Starting /dee2/code/volunteer_pipeline.sh ERR5052709 current disk space = 1525841612800 free memory = 1602356108 ERR5052709 SRAfilesize 8932cea302056830a5df9460919100b1 ERR5052709.sra ERR5052709.sra file validated ERR5052709 is paired end ERR5052709 is conventional basespace ERR5052709 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052709_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.308 35.0 35.0 35.0 35.0 35.0 2 34.6335 35.0 35.0 35.0 35.0 35.0 3 34.66825 35.0 35.0 35.0 35.0 35.0 4 34.71325 35.0 35.0 35.0 35.0 35.0 5 34.71 35.0 35.0 35.0 35.0 35.0 6 39.518 40.0 40.0 40.0 39.0 40.0 7 39.48525 40.0 40.0 40.0 39.0 40.0 8 39.4695 40.0 40.0 40.0 39.0 40.0 9 39.4675 40.0 40.0 40.0 39.0 40.0 10 39.472 40.0 40.0 40.0 39.0 40.0 11 39.4525 40.0 40.0 40.0 39.0 40.0 12 39.4775 40.0 40.0 40.0 39.0 40.0 13 39.50275 40.0 40.0 40.0 39.0 40.0 14 39.49625 40.0 40.0 40.0 39.0 40.0 15 39.4325 40.0 40.0 40.0 39.0 40.0 16 39.4475 40.0 40.0 40.0 39.0 40.0 17 39.399 40.0 40.0 40.0 39.0 40.0 18 39.4225 40.0 40.0 40.0 39.0 40.0 19 39.412 40.0 40.0 40.0 39.0 40.0 20 39.484 40.0 40.0 40.0 39.0 40.0 21 39.453 40.0 40.0 40.0 39.0 40.0 22 39.41825 40.0 40.0 40.0 39.0 40.0 23 39.338 40.0 40.0 40.0 39.0 40.0 24 39.428 40.0 40.0 40.0 39.0 40.0 25 39.39525 40.0 40.0 40.0 39.0 40.0 26 39.4145 40.0 40.0 40.0 39.0 40.0 27 39.3505 40.0 40.0 40.0 39.0 40.0 28 39.41 40.0 40.0 40.0 39.0 40.0 29 39.44925 40.0 40.0 40.0 39.0 40.0 30 39.45075 40.0 40.0 40.0 39.0 40.0 31 39.4395 40.0 40.0 40.0 39.0 40.0 32 39.41275 40.0 40.0 40.0 39.0 40.0 33 39.43325 40.0 40.0 40.0 39.0 40.0 34 39.46475 40.0 40.0 40.0 39.0 40.0 35 39.40925 40.0 40.0 40.0 39.0 40.0 36 39.40625 40.0 40.0 40.0 39.0 40.0 37 39.4175 40.0 40.0 40.0 39.0 40.0 38 39.387 40.0 40.0 40.0 39.0 40.0 39 39.386 40.0 40.0 40.0 39.0 40.0 40 39.40625 40.0 40.0 40.0 39.0 40.0 41 39.3485 40.0 40.0 40.0 39.0 40.0 42 39.382 40.0 40.0 40.0 39.0 40.0 43 39.42275 40.0 40.0 40.0 39.0 40.0 44 39.3665 40.0 40.0 40.0 39.0 40.0 45 39.3555 40.0 40.0 40.0 39.0 40.0 46 39.34325 40.0 40.0 40.0 39.0 40.0 47 39.2925 40.0 40.0 40.0 39.0 40.0 48 39.36325 40.0 40.0 40.0 39.0 40.0 49 39.415 40.0 40.0 40.0 39.0 40.0 50 39.4205 40.0 40.0 40.0 39.0 40.0 51 39.4035 40.0 40.0 40.0 39.0 40.0 52 39.41575 40.0 40.0 40.0 39.0 40.0 53 39.3815 40.0 40.0 40.0 39.0 40.0 54 39.38675 40.0 40.0 40.0 39.0 40.0 55 39.425 40.0 40.0 40.0 39.0 40.0 56 39.40625 40.0 40.0 40.0 39.0 40.0 57 39.341 40.0 40.0 40.0 39.0 40.0 58 39.3115 40.0 40.0 40.0 39.0 40.0 59 39.37175 40.0 40.0 40.0 39.0 40.0 60 39.3905 40.0 40.0 40.0 39.0 40.0 61 39.403 40.0 40.0 40.0 39.0 40.0 62 39.41725 40.0 40.0 40.0 39.0 40.0 63 39.42625 40.0 40.0 40.0 39.0 40.0 64 39.35625 40.0 40.0 40.0 39.0 40.0 65 39.342 40.0 40.0 40.0 39.0 40.0 66 39.35225 40.0 40.0 40.0 39.0 40.0 67 39.35675 40.0 40.0 40.0 39.0 40.0 68 39.38375 40.0 40.0 40.0 39.0 40.0 69 39.30425 40.0 40.0 40.0 39.0 40.0 70 39.34825 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 5.0 28 8.0 29 11.0 30 12.0 31 15.0 32 27.0 33 36.0 34 40.0 35 58.0 36 61.0 37 103.0 38 257.0 39 3362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.20424671385238 9.30232558139535 9.100101112234581 49.393326592517695 2 24.356089022255563 12.328082020505127 33.53338334583646 29.782445611402853 3 22.725 16.75 21.475 39.050000000000004 4 27.224999999999998 22.85 21.2 28.725 5 27.474999999999998 27.900000000000002 23.075000000000003 21.55 6 22.125 30.825000000000003 23.974999999999998 23.075000000000003 7 19.55 22.75 36.675000000000004 21.025 8 20.525 21.45 30.3 27.725 9 20.075000000000003 21.45 33.75 24.725 10 22.525000000000002 32.0 23.799999999999997 21.675 11 27.325 24.675 20.549999999999997 27.450000000000003 12 25.275 20.225 26.875 27.625 13 23.3 23.875 26.150000000000002 26.674999999999997 14 24.325 24.349999999999998 25.424999999999997 25.900000000000002 15 24.349999999999998 24.375 24.575 26.700000000000003 16 23.0 24.25 25.575 27.175 17 24.575 23.275000000000002 25.525 26.625 18 22.925 24.15 25.775 27.150000000000002 19 25.3 23.45 24.025 27.224999999999998 20 24.5 24.15 24.825 26.525 21 23.5 23.95 25.624999999999996 26.924999999999997 22 23.5 24.95 25.3 26.25 23 24.474999999999998 25.374999999999996 24.975 25.174999999999997 24 23.5 25.224999999999998 24.4 26.875 25 24.65 24.725 24.05 26.575 26 23.625 25.575 25.525 25.275 27 24.325 24.3 24.75 26.625 28 24.2 24.375 24.4 27.025 29 24.3 24.625 25.575 25.5 30 24.725 23.65 25.35 26.275 31 24.099999999999998 24.025 23.5 28.375 32 25.074999999999996 24.6 24.5 25.825 33 24.125 23.75 24.75 27.375 34 24.775 24.2 24.025 27.0 35 24.5 23.849999999999998 24.425 27.224999999999998 36 24.2 24.025 25.324999999999996 26.450000000000003 37 25.05 23.625 23.674999999999997 27.650000000000002 38 24.9 23.799999999999997 25.2 26.1 39 23.275000000000002 24.349999999999998 25.775 26.6 40 24.099999999999998 23.65 24.7 27.55 41 24.875 24.775 25.7 24.65 42 22.55 25.85 23.974999999999998 27.625 43 25.55 23.5 24.175 26.775 44 23.7 24.75 25.2 26.35 45 24.3 23.9 24.85 26.950000000000003 46 25.124999999999996 24.0 24.325 26.55 47 24.2 25.35 24.099999999999998 26.35 48 23.275000000000002 23.925 26.224999999999998 26.575 49 23.775 24.7 24.55 26.974999999999998 50 24.85 24.975 23.724999999999998 26.450000000000003 51 24.575 23.25 25.074999999999996 27.1 52 24.375 24.425 24.975 26.224999999999998 53 24.224999999999998 23.599999999999998 25.324999999999996 26.85 54 24.275 24.275 25.474999999999998 25.974999999999998 55 23.9 24.425 24.224999999999998 27.450000000000003 56 24.8 23.9 25.724999999999998 25.575 57 24.325 23.599999999999998 26.375 25.7 58 24.775 23.05 25.25 26.924999999999997 59 24.099999999999998 24.7 25.45 25.75 60 23.5 24.25 24.925 27.325 61 24.731182795698924 24.781195298824706 23.58089522380595 26.906726681670417 62 25.23130782695674 23.53088272068017 25.881470367591895 25.35633908477119 63 25.6064016004001 22.9057264316079 25.131282820705174 26.356589147286826 64 23.605901475368842 24.256064016004 25.906476619154787 26.231557889472366 65 24.831207801950487 24.10602650662666 24.88122030507627 26.18154538634659 66 23.82861438236031 23.878727136056128 25.206715108995237 27.08594337258832 67 23.672955974842765 24.050314465408807 23.446540880503143 28.830188679245282 68 24.28827904590921 23.80097460887407 23.980507822518597 27.930238522698126 69 25.565361279646993 19.249862107004965 27.55102040816326 27.633756205184778 70 27.716994894237786 0.0 33.6615609044493 38.62144420131291 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 3.0 27 5.0 28 5.5 29 11.0 30 16.0 31 21.0 32 25.5 33 25.0 34 42.5 35 59.0 36 73.5 37 89.0 38 104.0 39 139.5 40 160.0 41 172.0 42 185.5 43 187.0 44 211.0 45 236.5 46 237.5 47 237.0 48 235.5 49 233.5 50 233.0 51 220.0 52 202.0 53 197.0 54 180.0 55 175.5 56 177.0 57 166.0 58 154.5 59 137.5 60 132.0 61 115.0 62 100.5 63 103.0 64 97.0 65 89.0 66 81.5 67 76.0 68 70.5 69 54.5 70 44.0 71 45.5 72 38.0 73 29.0 74 22.0 75 16.5 76 13.5 77 9.0 78 6.5 79 3.0 80 2.0 81 1.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0999999999999999 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.22499999999999998 67 0.625 68 2.5250000000000004 69 9.35 70 31.45 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052709 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052709_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.51575 35.0 35.0 35.0 34.0 35.0 2 34.56175 35.0 35.0 35.0 34.0 35.0 3 34.448 35.0 35.0 35.0 34.0 35.0 4 34.42525 35.0 35.0 35.0 34.0 35.0 5 34.49625 35.0 35.0 35.0 34.0 35.0 6 39.2615 40.0 40.0 40.0 39.0 40.0 7 39.23 40.0 40.0 40.0 39.0 40.0 8 39.19125 40.0 40.0 40.0 39.0 40.0 9 39.254 40.0 40.0 40.0 39.0 40.0 10 39.25 40.0 40.0 40.0 39.0 40.0 11 39.30075 40.0 40.0 40.0 39.0 40.0 12 39.23625 40.0 40.0 40.0 39.0 40.0 13 39.27025 40.0 40.0 40.0 39.0 40.0 14 39.251 40.0 40.0 40.0 39.0 40.0 15 39.2895 40.0 40.0 40.0 39.0 40.0 16 39.30475 40.0 40.0 40.0 39.0 40.0 17 39.26525 40.0 40.0 40.0 39.0 40.0 18 39.28375 40.0 40.0 40.0 39.0 40.0 19 39.3085 40.0 40.0 40.0 39.0 40.0 20 39.2595 40.0 40.0 40.0 39.0 40.0 21 39.259 40.0 40.0 40.0 39.0 40.0 22 39.25925 40.0 40.0 40.0 39.0 40.0 23 39.321 40.0 40.0 40.0 39.0 40.0 24 39.257 40.0 40.0 40.0 39.0 40.0 25 39.3035 40.0 40.0 40.0 39.0 40.0 26 39.324 40.0 40.0 40.0 39.0 40.0 27 39.23925 40.0 40.0 40.0 39.0 40.0 28 39.249 40.0 40.0 40.0 39.0 40.0 29 39.2865 40.0 40.0 40.0 39.0 40.0 30 39.2665 40.0 40.0 40.0 39.0 40.0 31 39.26375 40.0 40.0 40.0 39.0 40.0 32 39.24175 40.0 40.0 40.0 39.0 40.0 33 39.25775 40.0 40.0 40.0 39.0 40.0 34 39.2685 40.0 40.0 40.0 39.0 40.0 35 39.23775 40.0 40.0 40.0 39.0 40.0 36 39.25925 40.0 40.0 40.0 39.0 40.0 37 39.19025 40.0 40.0 40.0 39.0 40.0 38 39.22725 40.0 40.0 40.0 39.0 40.0 39 39.25575 40.0 40.0 40.0 39.0 40.0 40 39.30525 40.0 40.0 40.0 39.0 40.0 41 39.161 40.0 40.0 40.0 39.0 40.0 42 39.2675 40.0 40.0 40.0 39.0 40.0 43 39.2045 40.0 40.0 40.0 39.0 40.0 44 39.22225 40.0 40.0 40.0 39.0 40.0 45 39.21275 40.0 40.0 40.0 39.0 40.0 46 39.23375 40.0 40.0 40.0 39.0 40.0 47 39.1995 40.0 40.0 40.0 39.0 40.0 48 39.18975 40.0 40.0 40.0 39.0 40.0 49 39.21575 40.0 40.0 40.0 39.0 40.0 50 39.2 40.0 40.0 40.0 39.0 40.0 51 39.16275 40.0 40.0 40.0 39.0 40.0 52 39.116 40.0 40.0 40.0 39.0 40.0 53 39.158 40.0 40.0 40.0 39.0 40.0 54 39.15825 40.0 40.0 40.0 39.0 40.0 55 39.242 40.0 40.0 40.0 39.0 40.0 56 39.18975 40.0 40.0 40.0 39.0 40.0 57 39.23725 40.0 40.0 40.0 39.0 40.0 58 39.191 40.0 40.0 40.0 39.0 40.0 59 39.17225 40.0 40.0 40.0 39.0 40.0 60 39.18525 40.0 40.0 40.0 39.0 40.0 61 39.184 40.0 40.0 40.0 39.0 40.0 62 39.1985 40.0 40.0 40.0 39.0 40.0 63 39.0935 40.0 40.0 40.0 39.0 40.0 64 39.14875 40.0 40.0 40.0 39.0 40.0 65 39.13175 40.0 40.0 40.0 39.0 40.0 66 39.18 40.0 40.0 40.0 39.0 40.0 67 39.213 40.0 40.0 40.0 39.0 40.0 68 39.24275 40.0 40.0 40.0 39.0 40.0 69 39.19025 40.0 40.0 40.0 39.0 40.0 70 39.1795 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 4.0 20 7.0 21 6.0 22 5.0 23 8.0 24 8.0 25 7.0 26 5.0 27 7.0 28 11.0 29 10.0 30 17.0 31 15.0 32 16.0 33 26.0 34 28.0 35 50.0 36 56.0 37 104.0 38 235.0 39 3372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.225 14.725 14.475 41.575 2 29.7 21.85 28.249999999999996 20.200000000000003 3 21.224999999999998 25.124999999999996 26.575 27.075 4 26.775 28.799999999999997 20.025000000000002 24.4 5 29.325000000000003 31.55 19.475 19.650000000000002 6 23.43671835917959 34.44222111055527 19.884942471235618 22.236118059029515 7 23.974999999999998 16.775000000000002 34.699999999999996 24.55 8 23.775 22.35 25.3 28.575 9 23.875 22.075 26.650000000000002 27.400000000000002 10 24.925 31.324999999999996 21.45 22.3 11 28.499999999999996 23.849999999999998 19.950000000000003 27.700000000000003 12 27.3 20.925 23.599999999999998 28.175 13 26.950000000000003 22.0 24.474999999999998 26.575 14 25.35 26.974999999999998 22.525000000000002 25.15 15 25.374999999999996 25.124999999999996 24.775 24.725 16 26.700000000000003 23.724999999999998 23.5 26.075 17 27.3 25.0 22.675 25.025 18 25.4 25.224999999999998 24.5 24.875 19 27.625 21.775 24.975 25.624999999999996 20 28.125 25.674999999999997 21.95 24.25 21 25.924999999999997 26.075 23.200000000000003 24.8 22 26.950000000000003 25.374999999999996 21.55 26.125 23 26.974999999999998 25.324999999999996 23.474999999999998 24.224999999999998 24 25.624999999999996 25.6 24.85 23.925 25 26.85 24.3 22.6 26.25 26 28.050000000000004 24.425 23.400000000000002 24.125 27 26.150000000000002 24.275 24.25 25.324999999999996 28 26.05 23.400000000000002 24.025 26.525 29 25.4 24.65 24.325 25.624999999999996 30 26.55 24.6 24.224999999999998 24.625 31 26.450000000000003 24.4 24.0 25.15 32 27.35 25.6 22.3 24.75 33 25.724999999999998 25.825 23.875 24.575 34 27.05 23.425 24.175 25.35 35 27.700000000000003 24.625 22.425 25.25 36 24.825 25.45 24.825 24.9 37 26.75 24.275 22.55 26.424999999999997 38 26.75 25.05 23.05 25.15 39 25.45 25.1 24.175 25.275 40 27.875 23.200000000000003 23.75 25.174999999999997 41 27.125 25.025 22.775000000000002 25.074999999999996 42 26.950000000000003 24.9 23.799999999999997 24.349999999999998 43 26.8 24.375 22.875 25.95 44 26.650000000000002 24.725 23.05 25.575 45 26.125 25.374999999999996 24.0 24.5 46 26.25 24.775 23.150000000000002 25.825 47 26.724999999999998 24.9 23.525 24.85 48 26.775 24.2 24.025 25.0 49 26.474999999999998 24.0 23.1 26.424999999999997 50 26.974999999999998 25.674999999999997 22.975 24.375 51 25.0 25.874999999999996 23.599999999999998 25.525 52 26.724999999999998 24.4 23.075000000000003 25.8 53 28.95 24.3 23.35 23.400000000000002 54 25.324999999999996 25.775 23.525 25.374999999999996 55 27.05 24.0 23.674999999999997 25.275 56 27.200000000000003 24.6 23.400000000000002 24.8 57 25.5 25.624999999999996 25.224999999999998 23.65 58 26.650000000000002 23.425 24.875 25.05 59 28.275 22.900000000000002 23.724999999999998 25.1 60 26.200000000000003 25.05 23.525 25.224999999999998 61 26.275 25.1 23.200000000000003 25.424999999999997 62 28.075 23.400000000000002 24.0 24.525 63 25.724999999999998 24.525 25.525 24.224999999999998 64 27.375 23.425 23.325000000000003 25.874999999999996 65 27.970978233675257 24.143107330497873 24.243182386790092 23.642732049036777 66 28.0561122244489 22.62024048096192 25.0 24.32364729458918 67 27.04133064516129 22.90826612903226 23.563508064516128 26.486895161290324 68 27.572016460905353 23.73971193415638 23.01954732510288 25.66872427983539 69 26.374236535258188 19.239311493614657 26.790671848972792 27.595780122154355 70 27.755252488020645 0.0 35.16402506450424 37.08072244747512 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 3.5 27 4.0 28 5.5 29 10.5 30 14.0 31 14.0 32 17.0 33 20.0 34 27.0 35 51.5 36 81.5 37 94.0 38 102.0 39 137.5 40 165.0 41 177.5 42 183.0 43 176.0 44 191.0 45 219.0 46 234.5 47 237.0 48 240.5 49 230.5 50 217.0 51 213.5 52 201.0 53 192.0 54 194.0 55 179.5 56 154.0 57 145.0 58 140.0 59 126.5 60 118.0 61 114.0 62 108.5 63 107.0 64 108.0 65 102.5 66 88.0 67 80.0 68 78.5 69 63.0 70 49.0 71 49.5 72 49.5 73 49.0 74 39.0 75 22.0 76 12.5 77 10.0 78 9.0 79 9.0 80 10.0 81 6.0 82 1.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.075 66 0.2 67 0.8 68 2.8000000000000003 69 9.950000000000001 70 32.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303731 spots for ERR5052709.sra Written 303731 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra Read 303723 spots for ERR5052709.sra Written 303723 spots for ERR5052709.sra SRR ids: ['ERR5052709.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u1tawv9e ERR5052709.sra spots: 6074468 blocks: [[1, 303723], [303724, 607446], [607447, 911169], [911170, 1214892], [1214893, 1518615], [1518616, 1822338], [1822339, 2126061], [2126062, 2429784], [2429785, 2733507], [2733508, 3037230], [3037231, 3340953], [3340954, 3644676], [3644677, 3948399], [3948400, 4252122], [4252123, 4555845], [4555846, 4859568], [4859569, 5163291], [5163292, 5467014], [5467015, 5770737], [5770738, 6074468]] ERR5052709 file size 1077472 ERR5052709 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052709 ERR5052709_1.fastq ERR5052709_2.fastq Input file: ERR5052709_1.fastq Paired file: ERR5052709_2.fastq trimmed: ERR5052709-trimmed-pair1.fastq, ERR5052709-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:44:08 2024 >> started Tue Dec 10 05:44:14 2024 >> done (5.852s) 6074468 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 8 ( 0.00%) empty read pairs filtered out after trimming by size control 6074460 (100.00%) read pairs available; of these: 22 ( 0.00%) trimmed read pairs available after processing 6074438 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 61 1 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 21 0.00% 70 6074438 100.00% 6074460 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=15 prefix-density=0.13 prefix-fanout=3.3 sequence=TGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=141.08 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.5 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.17 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=208.12 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=23.2 sequence=CGCCGCCGCCGT ERR5052709 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:45:51 Started mapping on | Dec 10 05:45:51 Finished on | Dec 10 05:46:51 Mapping speed, Million of reads per hour | 364.47 Number of input reads | 6074460 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4933670 Uniquely mapped reads % | 81.22% Average mapped length | 138.78 Number of splices: Total | 2379368 Number of splices: Annotated (sjdb) | 2268530 Number of splices: GT/AG | 2346273 Number of splices: GC/AG | 29714 Number of splices: AT/AC | 1066 Number of splices: Non-canonical | 2315 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.86 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 119412 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 34379 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.37% % of reads unmapped: other | 1.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1021378 1021378 1021378 N_multimapping 119412 119412 119412 N_noFeature 173036 4816060 202460 N_ambiguous 105166 417 17157 UnstrandedReadsAssigned:4655468 PositiveStrandReadsAssigned:117193 NegativeStrandReadsAssigned:4714053 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052709 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052709-trimmed-pair1.fastq ERR5052709-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,074,460 reads, 4,782,090 reads pseudoaligned [quant] estimated average fragment length: 193.433 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52973 ERR5052709.ke.tsv 35125 ERR5052709.se.tsv 88098 total ==> ERR5052709.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.815 4.7952e-08 2.03221e-08 PNS24247 1044 851.567 25.179 9.32064 PNS24249 1928 1735.57 31.6001 5.73948 PNS24246 1044 851.567 25.179 9.32064 PNS24248 1044 851.567 25.179 9.32064 PNS24244 1471 1278.57 13.8629 3.41789 PNS24243 293 116.402 0 0 KQK14069 1603 1410.57 4569.6 1021.2 KQK14071 474 284.516 213.232 236.25 ==> ERR5052709.se.tsv <== BRADI_1g14170v3 5188 BRADI_1g53295v3 19 BRADI_1g59795v3 184 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 219 BRADI_1g74790v3 178 BRADI_1g09890v3 0 BRADI_1g77505v3 116 BRADI_1g48960v3 0 ERR5052709 completed mapping pipeline successfully