Starting /dee2/code/volunteer_pipeline.sh ERR5052712 current disk space = 1525793878016 free memory = 1561571004 ERR5052712 SRAfilesize f75d52b8650415b9e5d68c3c6e4c2ce3 ERR5052712.sra ERR5052712.sra file validated ERR5052712 is paired end ERR5052712 is conventional basespace ERR5052712 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052712_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.96875 35.0 35.0 35.0 35.0 35.0 2 34.555 35.0 35.0 35.0 35.0 35.0 3 34.692 35.0 35.0 35.0 35.0 35.0 4 34.702 35.0 35.0 35.0 35.0 35.0 5 34.68375 35.0 35.0 35.0 35.0 35.0 6 39.505 40.0 40.0 40.0 39.0 40.0 7 39.53125 40.0 40.0 40.0 39.0 40.0 8 39.49775 40.0 40.0 40.0 39.0 40.0 9 39.54125 40.0 40.0 40.0 39.0 40.0 10 39.53075 40.0 40.0 40.0 39.0 40.0 11 39.49425 40.0 40.0 40.0 39.0 40.0 12 39.49225 40.0 40.0 40.0 39.0 40.0 13 39.4775 40.0 40.0 40.0 39.0 40.0 14 39.47325 40.0 40.0 40.0 39.0 40.0 15 39.50575 40.0 40.0 40.0 39.0 40.0 16 39.4815 40.0 40.0 40.0 39.0 40.0 17 39.507 40.0 40.0 40.0 39.0 40.0 18 39.54225 40.0 40.0 40.0 39.0 40.0 19 39.5195 40.0 40.0 40.0 39.0 40.0 20 39.525 40.0 40.0 40.0 39.0 40.0 21 39.4895 40.0 40.0 40.0 39.0 40.0 22 39.523 40.0 40.0 40.0 39.0 40.0 23 39.48825 40.0 40.0 40.0 39.0 40.0 24 39.441 40.0 40.0 40.0 39.0 40.0 25 39.466 40.0 40.0 40.0 39.0 40.0 26 39.45925 40.0 40.0 40.0 39.0 40.0 27 39.4555 40.0 40.0 40.0 39.0 40.0 28 39.493 40.0 40.0 40.0 39.0 40.0 29 39.481 40.0 40.0 40.0 39.0 40.0 30 39.451 40.0 40.0 40.0 39.0 40.0 31 39.47375 40.0 40.0 40.0 39.0 40.0 32 39.4875 40.0 40.0 40.0 39.0 40.0 33 39.473 40.0 40.0 40.0 39.0 40.0 34 39.42025 40.0 40.0 40.0 39.0 40.0 35 39.4405 40.0 40.0 40.0 39.0 40.0 36 39.47025 40.0 40.0 40.0 39.0 40.0 37 39.49325 40.0 40.0 40.0 39.0 40.0 38 39.475 40.0 40.0 40.0 39.0 40.0 39 39.489 40.0 40.0 40.0 39.0 40.0 40 39.50775 40.0 40.0 40.0 39.0 40.0 41 39.3835 40.0 40.0 40.0 39.0 40.0 42 39.40875 40.0 40.0 40.0 39.0 40.0 43 39.45225 40.0 40.0 40.0 39.0 40.0 44 39.45425 40.0 40.0 40.0 39.0 40.0 45 39.49225 40.0 40.0 40.0 39.0 40.0 46 39.418 40.0 40.0 40.0 39.0 40.0 47 39.46175 40.0 40.0 40.0 39.0 40.0 48 39.465 40.0 40.0 40.0 39.0 40.0 49 39.4755 40.0 40.0 40.0 39.0 40.0 50 39.36375 40.0 40.0 40.0 39.0 40.0 51 39.47375 40.0 40.0 40.0 39.0 40.0 52 39.44025 40.0 40.0 40.0 39.0 40.0 53 39.44275 40.0 40.0 40.0 39.0 40.0 54 39.40275 40.0 40.0 40.0 39.0 40.0 55 39.457 40.0 40.0 40.0 39.0 40.0 56 39.48075 40.0 40.0 40.0 39.0 40.0 57 39.48225 40.0 40.0 40.0 39.0 40.0 58 39.451 40.0 40.0 40.0 39.0 40.0 59 39.3945 40.0 40.0 40.0 39.0 40.0 60 39.43975 40.0 40.0 40.0 39.0 40.0 61 39.3685 40.0 40.0 40.0 39.0 40.0 62 39.3775 40.0 40.0 40.0 39.0 40.0 63 39.39075 40.0 40.0 40.0 39.0 40.0 64 39.40875 40.0 40.0 40.0 39.0 40.0 65 39.42875 40.0 40.0 40.0 39.0 40.0 66 39.36425 40.0 40.0 40.0 39.0 40.0 67 39.42725 40.0 40.0 40.0 39.0 40.0 68 39.41275 40.0 40.0 40.0 39.0 40.0 69 39.36175 40.0 40.0 40.0 39.0 40.0 70 39.41325 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 1.0 26 2.0 27 5.0 28 7.0 29 5.0 30 16.0 31 10.0 32 23.0 33 37.0 34 30.0 35 42.0 36 80.0 37 79.0 38 260.0 39 3401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.75332650972365 9.442169907881269 9.646878198567043 48.15762538382805 2 22.45 11.075 35.225 31.25 3 21.7 13.750000000000002 22.6 41.949999999999996 4 27.375 21.825 20.849999999999998 29.95 5 26.674999999999997 28.525 24.349999999999998 20.45 6 23.125 29.9 24.9 22.075 7 18.825 23.275000000000002 37.375 20.525 8 20.075000000000003 23.150000000000002 31.424999999999997 25.35 9 20.825 22.175 33.75 23.25 10 23.225 30.099999999999998 25.674999999999997 21.0 11 26.150000000000002 24.675 23.025000000000002 26.150000000000002 12 23.3 21.475 28.050000000000004 27.175 13 23.5 23.075000000000003 27.275 26.150000000000002 14 22.825 24.275 26.55 26.35 15 22.675 24.125 27.375 25.825 16 24.425 24.05 26.25 25.275 17 24.6 24.875 25.35 25.174999999999997 18 22.85 24.95 25.374999999999996 26.825 19 24.75 24.425 24.95 25.874999999999996 20 23.7 24.075 26.825 25.4 21 23.325000000000003 25.174999999999997 26.575 24.925 22 23.400000000000002 26.075 24.55 25.974999999999998 23 24.675 24.45 26.325 24.55 24 23.1 24.0 26.35 26.55 25 23.95 25.074999999999996 25.25 25.724999999999998 26 24.425 24.775 24.85 25.95 27 23.7 24.85 25.6 25.85 28 24.224999999999998 25.074999999999996 24.375 26.325 29 24.2 23.825 26.55 25.424999999999997 30 23.974999999999998 24.224999999999998 25.85 25.95 31 23.45 24.25 25.2 27.1 32 24.3 23.875 25.275 26.55 33 24.925 23.425 25.75 25.900000000000002 34 23.35 25.15 24.125 27.375 35 23.075000000000003 26.075 25.4 25.45 36 24.55 23.549999999999997 25.624999999999996 26.275 37 23.724999999999998 23.775 25.55 26.950000000000003 38 23.775 24.099999999999998 25.85 26.275 39 23.875 25.0 25.650000000000002 25.474999999999998 40 24.95 24.025 24.075 26.950000000000003 41 23.275000000000002 25.5 24.825 26.400000000000002 42 23.25 24.325 25.674999999999997 26.75 43 23.849999999999998 24.425 25.1 26.625 44 24.3 25.25 24.4 26.05 45 22.975 24.425 25.85 26.75 46 23.1 26.150000000000002 25.650000000000002 25.1 47 24.325 24.725 25.724999999999998 25.224999999999998 48 22.775000000000002 24.7 26.075 26.450000000000003 49 23.200000000000003 25.224999999999998 25.6 25.974999999999998 50 23.799999999999997 25.374999999999996 24.675 26.150000000000002 51 23.3 23.825 27.025 25.85 52 24.325 24.099999999999998 24.975 26.6 53 24.425 24.474999999999998 25.4 25.7 54 23.45 24.675 26.775 25.1 55 24.425 24.05 25.474999999999998 26.05 56 24.125 24.8 25.374999999999996 25.7 57 23.474999999999998 24.275 25.95 26.3 58 23.799999999999997 24.625 25.5 26.075 59 23.925 24.45 25.1 26.525 60 22.975 24.25 25.05 27.725 61 23.200000000000003 24.075 25.374999999999996 27.35 62 24.2 24.375 25.424999999999997 26.0 63 24.099999999999998 24.025 24.8 27.075 64 24.356089022255563 24.33108277069267 23.93098274568642 27.38184546136534 65 23.63090772693173 24.55613903475869 25.78144536134033 26.03150787696924 66 23.59437751004016 24.246987951807228 25.75301204819277 26.40562248995984 67 24.344758064516128 23.412298387096776 24.445564516129032 27.797379032258064 68 25.115443817342225 24.29451000513084 24.807593637762956 25.782452539763984 69 24.140775364311246 19.906516359637063 27.605169095408304 28.347539180643388 70 26.834692364714602 0.0 36.61971830985916 36.54558932542624 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 2.0 28 5.0 29 13.0 30 18.0 31 15.5 32 18.5 33 24.0 34 34.5 35 60.0 36 83.5 37 92.0 38 117.5 39 152.5 40 162.0 41 194.0 42 238.0 43 250.0 44 253.5 45 265.0 46 269.0 47 265.0 48 265.0 49 243.5 50 222.0 51 201.0 52 192.5 53 205.0 54 192.5 55 158.5 56 126.5 57 116.0 58 117.0 59 124.0 60 130.0 61 109.5 62 82.0 63 75.0 64 68.5 65 71.0 66 72.0 67 64.0 68 59.0 69 52.0 70 50.0 71 43.5 72 33.5 73 30.0 74 22.0 75 12.0 76 13.0 77 16.0 78 10.0 79 4.0 80 4.0 81 2.0 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.025 66 0.4 67 0.8 68 2.55 69 9.075 70 32.550000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3012804418779814 0.6 3 0.025106703489831784 0.075 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052712 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052712_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.50025 35.0 35.0 35.0 34.0 35.0 2 34.43975 35.0 35.0 35.0 34.0 35.0 3 34.45225 35.0 35.0 35.0 34.0 35.0 4 34.4865 35.0 35.0 35.0 34.0 35.0 5 34.47275 35.0 35.0 35.0 34.0 35.0 6 39.2405 40.0 40.0 40.0 39.0 40.0 7 39.23625 40.0 40.0 40.0 39.0 40.0 8 39.2915 40.0 40.0 40.0 39.0 40.0 9 39.2795 40.0 40.0 40.0 39.0 40.0 10 39.2905 40.0 40.0 40.0 39.0 40.0 11 39.251 40.0 40.0 40.0 39.0 40.0 12 39.30125 40.0 40.0 40.0 39.0 40.0 13 39.271 40.0 40.0 40.0 39.0 40.0 14 39.23175 40.0 40.0 40.0 39.0 40.0 15 39.25675 40.0 40.0 40.0 39.0 40.0 16 39.30275 40.0 40.0 40.0 39.0 40.0 17 39.31275 40.0 40.0 40.0 39.0 40.0 18 39.28275 40.0 40.0 40.0 39.0 40.0 19 39.28925 40.0 40.0 40.0 39.0 40.0 20 39.33175 40.0 40.0 40.0 39.0 40.0 21 39.26875 40.0 40.0 40.0 39.0 40.0 22 39.25375 40.0 40.0 40.0 39.0 40.0 23 39.29225 40.0 40.0 40.0 39.0 40.0 24 39.271 40.0 40.0 40.0 39.0 40.0 25 39.324 40.0 40.0 40.0 39.0 40.0 26 39.2545 40.0 40.0 40.0 39.0 40.0 27 39.276 40.0 40.0 40.0 39.0 40.0 28 39.25975 40.0 40.0 40.0 39.0 40.0 29 39.26 40.0 40.0 40.0 39.0 40.0 30 39.24025 40.0 40.0 40.0 39.0 40.0 31 39.277 40.0 40.0 40.0 39.0 40.0 32 39.32475 40.0 40.0 40.0 39.0 40.0 33 39.27325 40.0 40.0 40.0 39.0 40.0 34 39.22425 40.0 40.0 40.0 39.0 40.0 35 39.23975 40.0 40.0 40.0 39.0 40.0 36 39.211 40.0 40.0 40.0 39.0 40.0 37 39.26475 40.0 40.0 40.0 39.0 40.0 38 39.2495 40.0 40.0 40.0 39.0 40.0 39 39.22625 40.0 40.0 40.0 39.0 40.0 40 39.2665 40.0 40.0 40.0 39.0 40.0 41 39.25075 40.0 40.0 40.0 39.0 40.0 42 39.27775 40.0 40.0 40.0 39.0 40.0 43 39.2005 40.0 40.0 40.0 39.0 40.0 44 39.28675 40.0 40.0 40.0 39.0 40.0 45 39.30225 40.0 40.0 40.0 39.0 40.0 46 39.27375 40.0 40.0 40.0 39.0 40.0 47 39.272 40.0 40.0 40.0 39.0 40.0 48 39.21625 40.0 40.0 40.0 39.0 40.0 49 39.23125 40.0 40.0 40.0 39.0 40.0 50 39.235 40.0 40.0 40.0 39.0 40.0 51 39.1925 40.0 40.0 40.0 39.0 40.0 52 39.1405 40.0 40.0 40.0 39.0 40.0 53 39.153 40.0 40.0 40.0 39.0 40.0 54 39.1385 40.0 40.0 40.0 39.0 40.0 55 39.1655 40.0 40.0 40.0 39.0 40.0 56 39.1195 40.0 40.0 40.0 39.0 40.0 57 39.22275 40.0 40.0 40.0 39.0 40.0 58 39.19375 40.0 40.0 40.0 39.0 40.0 59 39.25425 40.0 40.0 40.0 39.0 40.0 60 39.22525 40.0 40.0 40.0 39.0 40.0 61 39.26725 40.0 40.0 40.0 39.0 40.0 62 39.19475 40.0 40.0 40.0 39.0 40.0 63 39.102 40.0 40.0 40.0 39.0 40.0 64 39.1745 40.0 40.0 40.0 39.0 40.0 65 39.17825 40.0 40.0 40.0 39.0 40.0 66 39.09075 40.0 40.0 40.0 39.0 40.0 67 39.17325 40.0 40.0 40.0 39.0 40.0 68 39.0905 40.0 40.0 40.0 39.0 40.0 69 39.101 40.0 40.0 40.0 39.0 40.0 70 39.037 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 5.0 20 8.0 21 3.0 22 9.0 23 8.0 24 7.0 25 8.0 26 9.0 27 9.0 28 4.0 29 8.0 30 12.0 31 20.0 32 16.0 33 26.0 34 33.0 35 34.0 36 69.0 37 104.0 38 208.0 39 3396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.4 18.35 12.2 40.050000000000004 2 26.700000000000003 24.15 28.65 20.5 3 22.55 24.45 26.525 26.474999999999998 4 25.95 29.925 19.8 24.325 5 27.575 32.35 19.8 20.275000000000002 6 23.474999999999998 33.1 21.6 21.825 7 24.7 18.725 32.675 23.9 8 22.725 23.724999999999998 24.95 28.599999999999998 9 24.75 22.025 27.725 25.5 10 24.425 30.349999999999998 22.85 22.375 11 27.85 23.35 20.474999999999998 28.325 12 25.650000000000002 22.25 25.35 26.75 13 26.1 23.275000000000002 23.95 26.674999999999997 14 25.224999999999998 25.525 24.675 24.575 15 26.025 24.45 23.525 26.0 16 25.174999999999997 25.85 23.75 25.224999999999998 17 25.874999999999996 25.4 23.95 24.775 18 25.3 25.724999999999998 23.799999999999997 25.174999999999997 19 25.974999999999998 24.15 24.15 25.724999999999998 20 25.45 25.85 24.625 24.075 21 26.05 24.65 24.275 25.025 22 26.125 24.525 23.65 25.7 23 25.2 25.575 23.275000000000002 25.95 24 25.174999999999997 26.025 24.175 24.625 25 25.674999999999997 24.7 24.125 25.5 26 25.45 25.15 24.625 24.775 27 25.525 25.25 25.174999999999997 24.05 28 25.650000000000002 24.375 23.75 26.224999999999998 29 26.35 24.65 24.85 24.15 30 26.0 25.900000000000002 24.474999999999998 23.625 31 24.675 24.5 25.124999999999996 25.7 32 26.625 24.8 23.875 24.7 33 25.6 26.0 25.2 23.200000000000003 34 25.525 24.75 24.675 25.05 35 26.875 25.35 23.7 24.075 36 25.95 24.4 25.05 24.6 37 25.8 24.075 23.7 26.424999999999997 38 25.05 25.974999999999998 23.1 25.874999999999996 39 24.425 25.474999999999998 25.650000000000002 24.45 40 27.1 24.3 23.125 25.474999999999998 41 25.025 25.5 24.224999999999998 25.25 42 26.25 25.0 24.349999999999998 24.4 43 23.95 25.4 24.925 25.724999999999998 44 26.75 25.324999999999996 23.474999999999998 24.45 45 25.0 25.525 25.474999999999998 24.0 46 26.174999999999997 24.875 24.775 24.175 47 25.35 25.3 24.825 24.525 48 24.4 24.5 25.424999999999997 25.674999999999997 49 25.575 25.5 25.1 23.825 50 26.174999999999997 24.05 25.75 24.025 51 25.25 25.4 24.575 24.775 52 24.325 24.099999999999998 25.525 26.05 53 25.6 25.974999999999998 25.2 23.225 54 25.45 24.525 26.424999999999997 23.599999999999998 55 26.150000000000002 24.3 24.075 25.474999999999998 56 26.025 25.05 23.525 25.4 57 25.474999999999998 25.7 25.025 23.799999999999997 58 27.175 23.65 23.674999999999997 25.5 59 25.55 25.525 24.125 24.8 60 25.3 25.3 24.075 25.324999999999996 61 27.575 23.7 24.525 24.2 62 27.474999999999998 24.725 24.3 23.5 63 24.925 25.724999999999998 24.775 24.575 64 26.38159539884971 24.656164041010253 23.85596399099775 25.10627656914228 65 27.00675168792198 25.78144536134033 23.755938984746187 23.455863965991497 66 24.868519909842224 26.84698221888305 24.793388429752067 23.491109441522664 67 25.610677411231432 23.772349534122387 25.686225132208513 24.930747922437675 68 27.32438016528926 23.734504132231404 25.0 23.941115702479337 69 26.501965188096577 19.06232453677709 26.10892756878158 28.32678270634475 70 27.68256333830104 0.0 35.581222056631894 36.73621460506706 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 4.0 26 5.5 27 4.0 28 6.0 29 13.0 30 18.0 31 17.0 32 20.5 33 25.0 34 33.0 35 57.0 36 87.0 37 101.0 38 115.0 39 148.5 40 168.0 41 192.5 42 226.0 43 235.0 44 245.0 45 255.5 46 250.5 47 245.0 48 259.0 49 244.5 50 216.0 51 205.0 52 176.0 53 158.0 54 159.5 55 142.5 56 127.0 57 130.0 58 133.5 59 129.0 60 121.0 61 115.0 62 97.5 63 86.0 64 87.5 65 87.5 66 80.5 67 75.0 68 67.5 69 53.5 70 47.0 71 45.0 72 36.0 73 29.0 74 32.0 75 24.0 76 10.5 77 8.0 78 5.0 79 1.5 80 1.0 81 2.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.025 66 0.17500000000000002 67 0.7250000000000001 68 3.2 69 10.95 70 32.9 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57189624779652 98.85000000000001 2 0.2518257365902795 0.5 3 0.1007302946361118 0.3 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443367 spots for ERR5052712.sra Written 443367 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra Read 443366 spots for ERR5052712.sra Written 443366 spots for ERR5052712.sra SRR ids: ['ERR5052712.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jmm1znbc ERR5052712.sra spots: 8867321 blocks: [[1, 443366], [443367, 886732], [886733, 1330098], [1330099, 1773464], [1773465, 2216830], [2216831, 2660196], [2660197, 3103562], [3103563, 3546928], [3546929, 3990294], [3990295, 4433660], [4433661, 4877026], [4877027, 5320392], [5320393, 5763758], [5763759, 6207124], [6207125, 6650490], [6650491, 7093856], [7093857, 7537222], [7537223, 7980588], [7980589, 8423954], [8423955, 8867321]] ERR5052712 file size 1573858 ERR5052712 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052712 ERR5052712_1.fastq ERR5052712_2.fastq Input file: ERR5052712_1.fastq Paired file: ERR5052712_2.fastq trimmed: ERR5052712-trimmed-pair1.fastq, ERR5052712-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:45:24 2024 >> started Tue Dec 10 05:45:30 2024 >> done (6.379s) 8867321 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 29 ( 0.00%) empty read pairs filtered out after trimming by size control 8867292 (100.00%) read pairs available; of these: 34 ( 0.00%) trimmed read pairs available after processing 8867258 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 47 2 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 1 0.00% 62 2 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 29 0.00% 70 8867258 100.00% 8867292 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=16 prefix-density=0.15 prefix-fanout=3.5 sequence=TGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=332.31 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=13.7 sequence=GCCGCCGCCCGGGAGCGCGCCCGGCCACACCGTGTAGCTGCACTTGTTTACGACGGTGATTGTGGCCGCGTCGGAGAAGAAGGCGGAGAGGAGGACGGCGAGGAGAGGGATGAGGATCACACGAGCAGAGGACGCCATGGAT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=193.36 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=15.5 sequence=GCCGCCGCCGTC ERR5052712 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:46:03 Started mapping on | Dec 10 05:46:04 Finished on | Dec 10 05:47:12 Mapping speed, Million of reads per hour | 469.44 Number of input reads | 8867292 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 7704339 Uniquely mapped reads % | 86.88% Average mapped length | 138.77 Number of splices: Total | 3921397 Number of splices: Annotated (sjdb) | 3734126 Number of splices: GT/AG | 3866680 Number of splices: GC/AG | 49793 Number of splices: AT/AC | 1720 Number of splices: Non-canonical | 3204 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 99622 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 17994 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.17% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1063331 1063331 1063331 N_multimapping 99622 99622 99622 N_noFeature 238923 7529304 281935 N_ambiguous 157732 701 25954 UnstrandedReadsAssigned:7307684 PositiveStrandReadsAssigned:174334 NegativeStrandReadsAssigned:7396450 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052712 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052712-trimmed-pair1.fastq ERR5052712-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,867,292 reads, 7,494,405 reads pseudoaligned [quant] estimated average fragment length: 206.774 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 ERR5052712.ke.tsv 35125 ERR5052712.se.tsv 88098 total ==> ERR5052712.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 730.622 13.0156 3.66936 PNS24247 1044 838.226 30.2917 7.44354 PNS24249 1928 1722.23 34.7853 4.16029 PNS24246 1044 838.226 30.2917 7.44354 PNS24248 1044 838.226 30.2917 7.44354 PNS24244 1471 1265.23 43.324 7.05307 PNS24243 293 115.072 0 0 KQK14069 1603 1397.23 6272.44 924.671 KQK14071 474 274.234 197.131 148.065 ==> ERR5052712.se.tsv <== BRADI_1g14170v3 7178 BRADI_1g53295v3 50 BRADI_1g59795v3 274 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 307 BRADI_1g74790v3 248 BRADI_1g09890v3 0 BRADI_1g77505v3 172 BRADI_1g48960v3 0 ERR5052712 completed mapping pipeline successfully