Starting /dee2/code/volunteer_pipeline.sh ERR5052713 current disk space = 1525792321536 free memory = 1401241652 ERR5052713 SRAfilesize 02cdbfb67da355ea7e1b1818571ef479 ERR5052713.sra ERR5052713.sra file validated ERR5052713 is paired end ERR5052713 is conventional basespace ERR5052713 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052713_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1455 35.0 35.0 35.0 35.0 35.0 2 34.58525 35.0 35.0 35.0 35.0 35.0 3 34.6815 35.0 35.0 35.0 35.0 35.0 4 34.712 35.0 35.0 35.0 35.0 35.0 5 34.702 35.0 35.0 35.0 35.0 35.0 6 39.5495 40.0 40.0 40.0 39.0 40.0 7 39.51675 40.0 40.0 40.0 39.0 40.0 8 39.49725 40.0 40.0 40.0 39.0 40.0 9 39.50625 40.0 40.0 40.0 39.0 40.0 10 39.5115 40.0 40.0 40.0 39.0 40.0 11 39.48925 40.0 40.0 40.0 39.0 40.0 12 39.47775 40.0 40.0 40.0 39.0 40.0 13 39.49225 40.0 40.0 40.0 39.0 40.0 14 39.50575 40.0 40.0 40.0 39.0 40.0 15 39.5155 40.0 40.0 40.0 39.0 40.0 16 39.49975 40.0 40.0 40.0 39.0 40.0 17 39.41475 40.0 40.0 40.0 39.0 40.0 18 39.39675 40.0 40.0 40.0 39.0 40.0 19 39.44525 40.0 40.0 40.0 39.0 40.0 20 39.484 40.0 40.0 40.0 39.0 40.0 21 39.50525 40.0 40.0 40.0 39.0 40.0 22 39.45925 40.0 40.0 40.0 39.0 40.0 23 39.392 40.0 40.0 40.0 39.0 40.0 24 39.47075 40.0 40.0 40.0 39.0 40.0 25 39.4765 40.0 40.0 40.0 39.0 40.0 26 39.4875 40.0 40.0 40.0 39.0 40.0 27 39.4735 40.0 40.0 40.0 39.0 40.0 28 39.4485 40.0 40.0 40.0 39.0 40.0 29 39.39 40.0 40.0 40.0 39.0 40.0 30 39.404 40.0 40.0 40.0 39.0 40.0 31 39.4515 40.0 40.0 40.0 39.0 40.0 32 39.431 40.0 40.0 40.0 39.0 40.0 33 39.4295 40.0 40.0 40.0 39.0 40.0 34 39.373 40.0 40.0 40.0 39.0 40.0 35 39.37575 40.0 40.0 40.0 39.0 40.0 36 39.45725 40.0 40.0 40.0 39.0 40.0 37 39.359 40.0 40.0 40.0 39.0 40.0 38 39.348 40.0 40.0 40.0 39.0 40.0 39 39.43575 40.0 40.0 40.0 39.0 40.0 40 39.393 40.0 40.0 40.0 39.0 40.0 41 39.38575 40.0 40.0 40.0 39.0 40.0 42 39.398 40.0 40.0 40.0 39.0 40.0 43 39.40375 40.0 40.0 40.0 39.0 40.0 44 39.384 40.0 40.0 40.0 39.0 40.0 45 39.39775 40.0 40.0 40.0 39.0 40.0 46 39.36525 40.0 40.0 40.0 39.0 40.0 47 39.357 40.0 40.0 40.0 39.0 40.0 48 39.36575 40.0 40.0 40.0 39.0 40.0 49 39.3875 40.0 40.0 40.0 39.0 40.0 50 39.4045 40.0 40.0 40.0 39.0 40.0 51 39.377 40.0 40.0 40.0 39.0 40.0 52 39.399 40.0 40.0 40.0 39.0 40.0 53 39.3495 40.0 40.0 40.0 39.0 40.0 54 39.34825 40.0 40.0 40.0 39.0 40.0 55 39.4045 40.0 40.0 40.0 39.0 40.0 56 39.34425 40.0 40.0 40.0 39.0 40.0 57 39.2755 40.0 40.0 40.0 39.0 40.0 58 39.29925 40.0 40.0 40.0 39.0 40.0 59 39.34225 40.0 40.0 40.0 39.0 40.0 60 39.40825 40.0 40.0 40.0 39.0 40.0 61 39.3515 40.0 40.0 40.0 39.0 40.0 62 39.35775 40.0 40.0 40.0 39.0 40.0 63 39.40325 40.0 40.0 40.0 39.0 40.0 64 39.33825 40.0 40.0 40.0 39.0 40.0 65 39.38025 40.0 40.0 40.0 39.0 40.0 66 39.39825 40.0 40.0 40.0 39.0 40.0 67 39.3495 40.0 40.0 40.0 39.0 40.0 68 39.342 40.0 40.0 40.0 39.0 40.0 69 39.3695 40.0 40.0 40.0 39.0 40.0 70 39.3755 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 6.0 27 5.0 28 13.0 29 13.0 30 18.0 31 17.0 32 21.0 33 35.0 34 30.0 35 40.0 36 60.0 37 100.0 38 230.0 39 3411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.40111845449924 9.303507880020335 9.07473309608541 48.220640569395016 2 23.275000000000002 12.125 34.150000000000006 30.45 3 22.25 13.65 24.075 40.025 4 27.275 21.325 21.5 29.9 5 26.474999999999998 26.75 24.175 22.6 6 23.575 28.249999999999996 25.025 23.150000000000002 7 19.85 23.125 37.525 19.5 8 21.224999999999998 23.425 29.599999999999998 25.75 9 20.25 22.05 33.5 24.2 10 23.05 32.625 24.85 19.475 11 24.875 25.324999999999996 23.400000000000002 26.400000000000002 12 24.125 21.025 28.325 26.525 13 22.8 23.575 27.775 25.85 14 23.225 23.825 27.900000000000002 25.05 15 22.8 22.825 27.750000000000004 26.625 16 23.474999999999998 23.849999999999998 25.75 26.924999999999997 17 22.900000000000002 24.349999999999998 25.6 27.150000000000002 18 23.225 24.375 25.025 27.375 19 23.775 24.8 24.775 26.650000000000002 20 23.9 24.775 26.375 24.95 21 23.525 24.625 25.0 26.85 22 23.225 23.799999999999997 26.3 26.674999999999997 23 22.125 25.75 27.875 24.25 24 22.900000000000002 24.55 24.975 27.575 25 24.975 24.575 24.675 25.775 26 24.2 25.0 26.424999999999997 24.375 27 23.674999999999997 23.674999999999997 25.124999999999996 27.525 28 24.3 25.6 24.15 25.95 29 22.325 24.575 25.874999999999996 27.224999999999998 30 22.6 23.925 26.325 27.150000000000002 31 24.05 24.95 25.275 25.724999999999998 32 23.375 24.9 26.075 25.650000000000002 33 23.05 24.625 24.95 27.375 34 25.05 25.775 23.825 25.35 35 23.225 24.9 26.75 25.124999999999996 36 23.225 23.05 25.825 27.900000000000002 37 23.65 25.6 24.2 26.55 38 24.349999999999998 25.45 25.8 24.4 39 23.225 23.724999999999998 25.124999999999996 27.925 40 23.575 24.975 25.35 26.1 41 24.625 26.0 25.324999999999996 24.05 42 24.075 25.35 25.074999999999996 25.5 43 24.05 24.725 24.975 26.25 44 24.0 25.4 25.5 25.1 45 23.724999999999998 23.05 27.05 26.174999999999997 46 23.95 23.375 26.1 26.575 47 23.53088272068017 24.90622655663916 25.70642660665166 25.85646411602901 48 23.330832708177045 23.15578894723681 25.6064016004001 27.906976744186046 49 24.831207801950487 24.981245311327832 24.431107776944234 25.756439109777446 50 23.055763940985248 25.056264066016503 26.156539134783696 25.731432858214554 51 23.055763940985248 24.33108277069267 25.581395348837212 27.031757939484873 52 24.831207801950487 24.706176544136035 25.506376594148538 24.956239059764943 53 23.680920230057513 23.93098274568642 26.331582895723933 26.056514128532132 54 23.005751437859466 24.406101525381345 25.731432858214554 26.85671417854464 55 23.88097024256064 24.981245311327832 25.18129532383096 25.95648912228057 56 22.780695173793447 25.506376594148538 25.78144536134033 25.93148287071768 57 23.80595148787197 23.95598899724931 26.03150787696924 26.206551637909474 58 24.006001500375092 23.830957739434858 25.03125781445361 27.131782945736433 59 22.655663915978995 25.6064016004001 25.081270317579396 26.65666416604151 60 23.23080770192548 22.73068267066767 25.93148287071768 28.107026756689173 61 23.95598899724931 24.55613903475869 23.80595148787197 27.68192048012003 62 24.406101525381345 24.731182795698924 26.85671417854464 24.006001500375092 63 23.680920230057513 24.256064016004 24.306076519129782 27.7569392348087 64 25.406351587896975 24.781195298824706 23.63090772693173 26.18154538634659 65 22.630657664416105 25.406351587896975 26.356589147286826 25.6064016004001 66 23.539734269240412 23.66507896715969 25.31962897969416 27.475557783905742 67 23.803526448362717 23.97984886649874 25.54156171284635 26.675062972292192 68 24.05095541401274 23.00636942675159 26.24203821656051 26.70063694267516 69 22.885979268957993 20.1582105837425 27.495908346972175 29.45990180032733 70 24.588364434687158 0.0 36.04098060739114 39.370654957921694 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.5 25 2.5 26 2.0 27 2.0 28 5.5 29 9.0 30 9.0 31 11.5 32 22.0 33 30.0 34 37.5 35 62.5 36 91.5 37 103.0 38 115.5 39 151.0 40 174.0 41 198.0 42 216.0 43 210.0 44 239.0 45 273.5 46 270.5 47 262.0 48 250.0 49 230.5 50 223.0 51 218.5 52 208.0 53 202.0 54 181.5 55 163.0 56 147.0 57 129.0 58 120.0 59 105.5 60 100.0 61 101.0 62 92.5 63 83.0 64 86.0 65 81.5 66 79.5 67 85.0 68 67.0 69 45.0 70 41.0 71 39.5 72 28.0 73 18.0 74 16.5 75 11.0 76 8.5 77 10.0 78 6.0 79 2.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.27499999999999997 67 0.75 68 1.875 69 8.35 70 31.674999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.025 0.0 46 0.0 0.0 0.0 0.025 0.0 47 0.0 0.0 0.0 0.025 0.0 48 0.0 0.0 0.0 0.025 0.0 49 0.0 0.0 0.0 0.025 0.0 50 0.0 0.0 0.0 0.025 0.0 51 0.0 0.0 0.0 0.025 0.0 52 0.0 0.0 0.0 0.025 0.0 53 0.0 0.0 0.0 0.025 0.0 54 0.0 0.0 0.0 0.025 0.0 55 0.0 0.0 0.0 0.025 0.0 56 0.0 0.0 0.0 0.025 0.0 57 0.0 0.0 0.0 0.025 0.0 58 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052713 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052713_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.48975 35.0 35.0 35.0 35.0 35.0 2 34.51575 35.0 35.0 35.0 35.0 35.0 3 34.43925 35.0 35.0 35.0 34.0 35.0 4 34.3675 35.0 35.0 35.0 34.0 35.0 5 34.41325 35.0 35.0 35.0 35.0 35.0 6 39.233 40.0 40.0 40.0 39.0 40.0 7 39.24325 40.0 40.0 40.0 39.0 40.0 8 39.104 40.0 40.0 40.0 39.0 40.0 9 39.1615 40.0 40.0 40.0 39.0 40.0 10 39.23925 40.0 40.0 40.0 39.0 40.0 11 39.18175 40.0 40.0 40.0 39.0 40.0 12 39.2225 40.0 40.0 40.0 39.0 40.0 13 39.1975 40.0 40.0 40.0 39.0 40.0 14 39.2285 40.0 40.0 40.0 39.0 40.0 15 39.20475 40.0 40.0 40.0 39.0 40.0 16 39.132 40.0 40.0 40.0 39.0 40.0 17 39.13575 40.0 40.0 40.0 39.0 40.0 18 39.17 40.0 40.0 40.0 39.0 40.0 19 39.15375 40.0 40.0 40.0 39.0 40.0 20 39.222 40.0 40.0 40.0 39.0 40.0 21 39.18575 40.0 40.0 40.0 39.0 40.0 22 39.2535 40.0 40.0 40.0 39.0 40.0 23 39.1785 40.0 40.0 40.0 39.0 40.0 24 39.185 40.0 40.0 40.0 39.0 40.0 25 39.2055 40.0 40.0 40.0 39.0 40.0 26 39.1835 40.0 40.0 40.0 39.0 40.0 27 39.15725 40.0 40.0 40.0 39.0 40.0 28 39.14975 40.0 40.0 40.0 39.0 40.0 29 39.2295 40.0 40.0 40.0 39.0 40.0 30 39.19525 40.0 40.0 40.0 39.0 40.0 31 39.237 40.0 40.0 40.0 39.0 40.0 32 39.2 40.0 40.0 40.0 39.0 40.0 33 39.1415 40.0 40.0 40.0 39.0 40.0 34 39.172 40.0 40.0 40.0 39.0 40.0 35 39.15775 40.0 40.0 40.0 39.0 40.0 36 39.21275 40.0 40.0 40.0 39.0 40.0 37 39.1195 40.0 40.0 40.0 39.0 40.0 38 39.1955 40.0 40.0 40.0 39.0 40.0 39 39.1295 40.0 40.0 40.0 39.0 40.0 40 39.2135 40.0 40.0 40.0 39.0 40.0 41 39.187 40.0 40.0 40.0 39.0 40.0 42 39.13325 40.0 40.0 40.0 39.0 40.0 43 39.11875 40.0 40.0 40.0 39.0 40.0 44 39.11325 40.0 40.0 40.0 39.0 40.0 45 39.15875 40.0 40.0 40.0 39.0 40.0 46 39.13425 40.0 40.0 40.0 39.0 40.0 47 39.12575 40.0 40.0 40.0 39.0 40.0 48 39.08175 40.0 40.0 40.0 39.0 40.0 49 39.144 40.0 40.0 40.0 39.0 40.0 50 39.12325 40.0 40.0 40.0 39.0 40.0 51 39.17525 40.0 40.0 40.0 39.0 40.0 52 39.13225 40.0 40.0 40.0 39.0 40.0 53 39.04075 40.0 40.0 40.0 39.0 40.0 54 39.0475 40.0 40.0 40.0 39.0 40.0 55 39.034 40.0 40.0 40.0 39.0 40.0 56 39.0525 40.0 40.0 40.0 39.0 40.0 57 39.1345 40.0 40.0 40.0 39.0 40.0 58 39.1225 40.0 40.0 40.0 39.0 40.0 59 39.0665 40.0 40.0 40.0 39.0 40.0 60 39.091 40.0 40.0 40.0 39.0 40.0 61 39.08675 40.0 40.0 40.0 39.0 40.0 62 39.12375 40.0 40.0 40.0 39.0 40.0 63 39.0315 40.0 40.0 40.0 39.0 40.0 64 39.03925 40.0 40.0 40.0 39.0 40.0 65 39.11175 40.0 40.0 40.0 39.0 40.0 66 39.073 40.0 40.0 40.0 39.0 40.0 67 39.11225 40.0 40.0 40.0 39.0 40.0 68 39.1655 40.0 40.0 40.0 39.0 40.0 69 39.0925 40.0 40.0 40.0 39.0 40.0 70 39.045 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 6.0 20 10.0 21 9.0 22 5.0 23 13.0 24 14.0 25 9.0 26 11.0 27 9.0 28 13.0 29 12.0 30 14.0 31 20.0 32 12.0 33 22.0 34 29.0 35 43.0 36 59.0 37 109.0 38 196.0 39 3385.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.15 19.275000000000002 12.775 38.800000000000004 2 28.275 23.025000000000002 28.95 19.75 3 20.7 26.3 26.75 26.25 4 26.200000000000003 28.875 20.775 24.15 5 27.05 31.525 20.775 20.65 6 22.775000000000002 32.375 21.85 23.0 7 23.775 18.224999999999998 34.125 23.875 8 23.075000000000003 21.775 26.325 28.825 9 24.125 22.35 26.424999999999997 27.1 10 24.025 32.0 23.0 20.974999999999998 11 28.4 21.9 21.0 28.7 12 26.650000000000002 22.575 23.875 26.900000000000002 13 25.575 26.025 23.525 24.875 14 26.05 23.674999999999997 24.95 25.324999999999996 15 24.65 25.825 24.5 25.025 16 24.725 24.349999999999998 24.55 26.375 17 25.650000000000002 24.85 23.825 25.674999999999997 18 25.45 25.575 24.275 24.7 19 25.650000000000002 25.3 23.875 25.174999999999997 20 27.375 24.45 23.275000000000002 24.9 21 25.575 25.85 23.549999999999997 25.025 22 25.85 26.85 23.150000000000002 24.15 23 25.174999999999997 25.15 24.125 25.55 24 24.85 26.474999999999998 24.975 23.7 25 25.8 25.2 23.1 25.900000000000002 26 26.724999999999998 25.4 23.674999999999997 24.2 27 24.425 25.75 25.424999999999997 24.4 28 25.05 25.324999999999996 24.85 24.775 29 25.5 24.65 24.4 25.45 30 24.725 25.8 24.4 25.074999999999996 31 26.35 24.325 24.075 25.25 32 28.275 24.95 23.3 23.474999999999998 33 25.650000000000002 24.575 24.725 25.05 34 24.25 27.05 23.1 25.6 35 25.3 25.424999999999997 23.674999999999997 25.6 36 23.775 26.174999999999997 25.5 24.55 37 25.174999999999997 25.6 24.325 24.9 38 25.900000000000002 24.875 23.674999999999997 25.55 39 24.675 26.474999999999998 24.349999999999998 24.5 40 25.674999999999997 25.45 23.525 25.35 41 26.174999999999997 25.074999999999996 24.349999999999998 24.4 42 26.525 24.575 25.074999999999996 23.825 43 25.35 24.349999999999998 24.7 25.6 44 25.825 25.275 24.45 24.45 45 25.45 24.65 24.375 25.525 46 25.174999999999997 24.95 23.525 26.35 47 26.431607901975497 25.656414103525883 24.406101525381345 23.50587646911728 48 25.406351587896975 24.8062015503876 25.03125781445361 24.756189047261813 49 26.231557889472366 23.55588897224306 25.656414103525883 24.55613903475869 50 25.756439109777446 25.98149537384346 24.056014003500874 24.20605151287822 51 25.331332833208304 25.081270317579396 24.90622655663916 24.681170292573142 52 25.6064016004001 25.23130782695674 24.50612653163291 24.656164041010253 53 27.056764191047762 24.18104526131533 24.056014003500874 24.706176544136035 54 25.831457864466117 26.18154538634659 24.356089022255563 23.63090772693173 55 26.85671417854464 23.755938984746187 24.706176544136035 24.681170292573142 56 26.30657664416104 24.831207801950487 23.25581395348837 25.6064016004001 57 25.731432858214554 25.95648912228057 24.50612653163291 23.80595148787197 58 24.831207801950487 25.6064016004001 24.281070267566893 25.28132033008252 59 26.206551637909474 25.406351587896975 24.281070267566893 24.10602650662666 60 25.681420355088775 26.206551637909474 24.23105776444111 23.88097024256064 61 26.138069034517258 25.86293146573287 24.537268634317158 23.461730865432717 62 26.563281640820406 24.287143571785894 24.912456228114056 24.23711855927964 63 25.18759379689845 25.68784392196098 25.737868934467233 23.386693346673336 64 26.488244122061033 25.987993996998497 23.51175587793897 24.012006003001503 65 27.370527895921942 25.11883912934701 22.992244183137352 24.518388791593697 66 25.996490348458263 24.918525946352467 25.41990473802958 23.66507896715969 67 27.116502400808695 24.96841041192823 23.982815264088956 23.932271923174124 68 26.5770423991727 24.767321613236813 24.35367114788004 24.301964839710443 69 26.094229160858657 19.710064120434904 27.822693058265962 26.37301366044048 70 28.785046728971963 0.0 34.13084112149532 37.084112149532714 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 2.5 27 3.0 28 5.5 29 10.0 30 12.0 31 17.5 32 25.5 33 28.0 34 35.5 35 59.0 36 86.5 37 98.0 38 116.0 39 150.0 40 166.0 41 184.5 42 210.0 43 217.0 44 226.5 45 244.5 46 264.5 47 276.0 48 270.0 49 245.5 50 227.0 51 223.5 52 201.5 53 183.0 54 171.0 55 159.5 56 142.5 57 125.0 58 128.0 59 123.0 60 115.0 61 100.5 62 87.0 63 88.0 64 86.0 65 84.0 66 83.0 67 82.0 68 64.0 69 49.0 70 52.0 71 40.5 72 32.0 73 35.0 74 28.5 75 17.0 76 10.0 77 8.0 78 7.5 79 3.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.05 62 0.05 63 0.05 64 0.05 65 0.075 66 0.27499999999999997 67 1.075 68 3.3000000000000003 69 10.325 70 33.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.2763819095477387 0.5499999999999999 3 0.07537688442211055 0.22499999999999998 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455212 spots for ERR5052713.sra Written 455212 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra Read 455211 spots for ERR5052713.sra Written 455211 spots for ERR5052713.sra SRR ids: ['ERR5052713.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rcty0ag_ ERR5052713.sra spots: 9104221 blocks: [[1, 455211], [455212, 910422], [910423, 1365633], [1365634, 1820844], [1820845, 2276055], [2276056, 2731266], [2731267, 3186477], [3186478, 3641688], [3641689, 4096899], [4096900, 4552110], [4552111, 5007321], [5007322, 5462532], [5462533, 5917743], [5917744, 6372954], [6372955, 6828165], [6828166, 7283376], [7283377, 7738587], [7738588, 8193798], [8193799, 8649009], [8649010, 9104221]] ERR5052713 file size 1615963 ERR5052713 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052713 ERR5052713_1.fastq ERR5052713_2.fastq Input file: ERR5052713_1.fastq Paired file: ERR5052713_2.fastq trimmed: ERR5052713-trimmed-pair1.fastq, ERR5052713-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:45:33 2024 >> started Tue Dec 10 05:45:43 2024 >> done (10.528s) 9104221 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 53 ( 0.00%) empty read pairs filtered out after trimming by size control 9104167 (100.00%) read pairs available; of these: 50 ( 0.00%) trimmed read pairs available after processing 9104117 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 2 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 46 0.00% 70 9104117 100.00% 9104167 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=17 prefix-density=0.16 prefix-fanout=3.4 sequence=TGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=335.90 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=13.6 sequence=GCCGCCGCCCGGGAGCGCGCCCGGCCACACCGTGTAGCTGCACTTGTTTACGACGGTGATTGTGGCCGCGTCGGAGAAGAAGGCGGAGAGGAGGACGGCGAGGAGAGGGATGAGGATCACACGAGCAGAGGACGCCATGGAT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.17 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=176.90 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=15.3 sequence=GCCGCCGCCGTC ERR5052713 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:46:35 Started mapping on | Dec 10 05:46:35 Finished on | Dec 10 05:47:45 Mapping speed, Million of reads per hour | 468.21 Number of input reads | 9104167 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 7912711 Uniquely mapped reads % | 86.91% Average mapped length | 138.76 Number of splices: Total | 4033638 Number of splices: Annotated (sjdb) | 3842306 Number of splices: GT/AG | 3977542 Number of splices: GC/AG | 51091 Number of splices: AT/AC | 1716 Number of splices: Non-canonical | 3289 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 102279 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 18385 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.14% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1089177 1089177 1089177 N_multimapping 102279 102279 102279 N_noFeature 247064 7732149 291090 N_ambiguous 162455 745 26193 UnstrandedReadsAssigned:7503192 PositiveStrandReadsAssigned:179817 NegativeStrandReadsAssigned:7595428 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052713 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052713-trimmed-pair1.fastq ERR5052713-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,104,167 reads, 7,697,234 reads pseudoaligned [quant] estimated average fragment length: 205.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52973 ERR5052713.ke.tsv 35125 ERR5052713.se.tsv 88098 total ==> ERR5052713.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 731.99 0 0 PNS24247 1044 839.673 29.1623 6.99118 PNS24249 1928 1723.67 41.2995 4.82314 PNS24246 1044 839.673 29.1623 6.99118 PNS24248 1044 839.673 29.1623 6.99118 PNS24244 1471 1266.67 59.2136 9.41014 PNS24243 293 115.121 0 0 KQK14069 1603 1398.67 6286.63 904.776 KQK14071 474 275.287 218.714 159.93 ==> ERR5052713.se.tsv <== BRADI_1g14170v3 7158 BRADI_1g53295v3 60 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 296 BRADI_1g74790v3 269 BRADI_1g09890v3 0 BRADI_1g77505v3 162 BRADI_1g48960v3 0 ERR5052713 completed mapping pipeline successfully