 26.18154538634659 24.63115778944736 26.231557889472366 57 22.9057264316079 23.755938984746187 25.98149537384346 27.35683920980245 58 23.53088272068017 24.431107776944234 25.206301575393848 26.831707926981746 59 23.305826456614152 25.081270317579396 26.9567391847962 24.656164041010253 60 23.50587646911728 24.756189047261813 25.531382845711427 26.206551637909474 61 23.40585146286572 26.056514128532132 23.380845211302827 27.156789197299325 62 24.381095273818453 24.781195298824706 25.55638909727432 25.28132033008252 63 23.63090772693173 25.331332833208304 25.6064016004001 25.431357839459867 64 23.980995248812203 24.131032758189548 25.681420355088775 26.206551637909474 65 23.56178089044522 25.63781890945473 25.087543771885944 25.71285642821411 66 24.17940365823102 25.0814332247557 24.730643948884993 26.00851916812829 67 22.652907123080794 24.21344072489303 24.414799899320414 28.718852252705762 68 22.51604621309371 24.082156611039796 26.93196405648267 26.46983311938382 69 25.15218594355285 19.230769230769234 27.33812949640288 28.27891532927504 70 25.635359116022098 0.0 35.21178637200737 39.15285451197054 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 1.5 26 5.5 27 9.0 28 9.5 29 14.5 30 19.0 31 22.0 32 27.0 33 29.0 34 40.0 35 58.5 36 86.5 37 107.0 38 123.0 39 158.0 40 177.0 41 198.5 42 236.0 43 252.0 44 262.0 45 289.5 46 287.5 47 268.0 48 252.0 49 223.5 50 211.0 51 209.5 52 187.0 53 166.0 54 164.0 55 143.5 56 122.0 57 119.0 58 112.5 59 105.5 60 105.0 61 101.5 62 91.0 63 84.0 64 82.5 65 79.0 66 72.0 67 67.0 68 61.0 69 49.5 70 44.0 71 35.5 72 27.0 73 27.0 74 24.0 75 15.5 76 8.5 77 7.0 78 6.0 79 3.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.775 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.22499999999999998 67 0.675 68 2.625 69 9.65 70 32.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052705 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052705_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.25325 35.0 35.0 35.0 33.0 35.0 2 34.16275 35.0 35.0 35.0 32.0 35.0 3 34.21125 35.0 35.0 35.0 33.0 35.0 4 34.164 35.0 35.0 35.0 33.0 35.0 5 34.11975 35.0 35.0 35.0 33.0 35.0 6 38.80525 40.0 40.0 40.0 38.0 40.0 7 38.846 40.0 40.0 40.0 38.0 40.0 8 38.60075 40.0 40.0 40.0 37.0 40.0 9 38.80675 40.0 40.0 40.0 38.0 40.0 10 38.76275 40.0 40.0 40.0 37.0 40.0 11 38.726 40.0 40.0 40.0 37.0 40.0 12 38.756 40.0 40.0 40.0 37.0 40.0 13 38.795 40.0 40.0 40.0 38.0 40.0 14 38.76375 40.0 40.0 40.0 37.0 40.0 15 38.78025 40.0 40.0 40.0 38.0 40.0 16 38.829 40.0 40.0 40.0 38.0 40.0 17 38.698 40.0 40.0 40.0 38.0 40.0 18 38.7395 40.0 40.0 40.0 38.0 40.0 19 38.7705 40.0 40.0 40.0 37.0 40.0 20 38.76775 40.0 40.0 40.0 38.0 40.0 21 38.8335 40.0 40.0 40.0 38.0 40.0 22 38.83225 40.0 40.0 40.0 38.0 40.0 23 38.8025 40.0 40.0 40.0 38.0 40.0 24 38.746 40.0 40.0 40.0 38.0 40.0 25 38.7395 40.0 40.0 40.0 38.0 40.0 26 38.81575 40.0 40.0 40.0 38.0 40.0 27 38.759 40.0 40.0 40.0 38.0 40.0 28 38.78525 40.0 40.0 40.0 38.0 40.0 29 38.74225 40.0 40.0 40.0 38.0 40.0 30 38.82275 40.0 40.0 40.0 38.0 40.0 31 38.8205 40.0 40.0 40.0 38.0 40.0 32 38.7645 40.0 40.0 40.0 38.0 40.0 33 38.8145 40.0 40.0 40.0 38.0 40.0 34 38.8045 40.0 40.0 40.0 38.0 40.0 35 38.7285 40.0 40.0 40.0 38.0 40.0 36 38.80425 40.0 40.0 40.0 38.0 40.0 37 38.6515 40.0 40.0 40.0 37.0 40.0 38 38.74125 40.0 40.0 40.0 38.0 40.0 39 38.68425 40.0 40.0 40.0 38.0 40.0 40 38.7705 40.0 40.0 40.0 38.0 40.0 41 38.6735 40.0 40.0 40.0 37.0 40.0 42 38.67075 40.0 40.0 40.0 37.0 40.0 43 38.635 40.0 40.0 40.0 37.0 40.0 44 38.679 40.0 40.0 40.0 37.0 40.0 45 38.746 40.0 40.0 40.0 38.0 40.0 46 38.748 40.0 40.0 40.0 38.0 40.0 47 38.61125 40.0 40.0 40.0 37.0 40.0 48 38.584 40.0 40.0 40.0 37.0 40.0 49 38.67775 40.0 40.0 40.0 37.0 40.0 50 38.703 40.0 40.0 40.0 37.0 40.0 51 38.67575 40.0 40.0 40.0 38.0 40.0 52 38.643 40.0 40.0 40.0 37.0 40.0 53 38.6405 40.0 40.0 40.0 37.0 40.0 54 38.65825 40.0 40.0 40.0 37.0 40.0 55 38.582 40.0 40.0 40.0 37.0 40.0 56 38.55325 40.0 40.0 40.0 37.0 40.0 57 38.6575 40.0 40.0 40.0 37.0 40.0 58 38.75375 40.0 40.0 40.0 38.0 40.0 59 38.704 40.0 40.0 40.0 37.0 40.0 60 38.68725 40.0 40.0 40.0 38.0 40.0 61 38.5765 40.0 40.0 40.0 37.0 40.0 62 38.67025 40.0 40.0 40.0 37.0 40.0 63 38.60575 40.0 40.0 40.0 38.0 40.0 64 38.67475 40.0 40.0 40.0 37.0 40.0 65 38.6345 40.0 40.0 40.0 37.0 40.0 66 38.577 40.0 40.0 40.0 36.0 40.0 67 38.61525 40.0 40.0 40.0 37.0 40.0 68 38.64425 40.0 40.0 40.0 37.0 40.0 69 38.5965 40.0 40.0 40.0 38.0 40.0 70 38.6085 40.0 40.0 40.0 37.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 6.0 19 8.0 20 21.0 21 14.0 22 15.0 23 21.0 24 19.0 25 7.0 26 21.0 27 14.0 28 18.0 29 20.0 30 28.0 31 28.0 32 21.0 33 31.0 34 34.0 35 56.0 36 63.0 37 121.0 38 238.0 39 3195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.675 17.7 15.45 33.175 2 29.175 22.975 26.3 21.55 3 22.15 24.425 27.0 26.424999999999997 4 27.175 30.099999999999998 19.225 23.5 5 28.15 32.925 18.9 20.025000000000002 6 21.885942971485743 32.266133066533264 22.811405702851424 23.036518259129565 7 22.25 19.25 34.775 23.724999999999998 8 22.7 22.7 25.15 29.45 9 22.775000000000002 23.225 27.35 26.650000000000002 10 25.2 30.25 22.275 22.275 11 27.6 23.400000000000002 20.7 28.299999999999997 12 26.75 21.25 24.675 27.325 13 24.9 24.5 24.925 25.674999999999997 14 25.35 25.025 25.324999999999996 24.3 15 24.525 25.074999999999996 24.625 25.775 16 25.525 23.849999999999998 25.074999999999996 25.55 17 26.974999999999998 24.85 23.325000000000003 24.85 18 25.224999999999998 25.0 24.725 25.05 19 26.400000000000002 25.3 23.849999999999998 24.45 20 26.875 24.525 22.900000000000002 25.7 21 24.575 25.5 24.625 25.3 22 26.650000000000002 24.6 23.849999999999998 24.9 23 27.150000000000002 25.25 23.325000000000003 24.275 24 23.474999999999998 26.325 24.8 25.4 25 25.2 24.375 25.2 25.224999999999998 26 25.25 26.174999999999997 24.4 24.175 27 24.775 25.8 24.55 24.875 28 26.375 24.175 24.3 25.15 29 26.575 24.95 23.275000000000002 25.2 30 25.85 24.825 24.425 24.9 31 26.275 23.625 25.124999999999996 24.975 32 27.1 24.6 23.125 25.174999999999997 33 24.474999999999998 25.124999999999996 25.45 24.95 34 27.0 23.599999999999998 23.674999999999997 25.724999999999998 35 26.724999999999998 26.200000000000003 23.400000000000002 23.674999999999997 36 25.2 24.95 25.8 24.05 37 26.05 23.7 25.025 25.224999999999998 38 26.075 25.974999999999998 24.775 23.175 39 26.3 24.15 24.925 24.625 40 27.1 24.425 24.349999999999998 24.125 41 25.525 26.375 24.224999999999998 23.875 42 26.474999999999998 24.525 25.124999999999996 23.875 43 25.95 24.25 25.674999999999997 24.125 44 26.6 25.174999999999997 23.775 24.45 45 25.35 26.275 25.2 23.175 46 27.025 23.95 23.95 25.074999999999996 47 27.250000000000004 24.875 24.95 22.925 48 26.5 26.174999999999997 23.575 23.75 49 25.05 25.0 25.624999999999996 24.325 50 26.375 25.15 25.1 23.375 51 25.025 25.3 25.474999999999998 24.2 52 26.450000000000003 24.55 24.474999999999998 24.525 53 26.900000000000002 25.724999999999998 23.95 23.425 54 25.874999999999996 24.5 24.825 24.8 55 26.875 25.224999999999998 24.349999999999998 23.549999999999997 56 26.156539134783696 25.93148287071768 23.55588897224306 24.356089022255563 57 26.581645411352838 25.28132033008252 25.156289072268066 22.980745186296573 58 26.78169542385596 24.406101525381345 25.481370342585645 23.330832708177045 59 26.93173293323331 25.681420355088775 23.40585146286572 23.980995248812203 60 24.88122030507627 26.38159539884971 24.831207801950487 23.905976494123532 61 26.231557889472366 25.006251562890725 24.456114028507127 24.306076519129782 62 26.70667666916729 25.63140785196299 23.755938984746187 23.905976494123532 63 25.806451612903224 25.481370342585645 23.58089522380595 25.131282820705174 64 26.78169542385596 24.656164041010253 24.381095273818453 24.18104526131533 65 27.53441802252816 23.9549436795995 25.00625782227785 23.504380475594495 66 25.770869892203557 25.821007771371267 24.191526698420656 24.216595638004513 67 27.5644264780192 24.027286508337546 24.936836786255682 23.47145022738757 68 26.55163533350502 24.002060262683493 25.083698171516865 24.362606232294617 69 25.626043405676125 19.977740678909292 27.879799666110184 26.5164162493044 70 28.352633545013074 0.0 34.92715726559582 36.72020918939111 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.5 10 2.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.5 26 6.0 27 9.0 28 6.5 29 6.0 30 8.0 31 17.0 32 26.5 33 27.0 34 38.5 35 63.5 36 86.0 37 95.0 38 114.5 39 150.5 40 167.0 41 183.0 42 212.0 43 225.0 44 240.5 45 262.0 46 272.5 47 277.0 48 249.0 49 213.0 50 205.0 51 196.5 52 176.5 53 165.0 54 158.5 55 154.5 56 148.0 57 139.0 58 134.0 59 124.5 60 120.0 61 108.5 62 96.5 63 96.0 64 100.0 65 94.5 66 77.0 67 69.0 68 72.5 69 60.0 70 44.0 71 40.5 72 32.5 73 28.0 74 24.5 75 19.0 76 12.0 77 7.0 78 6.0 79 3.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.125 66 0.27499999999999997 67 1.05 68 2.9250000000000003 69 10.15 70 33.074999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54705586311022 98.9 2 0.3019627579265224 0.6 3 0.12581781580271767 0.375 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241298 spots for ERR5052705.sra Written 241298 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra Read 241280 spots for ERR5052705.sra Written 241280 spots for ERR5052705.sra SRR ids: ['ERR5052705.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xuhc86lw ERR5052705.sra spots: 4825618 blocks: [[1, 241280], [241281, 482560], [482561, 723840], [723841, 965120], [965121, 1206400], [1206401, 1447680], [1447681, 1688960], [1688961, 1930240], [1930241, 2171520], [2171521, 2412800], [2412801, 2654080], [2654081, 2895360], [2895361, 3136640], [3136641, 3377920], [3377921, 3619200], [3619201, 3860480], [3860481, 4101760], [4101761, 4343040], [4343041, 4584320], [4584321, 4825618]] ERR5052705 file size 855509 ERR5052705 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052705 ERR5052705_1.fastq ERR5052705_2.fastq Input file: ERR5052705_1.fastq Paired file: ERR5052705_2.fastq trimmed: ERR5052705-trimmed-pair1.fastq, ERR5052705-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:42:20 2024 >> started Tue Dec 10 05:42:25 2024 >> done (4.673s) 4825618 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 35 ( 0.00%) empty read pairs filtered out after trimming by size control 4825583 (100.00%) read pairs available; of these: 29 ( 0.00%) trimmed read pairs available after processing 4825554 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 25 0.00% 70 4825554 100.00% 4825583 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=2.1 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=255.49 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=24.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.30 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=282.59 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=20.9 sequence=CGCCGCCGCCGA ERR5052705 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:43:09 Started mapping on | Dec 10 05:43:09 Finished on | Dec 10 05:43:26 Mapping speed, Million of reads per hour | 1021.89 Number of input reads | 4825583 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4577557 Uniquely mapped reads % | 94.86% Average mapped length | 138.75 Number of splices: Total | 2283997 Number of splices: Annotated (sjdb) | 2173743 Number of splices: GT/AG | 2253858 Number of splices: GC/AG | 26721 Number of splices: AT/AC | 1151 Number of splices: Non-canonical | 2267 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.90 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 69919 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 9226 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 178107 178107 178107 N_multimapping 69919 69919 69919 N_noFeature 145099 4471020 172561 N_ambiguous 94312 452 15320 UnstrandedReadsAssigned:4338146 PositiveStrandReadsAssigned:106085 NegativeStrandReadsAssigned:4389676 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052705 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052705-trimmed-pair1.fastq ERR5052705-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,825,583 reads, 4,481,213 reads pseudoaligned [quant] estimated average fragment length: 185.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52973 ERR5052705.ke.tsv 35125 ERR5052705.se.tsv 88098 total ==> ERR5052705.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.486 55.9374 25.2685 PNS24247 1044 859.21 7.97603 3.15127 PNS24249 1928 1743.21 31.4695 6.12828 PNS24246 1044 859.21 7.97603 3.15127 PNS24248 1044 859.21 7.97603 3.15127 PNS24244 1471 1286.21 14.665 3.87053 PNS24243 293 122.987 0 0 KQK14069 1603 1418.21 5763.01 1379.45 KQK14071 474 292.098 178.161 207.053 ==> ERR5052705.se.tsv <== BRADI_1g14170v3 6277 BRADI_1g53295v3 32 BRADI_1g59795v3 175 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 274 BRADI_1g74790v3 91 BRADI_1g09890v3 0 BRADI_1g77505v3 146 BRADI_1g48960v3 0 ERR5052705 completed mapping pipeline successfully