Starting /dee2/code/volunteer_pipeline.sh ERR5052710 current disk space = 1525841612800 free memory = 1602354428 ERR5052710 SRAfilesize 911d10c8554d8e3e3e5261ec065dd220 ERR5052710.sra ERR5052710.sra file validated ERR5052710 is paired end ERR5052710 is conventional basespace ERR5052710 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.17125 35.0 35.0 35.0 34.0 35.0 2 34.5655 35.0 35.0 35.0 35.0 35.0 3 34.646 35.0 35.0 35.0 35.0 35.0 4 34.65325 35.0 35.0 35.0 35.0 35.0 5 34.65375 35.0 35.0 35.0 35.0 35.0 6 39.50325 40.0 40.0 40.0 39.0 40.0 7 39.45225 40.0 40.0 40.0 39.0 40.0 8 39.42975 40.0 40.0 40.0 39.0 40.0 9 39.46475 40.0 40.0 40.0 39.0 40.0 10 39.4665 40.0 40.0 40.0 39.0 40.0 11 39.4245 40.0 40.0 40.0 39.0 40.0 12 39.42325 40.0 40.0 40.0 39.0 40.0 13 39.43975 40.0 40.0 40.0 39.0 40.0 14 39.418 40.0 40.0 40.0 39.0 40.0 15 39.407 40.0 40.0 40.0 39.0 40.0 16 39.355 40.0 40.0 40.0 39.0 40.0 17 39.39575 40.0 40.0 40.0 39.0 40.0 18 39.4495 40.0 40.0 40.0 39.0 40.0 19 39.43025 40.0 40.0 40.0 39.0 40.0 20 39.3935 40.0 40.0 40.0 39.0 40.0 21 39.41475 40.0 40.0 40.0 39.0 40.0 22 39.42 40.0 40.0 40.0 39.0 40.0 23 39.3585 40.0 40.0 40.0 39.0 40.0 24 39.3325 40.0 40.0 40.0 39.0 40.0 25 39.343 40.0 40.0 40.0 39.0 40.0 26 39.3485 40.0 40.0 40.0 39.0 40.0 27 39.367 40.0 40.0 40.0 39.0 40.0 28 39.39425 40.0 40.0 40.0 39.0 40.0 29 39.42925 40.0 40.0 40.0 39.0 40.0 30 39.43375 40.0 40.0 40.0 39.0 40.0 31 39.35975 40.0 40.0 40.0 39.0 40.0 32 39.356 40.0 40.0 40.0 39.0 40.0 33 39.42575 40.0 40.0 40.0 39.0 40.0 34 39.3625 40.0 40.0 40.0 39.0 40.0 35 39.40325 40.0 40.0 40.0 39.0 40.0 36 39.35275 40.0 40.0 40.0 39.0 40.0 37 39.36225 40.0 40.0 40.0 39.0 40.0 38 39.347 40.0 40.0 40.0 39.0 40.0 39 39.3795 40.0 40.0 40.0 39.0 40.0 40 39.37325 40.0 40.0 40.0 39.0 40.0 41 39.335 40.0 40.0 40.0 39.0 40.0 42 39.324 40.0 40.0 40.0 39.0 40.0 43 39.3675 40.0 40.0 40.0 39.0 40.0 44 39.326 40.0 40.0 40.0 39.0 40.0 45 39.321 40.0 40.0 40.0 39.0 40.0 46 39.36825 40.0 40.0 40.0 39.0 40.0 47 39.4005 40.0 40.0 40.0 39.0 40.0 48 39.387 40.0 40.0 40.0 39.0 40.0 49 39.371 40.0 40.0 40.0 39.0 40.0 50 39.37575 40.0 40.0 40.0 39.0 40.0 51 39.3655 40.0 40.0 40.0 39.0 40.0 52 39.38525 40.0 40.0 40.0 39.0 40.0 53 39.37725 40.0 40.0 40.0 39.0 40.0 54 39.32775 40.0 40.0 40.0 39.0 40.0 55 39.31925 40.0 40.0 40.0 39.0 40.0 56 39.33125 40.0 40.0 40.0 39.0 40.0 57 39.302 40.0 40.0 40.0 39.0 40.0 58 39.304 40.0 40.0 40.0 39.0 40.0 59 39.252 40.0 40.0 40.0 39.0 40.0 60 39.2945 40.0 40.0 40.0 39.0 40.0 61 39.24375 40.0 40.0 40.0 39.0 40.0 62 39.2785 40.0 40.0 40.0 39.0 40.0 63 39.3625 40.0 40.0 40.0 39.0 40.0 64 39.35 40.0 40.0 40.0 39.0 40.0 65 39.33375 40.0 40.0 40.0 39.0 40.0 66 39.284 40.0 40.0 40.0 39.0 40.0 67 39.309 40.0 40.0 40.0 39.0 40.0 68 39.29675 40.0 40.0 40.0 39.0 40.0 69 39.2995 40.0 40.0 40.0 39.0 40.0 70 39.34375 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 4.0 26 3.0 27 8.0 28 12.0 29 5.0 30 25.0 31 15.0 32 23.0 33 30.0 34 40.0 35 52.0 36 77.0 37 110.0 38 253.0 39 3342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.33333333333333 10.553018772196854 10.603754439370878 45.50989345509893 2 23.375 13.0 35.6 28.025 3 21.575 19.1 22.45 36.875 4 27.250000000000004 25.074999999999996 21.525 26.150000000000002 5 25.724999999999998 29.825000000000003 23.0 21.45 6 20.875 29.95 25.25 23.925 7 18.099999999999998 23.95 38.75 19.2 8 20.125 21.975 30.725 27.175 9 19.85 21.099999999999998 33.2 25.85 10 24.4 32.975 22.650000000000002 19.975 11 26.0 23.425 22.075 28.499999999999996 12 23.200000000000003 21.625 25.775 29.4 13 23.7 24.075 25.55 26.674999999999997 14 23.05 23.95 27.175 25.825 15 22.35 24.349999999999998 26.224999999999998 27.075 16 23.5 23.9 25.2 27.400000000000002 17 24.099999999999998 23.625 26.6 25.674999999999997 18 24.4 24.05 25.45 26.1 19 24.125 26.25 24.85 24.775 20 24.25 24.325 24.55 26.875 21 23.375 25.124999999999996 25.1 26.400000000000002 22 23.35 26.075 24.425 26.150000000000002 23 24.85 24.65 24.825 25.674999999999997 24 23.25 23.599999999999998 25.074999999999996 28.075 25 23.825 25.575 24.3 26.3 26 23.674999999999997 25.05 25.3 25.974999999999998 27 23.75 24.05 25.324999999999996 26.875 28 23.724999999999998 25.074999999999996 24.775 26.424999999999997 29 23.625 25.1 25.25 26.025 30 24.0 24.9 24.725 26.375 31 23.325000000000003 25.5 25.124999999999996 26.05 32 24.025 25.15 25.874999999999996 24.95 33 23.95 23.849999999999998 26.25 25.95 34 23.724999999999998 23.674999999999997 25.224999999999998 27.375 35 23.95 23.9 25.7 26.450000000000003 36 24.3 23.875 25.124999999999996 26.700000000000003 37 22.925 24.099999999999998 25.124999999999996 27.85 38 24.55 24.5 25.1 25.85 39 23.875 25.0 24.8 26.325 40 23.200000000000003 25.674999999999997 25.474999999999998 25.650000000000002 41 23.95 23.0 26.724999999999998 26.325 42 24.25 24.15 24.75 26.85 43 23.45 24.975 25.674999999999997 25.900000000000002 44 23.799999999999997 25.624999999999996 24.675 25.900000000000002 45 23.625 24.575 24.5 27.3 46 23.5 24.125 25.3 27.075 47 23.400000000000002 25.05 26.200000000000003 25.35 48 24.099999999999998 24.625 24.975 26.3 49 23.150000000000002 24.9 25.324999999999996 26.625 50 24.3 24.075 25.924999999999997 25.7 51 25.424999999999997 24.0 24.349999999999998 26.224999999999998 52 24.349999999999998 24.25 24.5 26.900000000000002 53 24.0 24.675 25.474999999999998 25.85 54 24.775 24.875 25.05 25.3 55 25.224999999999998 25.25 23.325000000000003 26.200000000000003 56 23.7 24.075 25.825 26.400000000000002 57 24.099999999999998 24.4 25.674999999999997 25.825 58 23.9 23.95 24.775 27.375 59 24.349999999999998 24.5 24.425 26.724999999999998 60 24.656164041010253 24.306076519129782 25.006251562890725 26.03150787696924 61 24.33108277069267 25.70642660665166 24.18104526131533 25.78144536134033 62 23.655913978494624 24.33108277069267 25.131282820705174 26.881720430107524 63 26.006501625406354 23.905976494123532 24.33108277069267 25.756439109777446 64 23.980995248812203 23.905976494123532 25.581395348837212 26.531632908227053 65 25.075075075075077 24.774774774774773 24.824824824824827 25.325325325325327 66 25.119077463023316 24.69290549009777 24.442216094259212 25.745800952619703 67 23.862207694241892 24.69197887855167 24.767412622579833 26.6784008046266 68 23.70237790846331 23.267706468933778 25.901304014318587 27.128611608284324 69 25.254470426409902 18.459422283356258 28.170563961485556 28.11554332874828 70 27.59882869692533 0.0 35.35871156661786 37.042459736456806 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 3.0 28 4.0 29 8.5 30 12.0 31 16.0 32 22.0 33 24.0 34 40.0 35 58.0 36 92.0 37 124.0 38 140.5 39 174.0 40 191.0 41 192.0 42 208.5 43 224.0 44 228.5 45 231.0 46 235.5 47 242.0 48 246.5 49 245.0 50 239.0 51 222.0 52 191.0 53 177.0 54 173.0 55 166.0 56 151.5 57 140.0 58 126.5 59 123.0 60 133.0 61 123.5 62 100.5 63 87.0 64 85.5 65 76.5 66 68.0 67 67.0 68 66.0 69 57.5 70 50.0 71 39.0 72 28.5 73 29.0 74 25.0 75 15.5 76 7.5 77 5.0 78 4.5 79 3.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.1 66 0.27499999999999997 67 0.575 68 2.225 69 9.125 70 31.7 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052710 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052710_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.511 35.0 35.0 35.0 35.0 35.0 2 34.42575 35.0 35.0 35.0 34.0 35.0 3 34.40075 35.0 35.0 35.0 34.0 35.0 4 34.35275 35.0 35.0 35.0 34.0 35.0 5 34.33075 35.0 35.0 35.0 34.0 35.0 6 39.13275 40.0 40.0 40.0 39.0 40.0 7 39.10425 40.0 40.0 40.0 39.0 40.0 8 39.1325 40.0 40.0 40.0 39.0 40.0 9 39.10875 40.0 40.0 40.0 39.0 40.0 10 39.13825 40.0 40.0 40.0 39.0 40.0 11 39.11425 40.0 40.0 40.0 39.0 40.0 12 39.163 40.0 40.0 40.0 39.0 40.0 13 39.12075 40.0 40.0 40.0 39.0 40.0 14 39.1125 40.0 40.0 40.0 39.0 40.0 15 39.1305 40.0 40.0 40.0 39.0 40.0 16 39.19825 40.0 40.0 40.0 39.0 40.0 17 39.20975 40.0 40.0 40.0 39.0 40.0 18 39.11575 40.0 40.0 40.0 39.0 40.0 19 39.16575 40.0 40.0 40.0 39.0 40.0 20 39.116 40.0 40.0 40.0 39.0 40.0 21 39.11925 40.0 40.0 40.0 39.0 40.0 22 39.064 40.0 40.0 40.0 39.0 40.0 23 39.1155 40.0 40.0 40.0 39.0 40.0 24 39.143 40.0 40.0 40.0 39.0 40.0 25 39.13975 40.0 40.0 40.0 39.0 40.0 26 39.1205 40.0 40.0 40.0 39.0 40.0 27 39.0735 40.0 40.0 40.0 39.0 40.0 28 39.10375 40.0 40.0 40.0 39.0 40.0 29 39.105 40.0 40.0 40.0 39.0 40.0 30 39.06625 40.0 40.0 40.0 39.0 40.0 31 39.0685 40.0 40.0 40.0 39.0 40.0 32 39.15925 40.0 40.0 40.0 39.0 40.0 33 39.1195 40.0 40.0 40.0 39.0 40.0 34 39.134 40.0 40.0 40.0 39.0 40.0 35 39.0865 40.0 40.0 40.0 39.0 40.0 36 38.9575 40.0 40.0 40.0 39.0 40.0 37 39.035 40.0 40.0 40.0 39.0 40.0 38 39.053 40.0 40.0 40.0 39.0 40.0 39 39.01775 40.0 40.0 40.0 39.0 40.0 40 39.05 40.0 40.0 40.0 39.0 40.0 41 39.0135 40.0 40.0 40.0 39.0 40.0 42 39.0275 40.0 40.0 40.0 39.0 40.0 43 39.05275 40.0 40.0 40.0 39.0 40.0 44 39.0895 40.0 40.0 40.0 39.0 40.0 45 38.97275 40.0 40.0 40.0 39.0 40.0 46 39.02475 40.0 40.0 40.0 39.0 40.0 47 39.099 40.0 40.0 40.0 39.0 40.0 48 39.07275 40.0 40.0 40.0 39.0 40.0 49 39.02275 40.0 40.0 40.0 39.0 40.0 50 39.07275 40.0 40.0 40.0 39.0 40.0 51 39.0105 40.0 40.0 40.0 39.0 40.0 52 38.9225 40.0 40.0 40.0 38.0 40.0 53 38.943 40.0 40.0 40.0 39.0 40.0 54 38.93375 40.0 40.0 40.0 38.0 40.0 55 39.03825 40.0 40.0 40.0 39.0 40.0 56 38.98475 40.0 40.0 40.0 39.0 40.0 57 38.9975 40.0 40.0 40.0 39.0 40.0 58 39.02 40.0 40.0 40.0 39.0 40.0 59 38.996 40.0 40.0 40.0 39.0 40.0 60 38.9835 40.0 40.0 40.0 39.0 40.0 61 39.009 40.0 40.0 40.0 39.0 40.0 62 39.01725 40.0 40.0 40.0 39.0 40.0 63 38.91875 40.0 40.0 40.0 38.0 40.0 64 38.979 40.0 40.0 40.0 38.0 40.0 65 38.989 40.0 40.0 40.0 39.0 40.0 66 38.8775 40.0 40.0 40.0 38.0 40.0 67 38.9865 40.0 40.0 40.0 38.0 40.0 68 38.94275 40.0 40.0 40.0 38.0 40.0 69 38.9705 40.0 40.0 40.0 39.0 40.0 70 38.845 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 5.0 19 11.0 20 3.0 21 8.0 22 9.0 23 10.0 24 9.0 25 12.0 26 14.0 27 8.0 28 12.0 29 14.0 30 14.0 31 21.0 32 21.0 33 28.0 34 41.0 35 42.0 36 73.0 37 103.0 38 214.0 39 3326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.15 17.2 13.750000000000002 37.9 2 29.325000000000003 23.200000000000003 27.1 20.375 3 20.95 25.1 27.675 26.275 4 25.05 30.5 19.625 24.825 5 26.625 33.324999999999996 20.474999999999998 19.575 6 22.525000000000002 33.925 21.325 22.225 7 22.650000000000002 17.8 34.35 25.2 8 23.05 21.275 25.8 29.875 9 22.8 21.575 27.825 27.800000000000004 10 24.975 31.275 21.4 22.35 11 28.325 22.475 19.7 29.5 12 27.1 20.65 23.674999999999997 28.575 13 23.400000000000002 24.925 24.85 26.825 14 25.5 25.900000000000002 23.95 24.65 15 24.725 25.4 24.375 25.5 16 23.75 24.075 24.625 27.55 17 26.325 25.1 23.425 25.15 18 26.375 26.275 22.525000000000002 24.825 19 25.624999999999996 23.625 24.925 25.825 20 26.85 24.375 22.575 26.200000000000003 21 24.925 25.5 23.65 25.924999999999997 22 24.775 24.55 23.5 27.175 23 26.174999999999997 25.724999999999998 23.625 24.474999999999998 24 25.5 25.4 23.325000000000003 25.775 25 26.525 22.900000000000002 23.875 26.700000000000003 26 26.950000000000003 24.425 23.724999999999998 24.9 27 24.625 25.624999999999996 24.825 24.925 28 24.4 24.9 23.974999999999998 26.724999999999998 29 26.474999999999998 26.0 23.025000000000002 24.5 30 25.575 25.1 23.849999999999998 25.474999999999998 31 25.775 24.95 24.05 25.224999999999998 32 27.3 24.325 23.225 25.15 33 25.85 26.0 23.05 25.1 34 26.200000000000003 25.525 23.05 25.224999999999998 35 27.025 25.1 22.625 25.25 36 25.95 25.05 23.5 25.5 37 25.674999999999997 24.025 24.55 25.75 38 25.924999999999997 25.825 23.674999999999997 24.575 39 24.975 25.05 24.875 25.1 40 26.05 25.025 23.65 25.275 41 26.625 25.724999999999998 22.7 24.95 42 24.75 25.7 23.625 25.924999999999997 43 25.324999999999996 25.0 25.25 24.425 44 26.25 24.75 22.8 26.200000000000003 45 26.700000000000003 26.325 23.400000000000002 23.575 46 25.95 24.85 23.95 25.25 47 26.1 24.6 24.349999999999998 24.95 48 24.55 25.124999999999996 25.474999999999998 24.85 49 26.8 25.124999999999996 23.125 24.95 50 25.924999999999997 25.174999999999997 24.575 24.325 51 26.5 25.4 24.099999999999998 24.0 52 26.575 24.349999999999998 23.325000000000003 25.75 53 27.900000000000002 25.474999999999998 23.599999999999998 23.025000000000002 54 26.674999999999997 24.45 24.65 24.224999999999998 55 26.1 24.65 23.625 25.624999999999996 56 26.275 25.25 24.5 23.974999999999998 57 26.224999999999998 24.925 23.45 25.4 58 26.825 25.2 23.5 24.474999999999998 59 26.75 25.05 24.85 23.35 60 26.531632908227053 24.23105776444111 25.081270317579396 24.15603900975244 61 26.531632908227053 24.831207801950487 23.25581395348837 25.381345336334082 62 27.081770442610654 24.50612653163291 23.030757689422355 25.381345336334082 63 24.431107776944234 26.456614153538382 24.256064016004 24.85621405351338 64 26.481620405101275 23.905976494123532 24.20605151287822 25.406351587896975 65 27.347858752817427 24.61808164287503 23.56624092161282 24.467818682694716 66 25.031351893654374 24.830699774266364 23.80235766240281 26.33559066967645 67 25.75107296137339 25.826811411259783 25.145165362282253 23.276950265084576 68 27.495486200670623 23.549135929842663 24.47768893474336 24.47768893474336 69 27.647714604236345 18.67335562987737 26.755852842809364 26.923076923076923 70 29.342202512934218 0.0 34.66371027346637 35.99408721359941 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 1.0 23 0.0 24 0.5 25 0.5 26 1.5 27 3.0 28 4.0 29 8.0 30 11.0 31 13.5 32 17.5 33 19.0 34 38.5 35 66.5 36 85.0 37 95.0 38 112.0 39 141.5 40 154.0 41 172.5 42 208.5 43 226.0 44 243.0 45 246.5 46 229.5 47 226.0 48 227.0 49 216.0 50 204.0 51 188.5 52 189.5 53 206.0 54 192.0 55 169.5 56 150.5 57 140.0 58 140.5 59 132.5 60 124.0 61 111.5 62 98.5 63 98.0 64 98.0 65 97.0 66 88.5 67 81.0 68 75.0 69 63.5 70 58.0 71 55.5 72 47.5 73 42.0 74 29.5 75 15.0 76 9.0 77 5.0 78 5.5 79 3.5 80 1.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.17500000000000002 66 0.325 67 0.975 68 3.075 69 10.299999999999999 70 32.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra Read 281629 spots for ERR5052710.sra Written 281629 spots for ERR5052710.sra Read 281618 spots for ERR5052710.sra Written 281618 spots for ERR5052710.sra SRR ids: ['ERR5052710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e1n04xgb ERR5052710.sra spots: 5632371 blocks: [[1, 281618], [281619, 563236], [563237, 844854], [844855, 1126472], [1126473, 1408090], [1408091, 1689708], [1689709, 1971326], [1971327, 2252944], [2252945, 2534562], [2534563, 2816180], [2816181, 3097798], [3097799, 3379416], [3379417, 3661034], [3661035, 3942652], [3942653, 4224270], [4224271, 4505888], [4505889, 4787506], [4787507, 5069124], [5069125, 5350742], [5350743, 5632371]] ERR5052710 file size 998896 ERR5052710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052710 ERR5052710_1.fastq ERR5052710_2.fastq Input file: ERR5052710_1.fastq Paired file: ERR5052710_2.fastq trimmed: ERR5052710-trimmed-pair1.fastq, ERR5052710-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:44:09 2024 >> started Tue Dec 10 05:44:15 2024 >> done (6.057s) 5632371 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 30 ( 0.00%) empty read pairs filtered out after trimming by size control 5632341 (100.00%) read pairs available; of these: 17 ( 0.00%) trimmed read pairs available after processing 5632324 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 15 0.00% 70 5632324 100.00% 5632341 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=22 prefix-density=0.17 prefix-fanout=3.2 sequence=TGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=302.53 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.2 sequence=GCCGCCGCCCGGGAGCGCGCCCGGCCACACCGTGTAGCTGCACTTGTTTACGACGGTGATTGTGGCCGCGTCGGAGAAGAAGGCGGAGAGGAGGACGGCGAGGAGAGGGATGAGGATCACACGAGCAGAGGACGCC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.14 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=193.46 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=21.3 sequence=CGCCGCCGCCGTC ERR5052710 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:44:52 Started mapping on | Dec 10 05:44:53 Finished on | Dec 10 05:45:50 Mapping speed, Million of reads per hour | 355.73 Number of input reads | 5632341 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4673537 Uniquely mapped reads % | 82.98% Average mapped length | 138.78 Number of splices: Total | 2233447 Number of splices: Annotated (sjdb) | 2130987 Number of splices: GT/AG | 2201842 Number of splices: GC/AG | 28604 Number of splices: AT/AC | 990 Number of splices: Non-canonical | 2011 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 59669 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 10552 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.21% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 899135 899135 899135 N_multimapping 59669 59669 59669 N_noFeature 136608 4560842 163175 N_ambiguous 101260 382 15328 UnstrandedReadsAssigned:4435669 PositiveStrandReadsAssigned:112313 NegativeStrandReadsAssigned:4495034 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052710 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052710-trimmed-pair1.fastq ERR5052710-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,632,341 reads, 4,570,793 reads pseudoaligned [quant] estimated average fragment length: 187.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52973 ERR5052710.ke.tsv 35125 ERR5052710.se.tsv 88098 total ==> ERR5052710.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.17 0 0 PNS24247 1044 857.916 21.1527 8.08133 PNS24249 1928 1741.92 27.5196 5.17819 PNS24246 1044 857.916 21.1527 8.08133 PNS24248 1044 857.916 21.1527 8.08133 PNS24244 1471 1284.92 26.0223 6.63795 PNS24243 293 122.069 0 0 KQK14069 1603 1416.92 5057.49 1169.91 KQK14071 474 290.875 172.897 194.825 ==> ERR5052710.se.tsv <== BRADI_1g14170v3 5615 BRADI_1g53295v3 21 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 170 BRADI_1g74790v3 189 BRADI_1g09890v3 0 BRADI_1g77505v3 108 BRADI_1g48960v3 0 ERR5052710 completed mapping pipeline successfully