Starting /dee2/code/volunteer_pipeline.sh ERR5052711 current disk space = 1525793878016 free memory = 1561565924 ERR5052711 SRAfilesize 1a8a0a43d4cfd5658a42dabd5568342e ERR5052711.sra ERR5052711.sra file validated ERR5052711 is paired end ERR5052711 is conventional basespace ERR5052711 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.29 35.0 35.0 35.0 34.0 35.0 2 34.62225 35.0 35.0 35.0 35.0 35.0 3 34.60975 35.0 35.0 35.0 35.0 35.0 4 34.717 35.0 35.0 35.0 35.0 35.0 5 34.661 35.0 35.0 35.0 35.0 35.0 6 39.467 40.0 40.0 40.0 39.0 40.0 7 39.474 40.0 40.0 40.0 39.0 40.0 8 39.371 40.0 40.0 40.0 39.0 40.0 9 39.41125 40.0 40.0 40.0 39.0 40.0 10 39.46675 40.0 40.0 40.0 39.0 40.0 11 39.43575 40.0 40.0 40.0 39.0 40.0 12 39.4055 40.0 40.0 40.0 39.0 40.0 13 39.42475 40.0 40.0 40.0 39.0 40.0 14 39.3825 40.0 40.0 40.0 39.0 40.0 15 39.3745 40.0 40.0 40.0 39.0 40.0 16 39.42375 40.0 40.0 40.0 39.0 40.0 17 39.4095 40.0 40.0 40.0 39.0 40.0 18 39.38 40.0 40.0 40.0 39.0 40.0 19 39.4115 40.0 40.0 40.0 39.0 40.0 20 39.4275 40.0 40.0 40.0 39.0 40.0 21 39.4 40.0 40.0 40.0 39.0 40.0 22 39.35675 40.0 40.0 40.0 39.0 40.0 23 39.36825 40.0 40.0 40.0 39.0 40.0 24 39.34975 40.0 40.0 40.0 39.0 40.0 25 39.3315 40.0 40.0 40.0 39.0 40.0 26 39.35925 40.0 40.0 40.0 39.0 40.0 27 39.32175 40.0 40.0 40.0 39.0 40.0 28 39.367 40.0 40.0 40.0 39.0 40.0 29 39.3105 40.0 40.0 40.0 39.0 40.0 30 39.3525 40.0 40.0 40.0 39.0 40.0 31 39.311 40.0 40.0 40.0 39.0 40.0 32 39.3615 40.0 40.0 40.0 39.0 40.0 33 39.32825 40.0 40.0 40.0 39.0 40.0 34 39.3485 40.0 40.0 40.0 39.0 40.0 35 39.3515 40.0 40.0 40.0 39.0 40.0 36 39.363 40.0 40.0 40.0 39.0 40.0 37 39.39925 40.0 40.0 40.0 39.0 40.0 38 39.3025 40.0 40.0 40.0 39.0 40.0 39 39.307 40.0 40.0 40.0 39.0 40.0 40 39.31825 40.0 40.0 40.0 39.0 40.0 41 39.2905 40.0 40.0 40.0 39.0 40.0 42 39.3345 40.0 40.0 40.0 39.0 40.0 43 39.34125 40.0 40.0 40.0 39.0 40.0 44 39.35075 40.0 40.0 40.0 39.0 40.0 45 39.313 40.0 40.0 40.0 39.0 40.0 46 39.28 40.0 40.0 40.0 39.0 40.0 47 39.23525 40.0 40.0 40.0 39.0 40.0 48 39.32175 40.0 40.0 40.0 39.0 40.0 49 39.31025 40.0 40.0 40.0 39.0 40.0 50 39.347 40.0 40.0 40.0 39.0 40.0 51 39.344 40.0 40.0 40.0 39.0 40.0 52 39.353 40.0 40.0 40.0 39.0 40.0 53 39.39725 40.0 40.0 40.0 39.0 40.0 54 39.27775 40.0 40.0 40.0 39.0 40.0 55 39.288 40.0 40.0 40.0 39.0 40.0 56 39.294 40.0 40.0 40.0 39.0 40.0 57 39.198 40.0 40.0 40.0 39.0 40.0 58 39.15725 40.0 40.0 40.0 39.0 40.0 59 39.27925 40.0 40.0 40.0 39.0 40.0 60 39.33475 40.0 40.0 40.0 39.0 40.0 61 39.26075 40.0 40.0 40.0 39.0 40.0 62 39.3115 40.0 40.0 40.0 39.0 40.0 63 39.31725 40.0 40.0 40.0 39.0 40.0 64 39.283 40.0 40.0 40.0 39.0 40.0 65 39.323 40.0 40.0 40.0 39.0 40.0 66 39.2925 40.0 40.0 40.0 39.0 40.0 67 39.28575 40.0 40.0 40.0 39.0 40.0 68 39.2785 40.0 40.0 40.0 39.0 40.0 69 39.29425 40.0 40.0 40.0 39.0 40.0 70 39.26225 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 2.0 26 2.0 27 7.0 28 10.0 29 12.0 30 19.0 31 24.0 32 30.0 33 37.0 34 32.0 35 43.0 36 57.0 37 132.0 38 266.0 39 3323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.09595959595959 10.328282828282829 9.595959595959595 47.97979797979798 2 22.0 12.5 35.825 29.675 3 21.5 18.35 24.125 36.025 4 26.125 24.425 20.525 28.925 5 25.224999999999998 31.025000000000002 23.474999999999998 20.275000000000002 6 22.175 30.475 24.875 22.475 7 20.025000000000002 22.55 36.525 20.9 8 19.625 21.0 31.175000000000004 28.199999999999996 9 19.35 21.7 33.125 25.825 10 24.425 31.225 22.175 22.175 11 25.1 23.599999999999998 22.35 28.95 12 24.775 21.525 25.374999999999996 28.325 13 23.35 23.925 25.3 27.425 14 23.35 25.35 26.125 25.174999999999997 15 22.775000000000002 23.875 26.150000000000002 27.200000000000003 16 24.275 24.474999999999998 24.625 26.625 17 25.174999999999997 23.674999999999997 25.424999999999997 25.724999999999998 18 22.55 24.325 25.5 27.625 19 24.55 24.375 24.6 26.474999999999998 20 25.2 24.25 25.35 25.2 21 22.925 24.4 25.4 27.275 22 25.224999999999998 24.55 24.224999999999998 26.0 23 23.150000000000002 25.3 26.85 24.7 24 23.775 24.5 25.275 26.450000000000003 25 25.174999999999997 23.35 24.725 26.75 26 24.175 25.55 25.75 24.525 27 23.25 23.599999999999998 25.85 27.3 28 24.95 24.45 23.45 27.150000000000002 29 23.575 25.95 25.5 24.975 30 22.825 25.25 24.175 27.750000000000004 31 25.1 24.375 23.175 27.35 32 23.3 25.8 25.2 25.7 33 24.474999999999998 23.05 25.8 26.674999999999997 34 24.925 23.5 25.8 25.775 35 23.875 24.474999999999998 26.0 25.650000000000002 36 23.175 23.849999999999998 26.0 26.974999999999998 37 24.725 24.75 23.974999999999998 26.55 38 24.95 24.175 25.75 25.124999999999996 39 24.425 24.65 25.2 25.724999999999998 40 22.95 24.775 23.400000000000002 28.875 41 24.925 24.474999999999998 25.85 24.75 42 23.7 25.1 24.4 26.8 43 23.724999999999998 24.55 25.424999999999997 26.3 44 26.125 24.5 24.2 25.174999999999997 45 23.425 25.374999999999996 26.474999999999998 24.725 46 23.724999999999998 23.625 24.75 27.900000000000002 47 24.175 25.7 24.325 25.8 48 23.125 24.275 26.150000000000002 26.450000000000003 49 24.725 24.3 23.799999999999997 27.175 50 24.375 25.25 25.474999999999998 24.9 51 23.125 25.1 25.05 26.724999999999998 52 25.1 25.074999999999996 23.075000000000003 26.75 53 24.525 25.45 25.2 24.825 54 25.275 23.65 24.7 26.375 55 24.875 24.5 24.05 26.575 56 24.224999999999998 25.650000000000002 24.65 25.474999999999998 57 23.974999999999998 25.775 24.0 26.25 58 24.525 24.224999999999998 23.625 27.625 59 25.23130782695674 27.081770442610654 23.980995248812203 23.705926481620406 60 22.9057264316079 23.980995248812203 26.30657664416104 26.806701675418854 61 25.506376594148538 24.50612653163291 23.55588897224306 26.431607901975497 62 23.48087021755439 25.206301575393848 24.90622655663916 26.406601650412604 63 25.03125781445361 24.256064016004 24.981245311327832 25.731432858214554 64 24.83741870935468 24.437218609304654 23.336668334167083 27.388694347173587 65 24.98122653316646 24.98122653316646 24.480600750938674 25.556946182728414 66 24.843319127600903 24.367009275507645 24.69290549009777 26.096766106793684 67 23.828715365239294 24.6095717884131 24.987405541561714 26.574307304785894 68 25.383828045035823 23.72057318321392 25.588536335721596 25.30706243602866 69 24.30727023319616 19.06721536351166 28.14814814814815 28.477366255144034 70 25.810014727540505 0.0 35.125184094256255 39.06480117820324 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 6.0 27 8.0 28 5.5 29 12.5 30 22.0 31 20.5 32 23.5 33 28.0 34 32.5 35 57.0 36 88.0 37 99.0 38 108.5 39 139.0 40 160.0 41 175.5 42 215.5 43 240.0 44 241.0 45 240.0 46 247.5 47 257.0 48 250.0 49 238.0 50 233.0 51 216.0 52 202.5 53 206.0 54 187.5 55 161.5 56 146.0 57 138.0 58 131.0 59 127.0 60 130.0 61 126.5 62 106.0 63 89.0 64 97.5 65 93.5 66 75.5 67 70.0 68 59.0 69 44.5 70 41.0 71 37.0 72 30.0 73 27.0 74 22.5 75 14.0 76 8.5 77 7.0 78 6.0 79 3.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.05 65 0.125 66 0.27499999999999997 67 0.75 68 2.3 69 8.875 70 32.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052711 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052711_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.47625 35.0 35.0 35.0 35.0 35.0 2 34.46475 35.0 35.0 35.0 34.0 35.0 3 34.36025 35.0 35.0 35.0 34.0 35.0 4 34.33825 35.0 35.0 35.0 34.0 35.0 5 34.3595 35.0 35.0 35.0 34.0 35.0 6 39.13675 40.0 40.0 40.0 39.0 40.0 7 39.11775 40.0 40.0 40.0 39.0 40.0 8 38.98875 40.0 40.0 40.0 39.0 40.0 9 39.04975 40.0 40.0 40.0 39.0 40.0 10 39.09025 40.0 40.0 40.0 39.0 40.0 11 39.0865 40.0 40.0 40.0 39.0 40.0 12 39.068 40.0 40.0 40.0 39.0 40.0 13 39.07375 40.0 40.0 40.0 39.0 40.0 14 39.0605 40.0 40.0 40.0 39.0 40.0 15 39.02675 40.0 40.0 40.0 39.0 40.0 16 39.07525 40.0 40.0 40.0 39.0 40.0 17 39.03325 40.0 40.0 40.0 39.0 40.0 18 39.061 40.0 40.0 40.0 39.0 40.0 19 39.08025 40.0 40.0 40.0 39.0 40.0 20 39.07025 40.0 40.0 40.0 39.0 40.0 21 39.13325 40.0 40.0 40.0 39.0 40.0 22 39.073 40.0 40.0 40.0 39.0 40.0 23 39.07225 40.0 40.0 40.0 39.0 40.0 24 39.0675 40.0 40.0 40.0 39.0 40.0 25 39.0575 40.0 40.0 40.0 39.0 40.0 26 39.09325 40.0 40.0 40.0 39.0 40.0 27 39.05475 40.0 40.0 40.0 39.0 40.0 28 38.97025 40.0 40.0 40.0 39.0 40.0 29 39.12575 40.0 40.0 40.0 39.0 40.0 30 39.06975 40.0 40.0 40.0 39.0 40.0 31 39.0645 40.0 40.0 40.0 39.0 40.0 32 39.137 40.0 40.0 40.0 39.0 40.0 33 39.0845 40.0 40.0 40.0 39.0 40.0 34 39.0345 40.0 40.0 40.0 39.0 40.0 35 39.0485 40.0 40.0 40.0 39.0 40.0 36 39.0195 40.0 40.0 40.0 39.0 40.0 37 39.0335 40.0 40.0 40.0 39.0 40.0 38 39.0165 40.0 40.0 40.0 39.0 40.0 39 39.02125 40.0 40.0 40.0 39.0 40.0 40 39.06175 40.0 40.0 40.0 39.0 40.0 41 39.07375 40.0 40.0 40.0 39.0 40.0 42 39.106 40.0 40.0 40.0 39.0 40.0 43 39.00625 40.0 40.0 40.0 39.0 40.0 44 39.00575 40.0 40.0 40.0 39.0 40.0 45 39.042 40.0 40.0 40.0 39.0 40.0 46 39.04525 40.0 40.0 40.0 39.0 40.0 47 38.9975 40.0 40.0 40.0 39.0 40.0 48 39.02225 40.0 40.0 40.0 39.0 40.0 49 39.0545 40.0 40.0 40.0 39.0 40.0 50 39.035 40.0 40.0 40.0 39.0 40.0 51 39.04275 40.0 40.0 40.0 39.0 40.0 52 38.995 40.0 40.0 40.0 39.0 40.0 53 38.99475 40.0 40.0 40.0 38.0 40.0 54 38.92375 40.0 40.0 40.0 38.0 40.0 55 38.912 40.0 40.0 40.0 38.0 40.0 56 38.92125 40.0 40.0 40.0 38.0 40.0 57 38.9975 40.0 40.0 40.0 39.0 40.0 58 38.942 40.0 40.0 40.0 39.0 40.0 59 38.9345 40.0 40.0 40.0 39.0 40.0 60 39.00825 40.0 40.0 40.0 39.0 40.0 61 38.997 40.0 40.0 40.0 39.0 40.0 62 38.9315 40.0 40.0 40.0 39.0 40.0 63 38.96275 40.0 40.0 40.0 39.0 40.0 64 38.92325 40.0 40.0 40.0 39.0 40.0 65 38.98875 40.0 40.0 40.0 38.0 40.0 66 39.004 40.0 40.0 40.0 39.0 40.0 67 38.92325 40.0 40.0 40.0 39.0 40.0 68 38.971 40.0 40.0 40.0 39.0 40.0 69 38.94925 40.0 40.0 40.0 39.0 40.0 70 38.92675 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 7.0 20 14.0 21 8.0 22 14.0 23 22.0 24 9.0 25 11.0 26 5.0 27 9.0 28 13.0 29 13.0 30 15.0 31 13.0 32 19.0 33 28.0 34 42.0 35 35.0 36 66.0 37 107.0 38 233.0 39 3315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.875 18.5 13.55 39.074999999999996 2 29.2 23.474999999999998 28.499999999999996 18.825 3 21.475 24.375 27.750000000000004 26.400000000000002 4 25.55 29.375 20.075000000000003 25.0 5 26.825 32.4 20.525 20.25 6 23.330832708177045 32.03300825206302 21.48037009252313 23.15578894723681 7 24.0 17.575 33.35 25.074999999999996 8 22.725 21.224999999999998 25.95 30.099999999999998 9 23.9 22.05 26.275 27.775 10 25.424999999999997 31.275 21.025 22.275 11 28.175 22.45 21.375 28.000000000000004 12 25.825 22.5 23.474999999999998 28.199999999999996 13 25.3 24.075 24.349999999999998 26.275 14 25.25 25.724999999999998 24.375 24.65 15 24.675 25.624999999999996 24.875 24.825 16 26.674999999999997 22.8 24.575 25.95 17 26.474999999999998 25.825 22.875 24.825 18 25.4 25.95 23.325000000000003 25.324999999999996 19 27.275 24.775 21.475 26.474999999999998 20 26.150000000000002 24.825 23.45 25.575 21 24.675 25.45 24.25 25.624999999999996 22 25.85 24.775 23.549999999999997 25.825 23 25.8 26.8 23.200000000000003 24.2 24 24.099999999999998 25.8 25.2 24.9 25 26.05 23.625 23.674999999999997 26.650000000000002 26 26.525 25.275 22.85 25.35 27 25.4 24.925 23.875 25.8 28 25.525 24.075 25.224999999999998 25.174999999999997 29 25.124999999999996 25.525 24.175 25.174999999999997 30 25.174999999999997 25.525 24.325 24.975 31 25.624999999999996 24.025 24.075 26.275 32 26.6 26.75 22.175 24.474999999999998 33 24.125 25.5 25.324999999999996 25.05 34 26.150000000000002 24.825 24.15 24.875 35 26.724999999999998 25.95 23.150000000000002 24.175 36 26.325 23.825 24.325 25.525 37 26.525 23.9 24.45 25.124999999999996 38 27.55 25.5 23.125 23.825 39 25.124999999999996 25.15 24.575 25.15 40 25.474999999999998 24.6 25.124999999999996 24.8 41 25.974999999999998 25.124999999999996 23.799999999999997 25.1 42 24.3 25.575 25.15 24.975 43 27.400000000000002 24.025 24.0 24.575 44 26.825 24.675 24.525 23.974999999999998 45 24.55 24.875 25.2 25.374999999999996 46 27.400000000000002 23.974999999999998 22.875 25.75 47 26.05 25.474999999999998 23.400000000000002 25.074999999999996 48 24.25 25.275 24.95 25.525 49 26.275 24.5 22.625 26.6 50 26.125 25.924999999999997 23.25 24.7 51 25.424999999999997 24.575 25.0 25.0 52 26.35 24.099999999999998 23.75 25.8 53 27.1 24.925 24.3 23.674999999999997 54 26.3 24.099999999999998 23.825 25.775 55 27.0 23.799999999999997 23.400000000000002 25.8 56 27.025 25.75 23.200000000000003 24.025 57 26.400000000000002 25.224999999999998 23.549999999999997 24.825 58 26.1 24.65 24.075 25.174999999999997 59 25.674999999999997 27.275 23.125 23.925 60 26.3 24.425 24.375 24.9 61 26.424999999999997 23.75 25.2 24.625 62 25.474999999999998 25.174999999999997 24.5 24.85 63 27.200000000000003 23.45 24.8 24.55 64 25.23130782695674 24.956239059764943 24.731182795698924 25.081270317579396 65 25.081351689612013 25.857321652065078 23.30413016270338 25.75719649561952 66 25.213246362267938 23.607626693426994 25.68991470145509 25.489212242849973 67 26.241492311570457 24.17443912276279 23.519032014116462 26.065036551550293 68 27.652982184353213 23.676736380067133 24.038213271365866 24.632068164213788 69 26.843575418994416 18.8268156424581 26.70391061452514 27.625698324022345 70 29.037037037037038 0.0 34.88888888888889 36.074074074074076 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 2.0 26 3.0 27 3.0 28 2.5 29 6.5 30 11.0 31 14.5 32 24.0 33 30.0 34 40.0 35 65.0 36 90.0 37 100.0 38 109.0 39 136.5 40 155.0 41 173.0 42 209.0 43 227.0 44 240.5 45 248.5 46 230.0 47 217.0 48 222.0 49 227.0 50 227.0 51 199.5 52 184.0 53 196.0 54 169.5 55 156.0 56 167.5 57 166.0 58 153.5 59 128.0 60 115.0 61 110.5 62 103.5 63 101.0 64 95.0 65 95.0 66 97.5 67 94.0 68 76.0 69 59.5 70 61.0 71 51.5 72 36.5 73 31.0 74 27.0 75 19.0 76 9.5 77 4.0 78 6.5 79 6.0 80 3.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.125 66 0.35000000000000003 67 0.8250000000000001 68 3.175 69 10.5 70 32.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289705 spots for ERR5052711.sra Written 289705 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra Read 289702 spots for ERR5052711.sra Written 289702 spots for ERR5052711.sra SRR ids: ['ERR5052711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9cve2h8s ERR5052711.sra spots: 5794043 blocks: [[1, 289702], [289703, 579404], [579405, 869106], [869107, 1158808], [1158809, 1448510], [1448511, 1738212], [1738213, 2027914], [2027915, 2317616], [2317617, 2607318], [2607319, 2897020], [2897021, 3186722], [3186723, 3476424], [3476425, 3766126], [3766127, 4055828], [4055829, 4345530], [4345531, 4635232], [4635233, 4924934], [4924935, 5214636], [5214637, 5504338], [5504339, 5794043]] ERR5052711 file size 1027631 ERR5052711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052711 ERR5052711_1.fastq ERR5052711_2.fastq Input file: ERR5052711_1.fastq Paired file: ERR5052711_2.fastq trimmed: ERR5052711-trimmed-pair1.fastq, ERR5052711-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:44:54 2024 >> started Tue Dec 10 05:44:59 2024 >> done (5.239s) 5794043 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 38 ( 0.00%) empty read pairs filtered out after trimming by size control 5794004 (100.00%) read pairs available; of these: 36 ( 0.00%) trimmed read pairs available after processing 5793968 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 35 0.00% 70 5793968 100.00% 5794004 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=18 prefix-density=0.17 prefix-fanout=3.2 sequence=TGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=289.36 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=14.1 sequence=GCCGCCGCCCGGGAGCGCGCCCGGCCACACCGTGTAGCTGCACTTGTTTACGACGGTGATTGTGGCCGCGTCGGAGAAGAAGGCGGAGAGGAGGACGGCGAGGAGAGGGATGAGGATCACACGAGCAGAGGACGCC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.14 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=258.47 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=21.8 sequence=CGCCGCCGCCATCCCC ERR5052711 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:45:36 Started mapping on | Dec 10 05:45:36 Finished on | Dec 10 05:46:33 Mapping speed, Million of reads per hour | 365.94 Number of input reads | 5794004 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4810292 Uniquely mapped reads % | 83.02% Average mapped length | 138.77 Number of splices: Total | 2302302 Number of splices: Annotated (sjdb) | 2196489 Number of splices: GT/AG | 2269374 Number of splices: GC/AG | 29754 Number of splices: AT/AC | 974 Number of splices: Non-canonical | 2200 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 61105 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 10787 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.17% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 922607 922607 922607 N_multimapping 61105 61105 61105 N_noFeature 141493 4694438 168603 N_ambiguous 104622 406 16091 UnstrandedReadsAssigned:4564177 PositiveStrandReadsAssigned:115448 NegativeStrandReadsAssigned:4625598 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052711 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052711-trimmed-pair1.fastq ERR5052711-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,794,004 reads, 4,704,991 reads pseudoaligned [quant] estimated average fragment length: 186.962 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 ERR5052711.ke.tsv 35125 ERR5052711.se.tsv 88098 total ==> ERR5052711.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.363 0 0 PNS24247 1044 858.038 18.2155 6.76606 PNS24249 1928 1742.04 37.4209 6.84634 PNS24246 1044 858.038 18.2155 6.76606 PNS24248 1044 858.038 18.2155 6.76606 PNS24244 1471 1285.04 37.9326 9.40803 PNS24243 293 122.02 0 0 KQK14069 1603 1417.04 5170.14 1162.85 KQK14071 474 290.882 189.046 207.135 ==> ERR5052711.se.tsv <== BRADI_1g14170v3 5770 BRADI_1g53295v3 24 BRADI_1g59795v3 164 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 178 BRADI_1g74790v3 206 BRADI_1g09890v3 0 BRADI_1g77505v3 109 BRADI_1g48960v3 0 ERR5052711 completed mapping pipeline successfully