Starting /dee2/code/volunteer_pipeline.sh ERR5052708 current disk space = 1526810529792 free memory = 1599949784 ERR5052708 SRAfilesize e49d51599c7e2d68f4f75d48a1461885 ERR5052708.sra ERR5052708.sra file validated ERR5052708 is paired end ERR5052708 is conventional basespace ERR5052708 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052708_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.20075 35.0 35.0 35.0 35.0 35.0 2 34.61675 35.0 35.0 35.0 35.0 35.0 3 34.62225 35.0 35.0 35.0 35.0 35.0 4 34.69825 35.0 35.0 35.0 35.0 35.0 5 34.6625 35.0 35.0 35.0 35.0 35.0 6 39.4825 40.0 40.0 40.0 39.0 40.0 7 39.4905 40.0 40.0 40.0 39.0 40.0 8 39.48975 40.0 40.0 40.0 39.0 40.0 9 39.4965 40.0 40.0 40.0 39.0 40.0 10 39.51725 40.0 40.0 40.0 39.0 40.0 11 39.56325 40.0 40.0 40.0 39.0 40.0 12 39.49325 40.0 40.0 40.0 39.0 40.0 13 39.49075 40.0 40.0 40.0 39.0 40.0 14 39.3835 40.0 40.0 40.0 39.0 40.0 15 39.4475 40.0 40.0 40.0 39.0 40.0 16 39.44075 40.0 40.0 40.0 39.0 40.0 17 39.46375 40.0 40.0 40.0 39.0 40.0 18 39.48125 40.0 40.0 40.0 39.0 40.0 19 39.491 40.0 40.0 40.0 39.0 40.0 20 39.428 40.0 40.0 40.0 39.0 40.0 21 39.45725 40.0 40.0 40.0 39.0 40.0 22 39.444 40.0 40.0 40.0 39.0 40.0 23 39.45375 40.0 40.0 40.0 39.0 40.0 24 39.397 40.0 40.0 40.0 39.0 40.0 25 39.41225 40.0 40.0 40.0 39.0 40.0 26 39.38275 40.0 40.0 40.0 39.0 40.0 27 39.3785 40.0 40.0 40.0 39.0 40.0 28 39.4285 40.0 40.0 40.0 39.0 40.0 29 39.427 40.0 40.0 40.0 39.0 40.0 30 39.4255 40.0 40.0 40.0 39.0 40.0 31 39.34925 40.0 40.0 40.0 39.0 40.0 32 39.3975 40.0 40.0 40.0 39.0 40.0 33 39.3565 40.0 40.0 40.0 39.0 40.0 34 39.282 40.0 40.0 40.0 39.0 40.0 35 39.33875 40.0 40.0 40.0 39.0 40.0 36 39.36675 40.0 40.0 40.0 39.0 40.0 37 39.41975 40.0 40.0 40.0 39.0 40.0 38 39.3655 40.0 40.0 40.0 39.0 40.0 39 39.38625 40.0 40.0 40.0 39.0 40.0 40 39.413 40.0 40.0 40.0 39.0 40.0 41 39.3505 40.0 40.0 40.0 39.0 40.0 42 39.4855 40.0 40.0 40.0 39.0 40.0 43 39.47375 40.0 40.0 40.0 39.0 40.0 44 39.42075 40.0 40.0 40.0 39.0 40.0 45 39.40125 40.0 40.0 40.0 39.0 40.0 46 39.44075 40.0 40.0 40.0 39.0 40.0 47 39.44175 40.0 40.0 40.0 39.0 40.0 48 39.418 40.0 40.0 40.0 39.0 40.0 49 39.3225 40.0 40.0 40.0 39.0 40.0 50 39.35975 40.0 40.0 40.0 39.0 40.0 51 39.387 40.0 40.0 40.0 39.0 40.0 52 39.35725 40.0 40.0 40.0 39.0 40.0 53 39.41625 40.0 40.0 40.0 39.0 40.0 54 39.35575 40.0 40.0 40.0 39.0 40.0 55 39.3855 40.0 40.0 40.0 39.0 40.0 56 39.36325 40.0 40.0 40.0 39.0 40.0 57 39.3175 40.0 40.0 40.0 39.0 40.0 58 39.299 40.0 40.0 40.0 39.0 40.0 59 39.2825 40.0 40.0 40.0 39.0 40.0 60 39.35025 40.0 40.0 40.0 39.0 40.0 61 39.32025 40.0 40.0 40.0 39.0 40.0 62 39.33375 40.0 40.0 40.0 39.0 40.0 63 39.3935 40.0 40.0 40.0 39.0 40.0 64 39.3535 40.0 40.0 40.0 39.0 40.0 65 39.388 40.0 40.0 40.0 39.0 40.0 66 39.3445 40.0 40.0 40.0 39.0 40.0 67 39.3695 40.0 40.0 40.0 39.0 40.0 68 39.35025 40.0 40.0 40.0 39.0 40.0 69 39.26525 40.0 40.0 40.0 39.0 40.0 70 39.35025 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 3.0 27 3.0 28 10.0 29 13.0 30 20.0 31 20.0 32 26.0 33 36.0 34 34.0 35 47.0 36 62.0 37 104.0 38 239.0 39 3381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.725888324873097 8.578680203045685 9.974619289340101 49.72081218274111 2 23.075000000000003 11.799999999999999 35.8 29.325000000000003 3 23.5 16.6 22.125 37.775 4 28.025 24.15 18.85 28.975 5 27.500000000000004 28.749999999999996 23.5 20.25 6 21.9 30.9 23.225 23.974999999999998 7 18.575 22.675 37.824999999999996 20.925 8 21.975 20.375 30.875000000000004 26.775 9 20.724999999999998 21.224999999999998 32.824999999999996 25.224999999999998 10 22.975 32.6 24.525 19.900000000000002 11 27.0 23.474999999999998 21.25 28.275 12 23.7 21.7 26.5 28.1 13 24.025 24.575 24.75 26.650000000000002 14 23.35 24.474999999999998 27.05 25.124999999999996 15 24.375 23.599999999999998 26.05 25.974999999999998 16 24.275 23.275000000000002 25.6 26.85 17 25.1 25.55 24.474999999999998 24.875 18 23.525 23.75 25.25 27.474999999999998 19 24.55 24.075 24.95 26.424999999999997 20 24.675 22.2 25.674999999999997 27.450000000000003 21 23.05 25.3 25.074999999999996 26.575 22 25.025 24.075 25.624999999999996 25.275 23 24.4 24.825 25.374999999999996 25.4 24 23.65 23.549999999999997 26.575 26.224999999999998 25 24.125 24.4 24.349999999999998 27.125 26 23.225 24.525 26.325 25.924999999999997 27 23.625 23.75 25.525 27.1 28 24.325 25.1 24.0 26.575 29 23.95 24.125 24.2 27.725 30 23.9 24.099999999999998 24.775 27.224999999999998 31 24.175 24.675 24.275 26.875 32 24.85 24.425 24.425 26.3 33 23.375 25.0 24.15 27.474999999999998 34 23.849999999999998 23.925 24.275 27.950000000000003 35 23.5 24.525 26.400000000000002 25.575 36 24.575 24.6 24.625 26.200000000000003 37 24.85 24.925 24.2 26.025 38 24.025 24.325 24.525 27.125 39 23.400000000000002 24.6 25.224999999999998 26.775 40 25.275 23.25 25.3 26.174999999999997 41 25.35 23.5 25.25 25.900000000000002 42 23.0 24.625 26.400000000000002 25.974999999999998 43 25.4 23.400000000000002 24.075 27.125 44 24.5 24.825 24.8 25.874999999999996 45 24.05 24.65 24.75 26.55 46 24.4 24.675 24.55 26.375 47 24.0 23.325000000000003 25.624999999999996 27.05 48 23.005751437859466 25.006251562890725 24.831207801950487 27.156789197299325 49 23.55588897224306 25.056264066016503 24.48112028007002 26.906726681670417 50 24.23105776444111 22.83070767691923 25.806451612903224 27.131782945736433 51 22.930732683170792 23.78094523630908 24.831207801950487 28.457114278569644 52 23.48087021755439 24.281070267566893 25.78144536134033 26.456614153538382 53 23.455863965991497 26.131532883220803 24.93123280820205 25.481370342585645 54 23.53088272068017 24.456114028507127 25.93148287071768 26.081520380095025 55 24.90622655663916 24.88122030507627 23.88097024256064 26.331582895723933 56 23.80595148787197 24.63115778944736 25.456364091022753 26.106526631657918 57 24.012006003001503 23.836918459229615 25.362681340670335 26.788394197098548 58 23.961980990495245 23.911955977988995 24.96248124062031 27.163581790895446 59 23.36168084042021 25.162581290645324 25.11255627813907 26.3631815907954 60 25.18759379689845 23.861930965482742 24.412206103051524 26.538269134567283 61 23.66183091545773 23.861930965482742 24.537268634317158 27.938969484742373 62 23.186593296648326 24.787393696848426 25.76288144072036 26.263131565782892 63 26.563281640820406 23.261630815407706 23.78689344672336 26.388194097048522 64 25.812906453226613 23.536768384192097 24.337168584292147 26.313156578289142 65 23.861930965482742 24.012006003001503 25.41270635317659 26.713356678339167 66 24.024024024024023 23.7987987987988 24.94994994994995 27.227227227227228 67 24.258421317244846 25.037707390648567 25.23881347410759 25.465057817998993 68 25.236270753512137 23.371647509578544 25.006385696040866 26.385696040868456 69 24.24910443648388 19.096169743731057 27.66602369798843 28.98870212179664 70 26.87935460212688 0.0 34.1034103410341 39.01723505683902 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 3.5 27 5.0 28 7.5 29 11.0 30 12.0 31 14.5 32 28.5 33 40.0 34 42.0 35 55.5 36 84.5 37 102.0 38 113.0 39 144.5 40 165.0 41 170.0 42 185.5 43 196.0 44 212.0 45 241.0 46 250.0 47 246.0 48 242.5 49 233.0 50 227.0 51 208.5 52 190.0 53 190.0 54 177.0 55 173.0 56 171.0 57 160.0 58 152.0 59 143.0 60 142.0 61 127.0 62 107.5 63 103.0 64 95.0 65 85.5 66 83.5 67 83.0 68 67.5 69 45.0 70 38.0 71 37.5 72 29.0 73 21.0 74 22.0 75 17.5 76 13.0 77 14.0 78 8.0 79 2.0 80 2.0 81 1.0 82 1.5 83 3.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.05 58 0.05 59 0.05 60 0.05 61 0.05 62 0.05 63 0.05 64 0.05 65 0.05 66 0.1 67 0.5499999999999999 68 2.125 69 9.275 70 31.825 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052708 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052708_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.50025 35.0 35.0 35.0 34.0 35.0 2 34.497 35.0 35.0 35.0 34.0 35.0 3 34.449 35.0 35.0 35.0 34.0 35.0 4 34.487 35.0 35.0 35.0 34.0 35.0 5 34.48525 35.0 35.0 35.0 35.0 35.0 6 39.2635 40.0 40.0 40.0 39.0 40.0 7 39.19075 40.0 40.0 40.0 39.0 40.0 8 39.21525 40.0 40.0 40.0 39.0 40.0 9 39.24425 40.0 40.0 40.0 39.0 40.0 10 39.25075 40.0 40.0 40.0 39.0 40.0 11 39.28825 40.0 40.0 40.0 39.0 40.0 12 39.24675 40.0 40.0 40.0 39.0 40.0 13 39.27225 40.0 40.0 40.0 39.0 40.0 14 39.29925 40.0 40.0 40.0 39.0 40.0 15 39.28525 40.0 40.0 40.0 39.0 40.0 16 39.31575 40.0 40.0 40.0 39.0 40.0 17 39.278 40.0 40.0 40.0 39.0 40.0 18 39.2605 40.0 40.0 40.0 39.0 40.0 19 39.286 40.0 40.0 40.0 39.0 40.0 20 39.2625 40.0 40.0 40.0 39.0 40.0 21 39.23675 40.0 40.0 40.0 39.0 40.0 22 39.2195 40.0 40.0 40.0 39.0 40.0 23 39.31275 40.0 40.0 40.0 39.0 40.0 24 39.25025 40.0 40.0 40.0 39.0 40.0 25 39.26175 40.0 40.0 40.0 39.0 40.0 26 39.24825 40.0 40.0 40.0 39.0 40.0 27 39.23725 40.0 40.0 40.0 39.0 40.0 28 39.24275 40.0 40.0 40.0 39.0 40.0 29 39.288 40.0 40.0 40.0 39.0 40.0 30 39.27025 40.0 40.0 40.0 39.0 40.0 31 39.25 40.0 40.0 40.0 39.0 40.0 32 39.2795 40.0 40.0 40.0 39.0 40.0 33 39.26975 40.0 40.0 40.0 39.0 40.0 34 39.29075 40.0 40.0 40.0 39.0 40.0 35 39.26325 40.0 40.0 40.0 39.0 40.0 36 39.221 40.0 40.0 40.0 39.0 40.0 37 39.20975 40.0 40.0 40.0 39.0 40.0 38 39.16375 40.0 40.0 40.0 39.0 40.0 39 39.15325 40.0 40.0 40.0 39.0 40.0 40 39.2165 40.0 40.0 40.0 39.0 40.0 41 39.2065 40.0 40.0 40.0 39.0 40.0 42 39.19725 40.0 40.0 40.0 39.0 40.0 43 39.231 40.0 40.0 40.0 39.0 40.0 44 39.22525 40.0 40.0 40.0 39.0 40.0 45 39.22375 40.0 40.0 40.0 39.0 40.0 46 39.18175 40.0 40.0 40.0 39.0 40.0 47 39.21525 40.0 40.0 40.0 39.0 40.0 48 39.1185 40.0 40.0 40.0 39.0 40.0 49 39.147 40.0 40.0 40.0 39.0 40.0 50 39.159 40.0 40.0 40.0 39.0 40.0 51 39.1355 40.0 40.0 40.0 39.0 40.0 52 39.04525 40.0 40.0 40.0 39.0 40.0 53 39.07825 40.0 40.0 40.0 39.0 40.0 54 39.1145 40.0 40.0 40.0 39.0 40.0 55 39.2065 40.0 40.0 40.0 39.0 40.0 56 39.11775 40.0 40.0 40.0 39.0 40.0 57 39.165 40.0 40.0 40.0 39.0 40.0 58 39.1495 40.0 40.0 40.0 39.0 40.0 59 39.21375 40.0 40.0 40.0 39.0 40.0 60 39.1845 40.0 40.0 40.0 39.0 40.0 61 39.1685 40.0 40.0 40.0 39.0 40.0 62 39.1875 40.0 40.0 40.0 39.0 40.0 63 39.063 40.0 40.0 40.0 39.0 40.0 64 39.16825 40.0 40.0 40.0 39.0 40.0 65 39.1825 40.0 40.0 40.0 39.0 40.0 66 39.13025 40.0 40.0 40.0 39.0 40.0 67 39.11775 40.0 40.0 40.0 39.0 40.0 68 39.05075 40.0 40.0 40.0 39.0 40.0 69 39.07325 40.0 40.0 40.0 39.0 40.0 70 39.08925 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 6.0 21 7.0 22 6.0 23 7.0 24 5.0 25 5.0 26 10.0 27 12.0 28 10.0 29 16.0 30 15.0 31 20.0 32 25.0 33 20.0 34 32.0 35 50.0 36 63.0 37 101.0 38 240.0 39 3347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.25 14.799999999999999 13.425 41.525 2 29.299999999999997 20.875 27.575 22.25 3 23.1 24.349999999999998 26.924999999999997 25.624999999999996 4 26.075 29.975 18.95 25.0 5 29.025000000000002 32.15 18.625 20.200000000000003 6 22.675 33.925 20.25 23.150000000000002 7 23.5 16.5 34.925 25.074999999999996 8 22.75 21.725 25.7 29.825000000000003 9 23.75 22.425 27.275 26.55 10 24.9 31.924999999999997 20.525 22.650000000000002 11 26.5 23.65 20.349999999999998 29.5 12 27.200000000000003 20.125 24.275 28.4 13 25.825 22.575 25.4 26.200000000000003 14 26.450000000000003 24.725 23.175 25.650000000000002 15 25.7 25.025 23.925 25.35 16 27.0 22.725 23.575 26.700000000000003 17 26.400000000000002 25.624999999999996 22.75 25.224999999999998 18 25.55 24.325 24.0 26.125 19 24.875 25.775 23.825 25.525 20 27.750000000000004 24.525 23.0 24.725 21 26.275 25.724999999999998 23.974999999999998 24.025 22 25.8 24.275 24.25 25.674999999999997 23 25.95 25.974999999999998 22.175 25.900000000000002 24 25.674999999999997 25.15 23.875 25.3 25 25.474999999999998 25.75 22.375 26.400000000000002 26 25.874999999999996 26.424999999999997 22.725 24.975 27 25.35 24.575 24.575 25.5 28 25.6 25.474999999999998 23.625 25.3 29 26.35 23.799999999999997 24.375 25.474999999999998 30 25.074999999999996 25.624999999999996 23.825 25.474999999999998 31 24.575 25.900000000000002 23.275000000000002 26.25 32 26.525 26.025 22.6 24.85 33 24.575 25.525 24.4 25.5 34 26.150000000000002 23.525 24.125 26.200000000000003 35 27.250000000000004 23.9 23.474999999999998 25.374999999999996 36 26.900000000000002 24.8 24.0 24.3 37 25.5 24.95 23.825 25.724999999999998 38 25.825 25.474999999999998 23.075000000000003 25.624999999999996 39 25.474999999999998 24.875 25.025 24.625 40 26.150000000000002 22.7 23.65 27.500000000000004 41 27.0 24.6 23.35 25.05 42 26.05 25.324999999999996 24.175 24.45 43 25.85 24.25 23.849999999999998 26.05 44 26.0 25.025 23.9 25.074999999999996 45 25.575 25.05 24.45 24.925 46 25.05 24.95 23.95 26.05 47 26.35 24.575 23.474999999999998 25.6 48 25.78144536134033 25.531382845711427 23.605901475368842 25.081270317579396 49 26.881720430107524 25.081270317579396 22.48062015503876 25.55638909727432 50 26.881720430107524 23.905976494123532 23.80595148787197 25.406351587896975 51 26.081520380095025 24.956239059764943 24.731182795698924 24.23105776444111 52 26.331582895723933 23.380845211302827 24.23105776444111 26.056514128532132 53 28.207051762940733 24.706176544136035 23.93098274568642 23.15578894723681 54 26.03150787696924 24.831207801950487 23.13078269567392 26.006501625406354 55 25.581395348837212 23.63090772693173 25.531382845711427 25.256314078519633 56 27.581895473868467 23.40585146286572 22.53063265816454 26.481620405101275 57 26.28814407203602 26.138069034517258 23.336668334167083 24.23711855927964 58 27.213606803401703 23.961980990495245 23.411705852926463 25.41270635317659 59 26.513256628314156 25.512756378189096 23.336668334167083 24.637318659329665 60 24.362181090545274 24.987493746873437 25.03751875937969 25.6128064032016 61 27.238619309654826 24.112056028014006 22.511255627813906 26.138069034517258 62 26.613306653326664 24.912456228114056 23.861930965482742 24.61230615307654 63 25.168876657493122 26.194645984488368 24.768576432324245 23.867900925694272 64 26.8951713785339 23.642732049036777 22.692019014260694 26.770077558168627 65 27.183979974968707 24.155193992490613 23.504380475594495 25.15644555694618 66 24.993720170811354 24.74252700326551 25.169555388093446 25.094197437829692 67 25.498611461752084 23.958596314062106 24.943196162585206 25.599596061600604 68 27.24697398918362 23.229461756373937 23.564254442441413 25.95930981200103 69 26.52088589851416 18.72722175497617 26.408746846089148 28.34314550042052 70 28.7732342007435 0.0 34.721189591078065 36.50557620817844 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 3.0 24 3.5 25 3.5 26 2.5 27 2.0 28 4.5 29 9.5 30 12.0 31 14.5 32 23.0 33 29.0 34 32.5 35 50.0 36 80.5 37 97.0 38 97.5 39 126.0 40 154.0 41 168.5 42 190.0 43 197.0 44 214.0 45 230.0 46 233.5 47 238.0 48 253.5 49 233.0 50 197.0 51 195.5 52 181.0 53 168.0 54 171.5 55 172.0 56 156.5 57 144.0 58 156.5 59 151.0 60 133.0 61 126.0 62 115.0 63 111.0 64 104.5 65 98.0 66 85.0 67 72.0 68 70.0 69 68.0 70 68.0 71 56.0 72 40.0 73 36.0 74 29.0 75 21.5 76 15.0 77 9.0 78 6.5 79 3.5 80 3.0 81 2.5 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.05 58 0.05 59 0.05 60 0.05 61 0.05 62 0.05 63 0.075 64 0.075 65 0.125 66 0.475 67 0.975 68 2.9250000000000003 69 10.825 70 32.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296390 spots for ERR5052708.sra Written 296390 spots for ERR5052708.sra Read 296395 spots for ERR5052708.sra Written 296395 spots for ERR5052708.sra SRR ids: ['ERR5052708.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7cyo66em ERR5052708.sra spots: 5927805 blocks: [[1, 296390], [296391, 592780], [592781, 889170], [889171, 1185560], [1185561, 1481950], [1481951, 1778340], [1778341, 2074730], [2074731, 2371120], [2371121, 2667510], [2667511, 2963900], [2963901, 3260290], [3260291, 3556680], [3556681, 3853070], [3853071, 4149460], [4149461, 4445850], [4445851, 4742240], [4742241, 5038630], [5038631, 5335020], [5335021, 5631410], [5631411, 5927805]] ERR5052708 file size 1051405 ERR5052708 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052708 ERR5052708_1.fastq ERR5052708_2.fastq Input file: ERR5052708_1.fastq Paired file: ERR5052708_2.fastq trimmed: ERR5052708-trimmed-pair1.fastq, ERR5052708-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:17:09 2024 >> started Tue Dec 10 08:17:15 2024 >> done (5.767s) 5927805 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 17 ( 0.00%) empty read pairs filtered out after trimming by size control 5927788 (100.00%) read pairs available; of these: 14 ( 0.00%) trimmed read pairs available after processing 5927774 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 13 0.00% 70 5927774 100.00% 5927788 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=12 prefix-density=0.13 prefix-fanout=3.4 sequence=TGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=123.78 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.17 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=8 fanout-score=203.27 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=23.8 sequence=CGCCGCCGCCGT ERR5052708 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:17:44 Started mapping on | Dec 10 08:17:44 Finished on | Dec 10 08:18:45 Mapping speed, Million of reads per hour | 349.84 Number of input reads | 5927788 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4811409 Uniquely mapped reads % | 81.17% Average mapped length | 138.78 Number of splices: Total | 2318736 Number of splices: Annotated (sjdb) | 2210620 Number of splices: GT/AG | 2286885 Number of splices: GC/AG | 28584 Number of splices: AT/AC | 994 Number of splices: Non-canonical | 2273 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 115539 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 33614 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.44% % of reads unmapped: other | 1.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1000840 1000840 1000840 N_multimapping 115539 115539 115539 N_noFeature 168023 4696639 196740 N_ambiguous 102595 411 16736 UnstrandedReadsAssigned:4540791 PositiveStrandReadsAssigned:114359 NegativeStrandReadsAssigned:4597933 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052708 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052708-trimmed-pair1.fastq ERR5052708-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,927,788 reads, 4,662,575 reads pseudoaligned [quant] estimated average fragment length: 193.672 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52973 ERR5052708.ke.tsv 35125 ERR5052708.se.tsv 88098 total ==> ERR5052708.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.652 7.34441e-07 3.18972e-07 PNS24247 1044 851.328 17.2374 6.53946 PNS24249 1928 1735.33 31.276 5.82098 PNS24246 1044 851.328 17.2374 6.53946 PNS24248 1044 851.328 17.2374 6.53946 PNS24244 1471 1278.33 25.0117 6.31927 PNS24243 293 116.187 0 0 KQK14069 1603 1410.33 4546.22 1041.11 KQK14071 474 284.515 224.431 254.768 ==> ERR5052708.se.tsv <== BRADI_1g14170v3 5171 BRADI_1g53295v3 15 BRADI_1g59795v3 161 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 219 BRADI_1g74790v3 185 BRADI_1g09890v3 0 BRADI_1g77505v3 88 BRADI_1g48960v3 0 ERR5052708 completed mapping pipeline successfully